Identification of Malassezia species

Malassezia spp. are lipophilic unipolar yeasts recognized as commensals of skin that may be pathogenic under certain conditions. The genus Malassezia now comprises of seven species. This study was aimed at using a simple practical approach to speciate Malassezia yeasts from clinical material. Seventy skin scrapings from patients with pityriasis versicolor infection, positive in 10% potassium hydroxide (KOH), were cultured onto modified Dixon's agar (mDixon's agar) and Sabouraud dextrose agar (SDA) and incubated at 32 degrees C. Speciation was done on the basis of Gram stain morphology, catalase test, and utilization of Tweens. Out of 70 scrapings 48 (68.75%) showed growth on mDixon's agar. The commonest isolate was M. sympodialis (28, 58%) followed by M. globosa (19, 40%) and one isolate was (2%) of M. restricta. M. sympodialis was the commonest species affecting our population and there was no isolation of M. obtusa, M. slooffiae, M. pachydermatis and M. furfur.     

Atypical lipid-dependent Malassezia species isolated from dogs with otitis externa

During a survey of the occurrence of Malassezia species in the external ear canals of dogs with chronic otitis externa, lipid-dependent Malassezia species were isolated in three dogs. These species were identified as Malassezia furfur and M. obtusa but showed atypical assimilation patterns. To our knowledge, this is the first report of the isolation of lipid-dependent species of the genus Malassezia in association with canine otitis.     

The Malassezia genus in skin and systemic diseases

In the last 15 years, the genus Malassezia has been a topic of intense basic research on taxonomy, physiology, biochemistry, ecology, immunology, and metabolomics. Currently, the genus encompasses 14 species. The 1996 revision of the genus resulted in seven accepted taxa: M. furfur, M. pachydermatis, M. sympodialis, M. globosa, M. obtusa, M. restricta, and M. slooffiae. In the last decade, seven new taxa isolated from healthy and lesional human and animal skin have been accepted: M. dermatis, M. japonica, M. yamatoensis, M. nana, M. caprae, M. equina, and M. cuniculi. However, forthcoming multidisciplinary research is expected to show the etiopathological relationships between these new species and skin diseases. Hitherto, basic and clinical research has established etiological links between Malassezia yeasts, pityriasis versicolor, and sepsis of neonates and immunocompromised individuals. Their role in aggravating seborrheic dermatitis, dandruff, folliculitis, and onychomycosis, though often supported by histopathological evidence and favorable antifungal therapeutic outcomes, remains under investigation. A close association between skin and Malassezia IgE binding allergens in atopic eczema has been shown, while laboratory data support a role in psoriasis exacerbations. Finally, metabolomic research resulted in the proposal of a hypothesis on the contribution of Malassezia-synthesized aryl hydrocarbon receptor (AhR) ligands to basal cell carcinoma through UV radiation-induced carcinogenesis.     

Identification of Malassezia species isolated from patients with seborrhoeic dermatitis, atopic dermatitis, pityriasis versicolor and normal subjects.

We identified Malassezia species isolated from 42 patients with seborrhoeic dermatitis, 17 patients with atopic dermatitis, 22 patients with pityriasis versicolor, 35 normal subjects and 73 healthy medical students. Regarding the prevalence of Malassezia species in the 35 normal subjects, the frequency of isolation of Malassezia globosa was 22%, M. sympodialis 10% and M. furfur 3%. M. slooffiae, M. pachydermatis, M. restricta and M. obtusa were infrequently isolated from normal skin. Two different species were isolated coincidentally from seven samples. In the patients with atopic dermatitis, M. furfur was isolated more frequently from lesional skin (21%) than non-lesional skin (11%). However, there was no statistical significance. Therefore, this result, by itself, is insufficient to prove that M. furfur should be considered to be an exacerbating factor of atopic dermatitis. In seborrhoeic dermatitis, M. furfur (35%) and M. globosa (22%) were isolated from lesional skin on the face at significantly high rates in comparison with the normal subjects. Therefore, M. furfur and/or M. globosa may be pathogens of seborrhoeic dermatitis. M. globosa was isolated at a frequency of 55% from lesional skin of pityriasis versicolor, while all other species were below 10%. These data suggest that the pathogenic species of pityriasis versicolor is M. globosa.     

New yeast species, Malassezia dermatis, isolated from patients with atopic dermatitis

Malassezia species are considered to be one of the exacerbating factors in atopic dermatitis (AD). During examination of the cutaneous colonization of Malassezia species in AD patients, we found a new species on the surface of the patients' skin. Analysis of ribosomal DNA sequences suggested that the isolates belonged to the genus MALASSEZIA: They did not grow in Sabouraud dextrose agar but utilized specific concentrations of Tween 20, 40, 60, and 80 as a lipid source. Thus, we concluded that our isolates were new members of the genus Malassezia and propose the name Malassezia dermatis sp. nov. for these isolates.     

Distribution of Malassezia species on the skin of patients with psoriasis

IntroductionMalassezia species can induce the expression of interleukin-17 (IL-17), which plays an important role in the inflammatory and immune response in psoriasis (PS). The purpose of this study was to investigate the Malassezia species composition in patients with PS and healthy individuals and explore the role of Malassezia species in the pathogenesis of PS.Materials and methodsA total of 28 patients with PS and 10 age- and sex-matched healthy individuals participated in this study. Specimens collected from the lesional and non-lesional skin of patients with PS and the skin of healthy individuals were analyzed by using nested PCR.ResultsThe relative abundance of Malassezia species was 84.96% in healthy subjects, more than twice that in patients with PS (P < 0.01). M. restricta (43.09%) and M. globosa (41.38%) were the main Malassezia species in patients with PS followed by M. furfur (4.84%) and M. sympodialis (2.49%). M. sympodialis accounted for 18. 81% of the Malassezia species in healthy subjects, which was nearly eight times higher than in patients with PS (P < 0.01). Further, M. furfur was detected both on lesional and non-lesional psoriatic skin, but it was not found on the skin of healthy individuals.ConclusionsThe Malassezia species composition in patients with PS differed from that of healthy individuals. M. restricta and M. globosa were the main Malassezia species in patients with PS.     

Precipitate production by some Malassezia species on Dixon's agar.

The production of a precipitate by Malassezia species on Dixon's agar was observed. Malassezia furfur (n = 12), M. obtusa (n = 2) and M. slooffiae (n = 3) were precipitate negative, while M. sympodialis (n = 32) and M. globosa (n = 6) were precipitate positive. This test may be useful in differentiating Malassezia species.     

Molecular analysis of Malassezia species isolated from three cases of Akatsuki disease (pomade crust)]

Malassezia spp. which normally colonize on the skin surface, are known as being either the cause or an exacerbating factor in a variety of skin conditions, including pityriasis versicolor, folliculitis, seborrheic dermatitis and atopic dermatitis. We report here three cases of Akatsuki disease (pomade crust). Scales and crusts were collected from the lesional skin and analyzed using a PCR-based non-culture method. Malassezia microflora in Akatsuki disease was compared to that of healthy subjects and atopic dermatitis patients. Samples were collected from upper and lower eyelids (Case 1), an operation scar (Case 2) and parietal scalp (Case 3). DNA was extracted from the scales and nested PCR was performed using specific primers for each species. Our analysis detected only M. obtusa and M. slooffiae in Cases 1 and 3 and only M. slooffiae in Case 2. Our previous data indicated that while M. globosa, M. restricta and M. sympodialis were common in healthy subjects, the two aforementioned species were rare, suggesting that the presence of M. obtusa and M. slooffiae in the subjects in the present study is correlated to the pathogenesis of Akatsuki disease.     

Assimilation test of Malassezia furfur isolated from the environment]

The lipophilic yeasts Malassezia species are the causative agents of tinea versicolor and known also to be a member of normal skin flora. They are commonly isolated from the skin of humans and animals, but not from the environment. This is the first report of the isolation of Malassezia sp. from the environment (a hospital floor). The results of assimilation tests of lipids and karyotyping showed that these isolates were M. furfur. They assimilated not only lipids including floor wax and car wax but also some ointments (except antifungal agents) used clinically. The results suggest that we need to take care when using such ointments to treat skin diseases.     

DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.     

Molecular differentiation of seven Malassezia species

A system based on PCR and restriction endonuclease analysis was developed to distinguish the seven currently recognized Malassezia species. Seventy-eight strains, including authentic culture collection strains and routine clinical isolates, were investigated for variation in the ribosomal DNA repeat units. Two genomic regions, namely, the large subunit of the ribosomal gene and the internal transcribed spacer (ITS) region, were amplified by PCR, and products were digested with restriction endonucleases. The patterns generated were useful in identification of five out of seven Malassezia species. M. sympodialis was readily distinguishable in that its ITS region yielded a 700-bp amplified fragment, whereas the other six species yielded an 800-bp fragment. M. globosa and M. restricta were very similar in the regions studied and could be distinguished only by performing a hot start-touchdown PCR on primers for the beta-tubulin gene. Primers based on the conserved areas of the Candida cylindracea lipase gene, which were used in an attempt to amplify Malassezia lipases, yielded an amplification product after annealing at 55 degrees C only with M. pachydermatis. This specific amplification may facilitate the rapid identification of this organism.     

Identification of Brucella species isolated from proven brucellosis patients in Izmir, Turkey

In many parts of the world, brucellosis has significantly decreased, but it is still a problem in some regions of Turkey. Totally, 11 Brucella strains isolated from the blood cultures of patients with presumptive diagnosis of brucellosis were identified to species and biovar level. For species identification, (i) CO2 requirements of isolates; (ii) detection of urease activation; (iii) detection of H2S production; (iv) dye sensitivities (thionine and basic fuchsin); (v) susceptibility to Brucella phage and (vi) agglutination with monospecific antisera (A and M) were performed. Ten out of 11 isolates were identified as B. melitensis biovar 3 and one out of 11 were identified as B. melitensis biovar 1. The sensitivity of isolates to antibiotics was determined by the E-test. All isolates were found to be sensitive to doxycycline, rifampin, ciprofloxacin and cephtriaxone. Only one out of 11 isolates was found to be semi-sensitive to trimethoprim/sulfamethoxazole (cotrimoxazole).     

Porphyrins and nucleic acid in some photosensitive skin diseases

This study was suggested to evaluate the possible role of porphyrins and DNA, and their interaction, in some photosensitive premalignant and malignant dermatoses. Twenty-five patients with photosensitive skin diseases viz. xeroderma pigmentosum and basal cell carcinoma, were randomly selected at the outpatient clinic of Dermatology in Mansoura University Hospital. Twenty-five matched normal individuals were used as a control group. In basal cell carcinoma patients, a high increase in skin DNA and decrease in skin total porphyrin, haemoglobin and haem concentrations were observed. In xeroderma pigmentosum, a significant decrease in both skin DNA and skin total porphyrin were found, at the same time, there were elevations in urinary total porphyrin, PBG and ALA concentrations, and a high decrease in haemoglobin and haem levels.