Characterization of an Enterococcus gallinarum Isolate Carrying a Dual vanA and vanB Cassette

The ability of vancomycin resistance determinants to be horizontally transferred within enterococci species is a concern. Identification and characterization of vancomycin-resistant enterococci (VRE) in a clinical isolate have a significant impact on infection control practices. In this study, we describe a clinical isolate of Enterococcus gallinarum exhibiting high-level resistance to vancomycin and teicoplanin. The genetic characterization of this isolate showed the presence of vanA and vanB genes in addition to the naturally carried vanC gene. vanA was identified on pA6981, a 35,608-bp circular plasmid with significant homology to plasmid pS177. The vanB operon was integrated into the bacterial chromosome and showed a high level of homology to previously reported Tn1549 and Tn5382. To the best of our knowledge, this is the first report of E. gallinarum carrying both vanA and vanB operons, indicating the importance of identifying the vancomycin resistance mechanism in non-E. faecium and non-E. faecalis enterococcal species.     

Emergence of Vancomycin-Resistant Enterococci in Australia: Phenotypic and Genotypic Characteristics of Isolates

Enterococci with resistance to glycopeptides have recently emerged in Australia. We developed multiplex PCR assays for vanA, vanB, vanC1, and vanC2 or vanC3 in order to examine the genetic basis for vancomycin resistance in Australian isolates of vancomycin-resistant Enterococcus faecium and E. faecalis (VRE). The predominant genotype from human clinical E. faecium isolates was vanB. The PCR van genotype was consistent with the resistance phenotype in all but six cases. One vanA E. faecalis isolate had a VanB phenotype, one vanB E. faecium isolate had a VanA phenotype, and four E. faecalis isolates were consistently negative for vanA, vanB, vanC1, and vanC2 or vanC3, even though they exhibited a VanB phenotype. These four isolates were subsequently examined for the presence of vanD by published methods and were found to be negative. No vancomycin-susceptible strains produced a PCR product. On the basis of our findings the epidemiology of VRE in Australia appears to be different from that in either the United States or Europe. Our multiplex PCR assays gave a rapid and accurate method for determining the genotype and confirming the identification of glycopeptide-resistant enterococci. Rapid and accurate methods are essential, because laboratory-based surveillance is critical in programs for the detection, control, and prevention of the transmission of glycopeptide-resistant enterococci.     

Evaluation of species-specific PCR, Bruker MS, VITEK MS and the VITEK 2 system for the identification of clinical Enterococcus isolates

The purpose of this investigation was to compare the performance of species-specific polymerase chain reaction (PCR), matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF MS) and phenotypic identification systems for the identification of Enterococcus species. A total of 132 clinical isolates were investigated by the following: (1) a multiplex real-time PCR assay targeting ddl Enterococcus faecium, ddl Enterococcus faecalis, vanC1 and vanC2/C3 genes, and a high-resolution melting (HRM) analysis of the groESL gene for the differentiation of Enterococcus casseliflavus and Enterococcus gallinarum; (2) Bruker MS; (3) VITEK MS; and (4) the VITEK 2 system. 16S rRNA gene sequencing was used as a reference method in the study. The 132 isolates were identified as 32 E. faecalis, 63 E. faecium, 16 E. casseliflavus and 21 E. gallinarum. The multiplex PCR, Bruker MS and VITEK MS were able to identify all the isolates correctly at the species level. The VITEK 2 system could identify 131/132 (99.2?%) and 121/132 (91.7?%) of the isolates at the genus and species levels, respectively. The HRM-groESL assay identified all (21/21) E. gallinarum isolates and 81.3?% (13/16) of the E. casseliflavus isolates. The PCR methods described in the present study are effective in identifying the enterococcal species. MALDI-TOF MS is a rapid, reliable and cost-effective identification technique for enterococci. The VITEK 2 system is less efficient at detecting non-faecalis and non-faecium Enterococcus species.     

Prevalence,outcome and risk factor associated with vancomycin-resistant Enterococcus faecalis and Enterococcus faecium at a Tertiary Care Hospital in Northern India

Purpose: To determine the prevalence, genotype, risk factors and mortality in patients having vancomycin-resistant Enterococcus faecalis (VR E. faecalis) and Enterococcus faecium (VR E. faecium) infection or colonisation. Materials and Methods: A total of 1488 clinical isolates of E. faecalis and E. faecium were tested for vancomycin resistance by phenotypic (disk diffusion, E-test and broth micro-dilution test) and genotypic polymerase chain reaction methods. Records of all 1488 patients who had E. faecalis or E. faecium infection or colonisation were reviewed for the identification of host, hospital and medication related risk factors associated with VR E. faecalis and VR E. faecium. Results: Of 1488 isolates, 118 (7.9%) were vancomycin-resistant and their distributions were as follows: E. faecalis =72 (61%) and E. faecium =46 (39%). All 118 vancomycin-resistant isolates were vanA genotype (minimum inhibitory concentration [MIC] to vancomycin ≥64 μg/ml and MIC to teicoplanin ≥32 μg/ml) and none of the isolates was vanB genotype. Multivariate logistic regression analysis identified ventilator support and hospital stay for ≥48 h as independent risk factors associated with VR E. faecalis and VR E. faecium infection or colonisation. Hospital stay ≥48 h was the only independent risk factor for mortality in patients infected with vancomycin-resistant enterococci. Conclusions: Strategies to limit the nosocomial infection especially in patients on ventilator support can reduce VRE incidence and related mortality.     

Comparison of Eight Methods To Detect Vancomycin Resistance in Enterococci

A collection of genetically unrelated vancomycin-resistant enterococci (VRE) including 50 vanA, 15 vanB, 50 vanC1, and 30 vanC2 VRE were used to evaluate the accuracy of eight currently available susceptibility test methods (agar dilution, disk diffusion, E-test, agar screen plate, Vitek GPS-TA and GPS-101, and MicroScan overnight and rapid panels). vanA VRE were detected by all methods. vanB VRE were often not detected by Vitek GPS-TA and MicroScan rapid (sensitivities, 47 and 53%, respectively), though the new Vitek GPS-101 was found to be a significant improvement. E-test and the agar screen were the only two methods detecting all VRE, including the vanC1/C2 VRE.     

Prevalence of Vancomycin-Resistant Enterococci in Europe

 The aim of the present study was to determine the prevalence of vancomycin-resistant enterococci (VRE) in Europe. Overall, 49 laboratories in 27 countries collected 4,208 clinical isolates of enterococci. Species identification, susceptibility testing, and van gene determination by polymerase chain reaction were performed in a central laboratory. Overall, 18 vanA and 5 vanB isolates of VRE were found. The prevalence of vanA VRE was highest in the UK (2.7%), while the prevalence of vanB VRE was highest in Slovenia (2%). Most vanA and vanB VRE were identified as Enterococcus faecium. Most VRE isolates originated from the patient's urogenital tract, skin, or digestive tract. VRE were equally distributed among clinical departments, with no clear preponderance in any single patient group. A total of 71 isolates containing the vanC gene were identified. The prevalence of vanC VRE was highest in Latvia and Turkey, where rates were 14.3 and 11.7%, respectively. Two-thirds of these isolates were identified as Enterococcus gallinarum and one-third as Enterococcus casseliflavus; the majority of these isolates were cultured from feces. Almost all isolates were obtained from hospitalized patients, mostly children. The highest prevalence of high-level gentamicin-resistant enterococci was seen in Turkey and Greece. In general, the distribution of this resistance type seemed unrelated to the occurrence of VRE. The prevalence of vanA/vanB VRE in Europe is still low; the majority of the VRE isolates exhibit the vanC genotype and colonize the gastrointestinal tract of hospitalized children.     

Real-time PCR for the rapid detection of vanA,vanB and vanM genes

Background/PurposeTo evaluate the ability of quadruple Taqman probe real-time PCR to the detection of vanA, vanB and vanM in enterococcal isolates.MethodsA total of 343 strains, including 253 vancomycin-resistant enterococcus (VRE) strains and 90 non-VRE strains, were tested by both quadruple Taqman probe real-time PCR and gel-based PCR assay.ResultsWhen differentiating among three genotypes of vanA, vanB and vanM in VRE strains, the sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), diagnostic accuracy and consistency of the quadruple Taqman probe real-time PCR were all 100%. Minimum.Inhibitory concentration (MIC) results showed that there was a wide MIC range of vancomycin and teicoplanin for the strains that harboring vanA/vanM gene respectively or harboring vanA and vanM genes simultaneously. However, the VRE strains with vanB genotype all were sensitive to teicoplanin.ConclusionConsidering the excellent PPV and low NPV, real-time PCR would be useful to monitor VRE-colonized or infected patients. However, further evaluation of the assay's performance in the clinical specimens is required, especially when considering that high level of PCR inhibitors present in these samples.     

Prevalence and antimicrobial resistance pattern of multidrug-resistant enterococci isolated from clinical specimens

Purpose: Vancomycin-resistant enterococci (VRE) pose an emerging problem in hospitals worldwide. The present study was undertaken to determine the occurrence, species prevalence, antibacterial resistance, and phenotypic and genetic characteristics of VRE isolated in Riyadh hospitals, KSA. Materials and Methods: Two hundred and six isolates of enterococcal species were obtained from clinical samples. The antibiotic susceptibility of isolates and minimum inhibitory concentration (MIC) tests for vancomycin and teicoplanin were determined. Molecular typing of VRE isolates was carried out by using pulsed field gel electrophoresis (PFGE) and the resistance genotype was determined by polymerase chain reaction (PCR). Results: VRE accounted for 3.9% of the isolates and were detected mostly in urine, wound and blood specimens isolated from ICU, internal medicine and surgical wards. All strains were identified to species level and were found to consist of E. faecalis (69.2%), E. faecium (11.3%), E. avium (2.1%), E. hirae (0.8%), E. casseliflavus (1.3%) and E. gallinarum (1.3%) species. According to the susceptibility data obtained, 8 (3.9%) out of 206 isolates were found to be VRE (MICs > 32 µg/ml). The vanA, vanB and vanC gene fragments of E. faecalis, E. faecium and E. gallinarum were amplified from isolates and were detected. PFGE patterns of the VRE isolates revealed homogenous patterns with dominant clone suggesting that the strains intrinsic resistance is independent. Conclusions: This study shows an emergence of VRE along with increased rate of multidrug-resistant enterococci in the area of the study. Regular surveillance of antimicrobial susceptibilities should be done regularly and the risk factors should be determined.     

Recovery from a Single Blood Culture of Two Enterococcus gallinarum Isolates Carrying Both vanC-1 and vanA Cluster Genes and Differing in Glycopeptide Susceptibility

 Two Enterococcus gallinarum isolates distinguished by different colony sizes were recovered from the same blood culture from a woman with acute myeloid leukemia. They were designated E31 (the one with larger colonies) and E32 (the one with smaller colonies). Both isolates were glycopeptide resistant, but the MICs of vancomycin and teicoplanin for E31 (32 and 2 μg/ml, respectively, consistent with the VanC phenotype) and E32 (128 and 16 μg/ml, respectively, consistent with the VanA phenotype) were different. E31 and E32 had the same plasmid profile and showed identical pulsed-field gel electrophoresis patterns after digestion of total DNA with NotI and a two-band variation after digestion with SmaI. Polymerase chain reaction experiments showed that both isolates had both the vanC-1 and vanA genes and carried a Tn1546-related transposon lacking orf1, vanY, and vanZ. The absence of these three genes was confirmed by Southern analysis with appropriate probes. Southern hybridization experiments using a vanA probe showed that this atypical Tn1546-related element appeared to be located on the chromosome. In both E31 and E32, the vanA probe hybridized to EcoRV and HindIII fragments larger in size than the hybridizing fragments observed in the VanA prototype strain Enterococcus faecium BM4147, suggesting the lack of the relevant EcoRV and HindIII restriction sites.     

Resistance patterns and occurrence of virulence determinants among GRE strains in southwestern Poland

PurposeThe aim of this study was to determine the antimicrobial resistance and the occurrence of virulence determinants among glycopeptide-resistant enterococci (GRE) isolated in 2007–2009 from patients hospitalized in southwestern Poland.Material and methodsThe minimal inhibitory concentrations (MICs) of antibiotics were determined by agar dilution method or by E-test®. The presence of vanA – vanG resistance and virulence genes (agg, esp, gelE and cylA, cylB, cylM) was investigated using PCR. The ability to form biofilm and the activity of gelatinase, hemolysins, lipase and DNase were tested.ResultsAll the GRE strains were susceptible to linezolid, daptomycin, and tigecycline and resistant to norfloxacin. In the Enterococcus faecium group, 17 strains carried the vanA gene and 20 the vanB gene. In the Enterococcu faecalis group, 4 strains carried the vanA gene and 1 the vanB gene. There were differences in tetracycline susceptibility between the VanA (70%) and the VanB (55%) phenotypes. Only linezolid had high activity against both the VanA and the VanB phenotypes. The esp gene was present in most of the GRE strains, but only 3 E. faecalis strains produced biofilm. Lipase was produced by 10/42 examined strains, gelatinase by 4/42 and hemolysin by 3/42 isolates.ConclusionsLinezolid seems to be the optimal option in empirical therapy of infections caused by GRE strains because of the relationship between its activity (MIC value) and susceptibility breakpoint. There was no correlation between the prevalence of different virulence genes and resistance to the antibiotics tested.     

Low-Level Vancomycin Resistance in Clostridium innocuum

Low-level vancomycin resistance was observed for 28 clinical Clostridium innocuum isolates and C. innocuum NCIB 10674, whereas teicoplanin was active. DNA from three clinical isolates and the type strain could not be amplified by PCR with primers specific for the genes vanA, vanB, and vanC, suggesting that C. innocuum is intrinsically resistant to vancomycin.     

Vancomycin‐resistant enterococci from Portuguese wastewater treatment plants

The objective of this study was to evaluate the incidence of vancomycin resistant enterococci in sludge and sewage of urban and poultry‐slaughterhouse wastewater treatment plants. A total of 17 vancomycin resistant enterococci (eight vanA ‐containing Enterococcus faecium and nine vanC1/vanC2 ‐containing Enterococcus gallinarum/casseliflavus) were found among 499 isolates of sewage and sludge samples of 14 urban and nine poultry‐slaughterhouse wastewater treatment plants. These seventeen VRE isolates showed resistance to kanamycin (n = 8), tetracycline (n = 7), erythromycin (n = 7), ciprofloxacin (n = 7), ampicillin (n = 7), streptomycin (n = 6), and gentamicin (n = 2). The tetM gene, related with tetracycline resistance, was found in six of eight van A‐containing isolates, in all seven vanC‐1 isolates and in one of two vanC‐2 isolates. The ermB gene in seven erythromycin‐resistant isolates; and the aac6 ′‐aph2 ″ gene in the two high‐level‐gentamicin‐resistant isolates. Moreover, two vanA ‐containing E. faecium isolates harbored the hyl virulence gene, and three isolates the entA bacteriocin gene. The purK‐1 allele was detected in our urban vanA ‐containing E. faecium isolate, and we found as well the purK‐6 allele in one poultry‐slaughterhouse vanA ‐containing E. faecium isolate. This study suggests that the wastewater treatment plants might be an important source of dissemination of antibiotic‐resistant enterococci in Portugal. (© 2010 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim)     

Determination of 16S rRNA Sequences of Enterococci and Application to Species Identification of Nonmotile Enterococcus gallinarum Isolates

The 16S rRNA sequences of enterococcal species E. faecium, E. faecalis, E. gallinarum, E. casseliflavus/flavescens, E. dispar, E. pseudoavium, E. sulfureus, E. malodoratus, E. raffinosus, E. cecorum, E. hirae, E. saccharolyticus, E. seriolicida, E. mundtii, E. avium, E. durans, E. columbae, and E. solitarius are presented herein. These data were utilized to confirm the species identification of two nonmotile E. gallinarum isolates which had been previously phenotypically identified as E. faecium. The implications of this finding are discussed.     

VanB phenotype-vanA genotype Enterococcus faecium with heterogeneous expression of teicoplanin resistance

Six VanB phenotype-vanA genotype isolates of Enterococcus faecium with heterogeneous expression of teicoplanin resistance which gave rise to an outbreak at a Korean tertiary care teaching hospital have IS1216V in the coding region of vanS. This could be the underlying cause of the VanB phenotype-vanA genotype with heterogeneous expression of teicoplanin resistance.     

Molecular characterization of vancomycin-resistant enterococci isolated from a hospital in Beijing,China

ObjectiveTo investigate the occurrence of vancomycin-resistant enterococci (VRE) isolated from patients in Peking Union Medical College Hospital, Beijing, China from 2011 to 2017, and to evaluate their resistance mechanisms and genetic relatedness.MethodsAll isolates were identified using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF). Antibiotic susceptibility testing was performed using the broth microdilution method. Molecular characterization were detected by PCR and sequencing. Genotyping of VRE isolates was performed by multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE) analysis. Virulence genes were detected by multiplex PCR.ResultsA total of 87 consecutive VRE were collected, including 84 isolates of vancomycin resistant Enterococcus faecium (VREfm) and 3 isolates of Enterococcus faecalis (VREfs). Urine (40.2%, 35/87) and blood (17.2%, 15/87) were the most commonly specimens. All VREfm isolates were resistant to ampicillin, and were susceptible to daptomycin, linezolid and tigecycline. The resistant rate of teicoplanin was 47.6%. All of the VREfm isolates carried the vanA gene, no isolates carried vanB. 11.9% (10/84) VREfm isolates carried both vanA and vanM. Among them, 76.2% (64/84) and 66.7% (56/84) carried esp and hyl, respectively. The 3 vancomycin resistant E. faecalis (VREfs) isolates were varied, and only one carried vanB. A total of 3 and 18 STs were detected among VREfs and VREfm strains, respectively. PFGE results indicated a genetic diversity among VREfm isolates.ConclusionThis study confirms that VREfm isolates associated with ST78 were the main epidemic lineage responsible for nosocomial infections in China, as were also observed in other nations worldwide.     

Screening of Stool Samples for Identification of Vancomycin-Resistant Enterococcus Isolates Should Include the Methyl-α-dGlucopyranoside Test To Differentiate Nonmotile Enterococcus gallinarum from E. faecium

The methyl-α-d-glucopyranoside (MDG) test has been shown to be superior to motility testing in differentiating Enterococcus faecium from E. gallinarum. In the present study, 33 vancomycin-resistant enterococcus (VRE) isolates collected as part of a stool surveillance study were compared by using motility and MDG. Motility testing identified all 33 isolates as E. faecium, whereas MDG identified 11 of the 33 isolates as nonmotile E. gallinarum. The MDG results were confirmed by sequencing the 16S rDNA V6-to-V8 region. We conclude that the MDG test is a necessary component of routine VRE screening.Enterococci have been shown to be the second most common cause of nosocomial infection in the United States (15). Enterococcus faecalis is responsible for the majority of enterococcal infections, whereas E. faecium, while responsible for significantly fewer infections, is more commonly associated with resistance to beta-lactams, fluoroquinones, and glycopeptides (9, 10) and is associated with greater morbidity and mortality (7). As the prevalence of infections caused by vancomycin-resistant enterococci (VRE) is presently low, the screening of stool for identification of colonizers in high-risk patients is the focus of several epidemiological studies (10, 13). It is critical in such screening studies to differentiate E. faecalis and E. faecium from other enterococcal species, such as E. gallinarum and E. casseliflavus, which do not normally cause human disease but commonly demonstrate intrinsic low-level glycopeptide resistance (1). Recent reports suggest that motility alone as the criterion for differentiating between E. gallinarum and E. faecium (3) is inadequate and may lead to the misidentification of isolates of nonmotile E. gallinarum as E. faecium (5).Recently, Devriese and coworkers have shown the methyl-α-d-glycopyranoside (MDG) test to be reliable and accurate in differentiating E. casseliflavus and E. gallinarum from E. faecalis and E. faecium (4). We were interested in determining the impact of the MDG test using a collection of vancomycin-resistant E. faecium isolates taken from a recent stool surveillance project (10) in which 1,500 enterococcal isolates had been identified to species level with a conventional identification algorithm, not containing MDG (8). The susceptibilities to glycopeptides vancomycin and teicoplanin and the glycopeptide resistance genotypes were also determined (6, 11).Frozen stock cultures of 33 vancomycin-resistant E. faecium isolates (MIC, 4 μg/ml) obtained in the VRE prevalence study were subcultured onto Trypticase soy–5% sheep blood agar and incubated at 37°C for 24 h for MDG testing and PCR lysate preparation. MDG testing of all VRE isolates was performed as previously described by Devriese et al. (4). Enterococcal species identification of each isolate was confirmed by sequencing the V6-to-V8 region (12) of the 16S rDNA which corresponds to bp 929 to 1369 of the Escherichia coli 16S rRNA sequence (2). The following ATCC strains were chosen for sequence determination: E. faecalis ATCC 29212, E. faecium ATCC 35667, E. gallinarum ATCC 35038, and E. casseliflavus ATCC 12755. Thirty-two enterococcal isolates from the stool surveillance project had also been sequenced to confirm the specificity and consistency of all sequences: 9 E. faecium isolates, 10 E. faecalis isolates, 5 E. casseliflavus isolates, and 8 E. gallinarum isolates. Subsequently, sequencing of the V6-V8 region of the 16S rDNAs of all 33 VRE isolates tested for MDG was performed. DNA extracts were prepared by using one or two colonies from the 24-h subcultures. DNA was isolated by using the QIAamp tissue kit (Qiagen, Santa Clarita, Calif.) in accordance with the manufacturer’s protocol. PCR amplification was performed by using universal 16S rDNA gene primers 91E(G) (5′TCAAAGGAATTGACGGGGGC) and 13B (5′AGGCCCGGGAACGTATTCAC) (14). A 50-μl PCR mixture contained 5 μl of DNA template; 5 μl of 25 mM MgCl₂–10× PCR buffer; 1.25 mM each dCTP, dGTP, dATP, and dUTP · dTTP in an 8:1 ratio; 0.5 μl of 100 mM each primer; 0.5 U of uracil DNA glycosylase (GibcoBRL, Burlington, Canada); 2.5 U of Taq DNA polymerase (Pharmacia Biotech, Baie d’Urfé, Canada); and 30 μl of sterile distilled H₂O. The PCR was performed with a Perkin-Elmer GeneAmp PCR System 9600 with cycles of 37°C for 10 min and 95°C for 10 min and 30 cycles of 95, 55, and 72°C for 1 min each and incubated at 72°C for 10 min for final extension.Sequencing reactions were performed with the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems, Foster City, Calif.). The primer used for the sequencing reaction was 91E(G) or 13B diluted 1:100 in Tris-EDTA buffer. Cycle sequencing on the GeneAmp PCR System 9600 was performed, and sequencing analysis was performed with the PE-ABI 373 DNA sequencing system and Software 373 in accordance with the manufacturers’ instructions.The results obtained by MDG testing for all 33 VRE isolates demonstrated that 22 isolates were MDG negative, showing concordance with prior motility-based E. faecium identification. However, 11 VRE isolates tested MDG positive, indicating that they were in fact not E. faecium as originally reported but, instead, nonmotile E. gallinarum (Table ​(Table1).1). These 11 strains all possessed low-level glycopeptide resistance, with vancomycin and teicoplanin MICs of 4 to 8 μg/ml and 0.25 to 0.5 μg/ml, respectively.

TABLE 1

Comparison of MDG testing and species identification using sequencing with conventional testing of 33 VRE (E. faecium) isolates

Significance of methicillin–teicoplanin resistant Staphylococcus haemolyticus in bloodstream infections in patients of the Semmelweis University hospitals in Hungary

The purpose of this study was to quantify the impact of Staphylococcus haemolyticus in the epidemiology of the blood stream infection (BSI) and to characterize the rates and quantitative levels of resistance to antistaphylococcal drugs. During an eight-year period, 2967 BSIs of the patients hospitalized in different clinical departments of the Semmelweis University, Budapest, Hungary were analyzed. One hundred eighty-four were caused by S. haemolyticus, amounting to 6% of all infections. The antibacterial resistance of S. haemolyticus isolates was investigated by the broth microdilution method, vancomycin agar screen, population analysis profile and PCR for mecA, vanA and vanB genes detection. Epidemiological investigation was processed by determining phenotypic antibiotic resistance patterns and PFGE profiles. Extremely high MIC levels of resistance were obtained to oxacillin, erythromycin, clindamycin, gentamicin and ciprofloxacin. The incidence of teicoplanin reduced susceptibility revealed 32% without possessing either the vanA or vanB gene by the strains. PFGE revealed 56 well-defined genotypes indicating no clonal relationship of the strains. The propensity of S. haemolyticus to acquire resistance and its pathogenic potential in immunocompromised patients, especially among preterm neonates, emphasise the importance of species level identification of coagulase-negative staphylococci and routinely determine the MIC of proper antibacterial agents for these isolates.     

Invasive enterococcal infections in Poland: the current epidemiological situation

The aim of this study was to investigate human invasive isolates of enterococci, obtained through prospective surveillance in Poland. The consecutive enterococcal isolates were collected in 30 hospitals between May 2010 and June 2011, and studied by species identification, antimicrobial susceptibility testing and, for Enterococcus faecium by detection of markers specific for the hospital meroclone, multilocus VNTR analysis (MLVA) and multilocus sequence typing (MLST). Additionally, the genomic difference regions (GDRs) characteristic for lineage 78 were searched by PCR. Among 259 isolates, a nearly equal number of Enterococcus faecalis (n?=?140; 54.1 %) and E. faecium (n?=?112; 43.2 %) was found. The observed 14-day mortality rate of infected patients reached 18.1 %. All isolates were susceptible to linezolid and daptomycin. High-level aminoglycoside resistance occurred in over 50 % of isolates. Vancomycin resistance mediated by vanA or vanB was detected in 7.1 % of E. faecium; 71.4 % of isolates were multidrug resistant. E. faecium isolates ubiquitously carried molecular markers of hospital-associated meroclone (IS16, esp _Efm , intA of ICEEfm1) and multilocus sequence typing showed the domination of representatives of lineages 78 and 17/18 (52.7 % and 46.4 %, respectively). Isolates of lineage 78 were significantly enriched in all the GDRs studied. The recent spread of E. faecium from this lineage contributed to the observed increase of E. faecium in enterococcal invasive infections in hospitals in Poland.     

Molecular Epidemiology of Enterococcal Bacteremia in Australia

Enterococci are a major cause of health care-associated infections and account for approximately 10% of all bacteremias globally. The aim of this study was to determine the proportion of enterococcal bacteremia isolates in Australia that are antimicrobial resistant, with particular emphasis on susceptibility to ampicillin and the glycopeptides, and to characterize the molecular epidemiology of the Enterococcus faecalis and Enterococcus faecium isolates. From 1 January to 31 December 2011, 1,079 unique episodes of bacteremia were investigated, of which 95.8% were caused by either E. faecalis (61.0%) or E. faecium (34.8%). The majority of bacteremias were health care associated, and approximately one-third were polymicrobial. Ampicillin resistance was detected in 90.4% of E. faecium isolates but was not detected in E. faecalis isolates. Vancomycin nonsusceptibility was reported in 0.6% and 36.5% of E. faecalis and E. faecium isolates, respectively. Unlike Europe and the United States, where vancomycin resistance in E. faecium is predominately due to the acquisition of the vanA operon, 98.4% of E. faecium isolates harboring van genes carried the vanB operon, and 16.1% of the vanB E. faecium isolates had vancomycin MICs at or below the susceptible breakpoint of the CLSI. Although molecular typing identified 126 E. faecalis pulsed-field gel electrophoresis pulsotypes, >50% belonged to two pulsotypes that were isolated across Australia. E. faecium consisted of 73 pulsotypes from which 43 multilocus sequence types were identified. Almost 90% of the E. faecium isolates were identified as CC17 clones, of which approximately half were characterized as ST203, which was isolated Australia-wide. In conclusion, the Australian Enterococcal Sepsis Outcome Programme (AESOP) study has shown that although they are polyclonal, enterococcal bacteremias in Australia are frequently caused by ampicillin-resistant vanB E. faecium.     

The changing epidemiology of VanB <Emphasis Type="Italic">Enterococcus faecium</Emphasis> in Poland

Increasing prevalence of VanB Enterococcus faecium in Polish hospitals reported to National Reference Centre for Susceptibility Testing (NRCST) prompted us to investigate the basis of this phenomenon. Two-hundred seventy-eight E. faecium isolates of VanB phenotype from the period 1999 to 2010 obtained by NRCST were investigated by multilocus sequence typing (MLST) and multilocus VNTR analysis (MLVA). Localization, transferability, and partial structure of the vanB-carrying Tn1549 transposon were studied by hybridization, PCR mapping, sequencing, and conjugation. VanB isolates almost exclusively represented hospital-associated E. faecium, with a significant shift from representatives of 17/18 lineage to 78 lineage after 2005. The vanB determinant, initially located mostly on transferable plasmids of the pRUM-, pLG1-, and pRE25-replicon types, later on was found almost exclusively on the host chromosome. Fifteen different plasmid and chromosomal insertion sites were identified, typically associated with single transposon coupling sequences, mostly not observed before. Our study demonstrates the significant change in the epidemiology of VanB-E. faecium in Poland, associated with the introduction and spread of the lineage 78 of the hospital-adapted E. faecium. These data point to the importance of the lineage 78 for the spread of vancomycin-resistance, determined by the vanB gene cluster, resulting in an increasing VRE prevalence in hospitals. This study also supports the scenario, in which representatives of the hospital-associated E. faecium independently acquire the vanB determinant de novo and spread within and among hospitals, concomitantly undergoing differentiation.