Genetic variations and haplotypes of CYP2C19 in a Japanese population

Forty-eight single nucleotide variations, including 27 novel ones, were found in the 5'- regulatory region, all of the exons and their surrounding introns of CYP2C19 in 253 Japanese subjects (134 diabetic patients and 119 healthy volunteers). Identified novel variations were as follows: -2772G>A, 2767_-2760delGGTGAACA, -2720T>C, -2547delG, -2545G>T, -2545_-2544 delGC, and -2040C>T in the enhancer region; -778C>T, -777G>A, -529G>C, -189C>A, and -185A>G in the promoter region; 151A>G (S51G), 481G>C (A161P), 986G>A (R329H), 1078G>A (D360N), and 1119C>T (D373D) in the exons, and IVS1+128T>A, IVS3+163G>A, IVS4+271A>G, IVS5-49A>G, IVS6-210C>T, IVS6-196T>A, IVS6-32T>A, IVS7+84G>A, IVS7-174C>T, and IVS8+64C>T in the introns. Since we found no significant differences in the variation frequencies between healthy volunteers and diabetic patients, the data for all subjects were treated as one group in further analysis. The allele frequencies were 0.265 for IVS6-196T>A, 0.045 for -2772G>A and -2720T>C, 0.024 for -2040C>T, 0.014 for IVS7-174C>T, 0.010 for -529G>C, 0.006 for IVS1+128T>A and 481G>C (A161P), 0.004 for -2767_-2760delGGTGAACA and IVS6-210C>T, and 0.002 for the other 17 variations. In addition, the two known nonsynonymous single nucleotide polymorphisms, 681G>A (splicing defect, (*)2 allele) and 636G>A (W212X; (*)3 allele) were detected at 0.267 and 0.128 frequencies, respectively. No variation was detected in the known binding sites for constitutive androstane receptor and glucocorticoid receptor. Linkage disequilibrium analysis showed several close linkages of variations throughout the gene. By using the variations, thirty-one haplotypes of CYP2C19 and their frequencies were estimated. Our results would provide fundamental and useful information for genotyping CYP2C19 in the Japanese and probably other Asian populations.     

Eight novel single nucleotide polymorphisms in ABCG2/BCRP in Japanese cancer patients administered irinotacan

Eight novel single nucleotide polymorphisms (SNPs) were found in the gene encoding the ATP-binding cassette transporter, ABCG2/BCRP, from 60 Japanese individuals administered the anti-cancer drug irinotecan. The detected SNPs were as follows: 1) SNP, MPJ6_AG2005 (IVS2-93T>C); Gene Name, ABCG2; Accession Number, NT_006204; 2) SNP, MPJ6_AG2007 (IVS3+71_72 insT); Gene Name, ABCG2; Accession Number, NT_006204; 3) SNP, MPJ6_AG2012 (IVS6-204C>T); Gene Name, ABCG2; Accession Number, NT_006204; 4) SNP, MPJ6_AG2015 (at nucleotide 1098G>A (exon 9) from the A of the translation initiation codon); Gene Name, ABCG2; Accession Number, NT_006204; 5) SNP, MPJ6_AG2017 (1291T>C (exon 11)); Gene Name, ABCG2; Accession Number, NT_006204; 6) SNP, MPJ6_AG2019 (IVS11-135G>A); Gene Name, ABCG2; Accession Number, NT_006204; 7) SNP, MPJ6_AG2020 (1465T>C (exon 12)); Gene Name, ABCG2; Accession Number, NT_006204; 8) SNP, MPJ6_AG2023 (IVS13+65T>G); Gene Name, ABCG2; Accession Number, NT_006204.MPJ6_AG2015 was a synonymous SNP (E366E). MPJ6_AG2017 and MPJ6_AG2020 resulted in amino acid alterations, F431L and F489L, respectively.     

Novel nonsynonymous single nucleotide polymorphisms in the CYP2D6 gene

Cytochrome P450 (CYP) 2D6 is an important drug-metabolizing enzyme, and its gene is known to be highly polymorphic. Here, we report five novel nonsynonymous single nucleotide polymorphisms (SNPs), and 65 other sequence variations detected from the gene coding for cytochrome P450 (CYP) 2D6 in 254 Japanese subjects. Two of the novel nonsynonymous SNPs were associated with the *10 key SNP, C100T. Among the 65 variations, 23 were novel, including 12 SNPs in 5'-flanking, 1 in 5'-untranslated, and 10 in intronic regions. The nonsynonymous SNPs in the CYP2D6 gene were as follows: 73 C>T (Arg25Trp, exon 1), 972 C>T (Ala90Val, exon 2), 1611 T>A (Phe120Ile, exon 3), 1720 A>C (Glu156Ala, exon 3), 3172 A>C (Glu334Ala, exon 7). The SNPs, 73C>T, 972 C>T, 1611 T>A, 1720 A>C and 3172 A>C were linked with *10, *1, *10, *1 and *2, respectively.     

Two novel haplotypes of CYP2D6 gene in a Japanese population

Two novel haplotypes of CYP2D6 were found in Japanese subjects. One haplotype of the human CYP2D6 gene, newly designated as CYP2D6(*)44 allele, had both a novel single nucleotide polymorphism (SNP) of 2950G>C in intron 6 donor splice junction and a known SNP (82CG, -1235A>G, -740C>T, -678G>A, and a gene conversion with CYP2D7 gene in intron 1 associated with CYP2D6(*)21. Both CYP2D6(*)44 and CYP2D6(*)21B alleles would cause a splicing error or a frameshift with impaired drug metabolizing function mediated by CYP2D6.     

Fourteen novel single nucleotide polymorphisms in the SLC22A2 gene encoding human organic cation transporter (OCT2)

Thirty-three genetic variations including fourteen novel ones were found in the SLC22A2 gene from 116 Japanese individuals. The novel variations were as follows: 596C>T (MPJ6_OC2003), 602C>T (MPJ6_OC2004), IVS5+20A>G (MPJ6_OC2010), IVS5-84_-83insG (MPJ6_OC2013), IVS6+30T>C (MPJ6_OC2014), IVS6+146G>T (MPJ6_OC2016), IVS6+179G>T (MPJ6_OC2017), IVS6-16delT (MPJ6_OC2018), 1920G>A (MPJ6_OC2022), 2153G>A (MPJ6_OC2026), 2157C>T (MPJ6_OC2028), 2306T>C (MPJ6_OC2031), 2342+5T>C (the last nucleotide number of mRNA+the position in the 3'-flanking region; MPJ6_OC2032) and 2342+127T>C (MPJ6_OC2033). Six variations were located in the exons, four of which were in the 3'-untranslated region (3'-UTR) of exon 11; six were in the introns; and two were in the 3'-flanking region. The frequencies were 0.802 for IVS5-84_-83insG, 0.013 for 602C>T, 0.009 for 596C>T, and 0.004 for the other 11 variations. Among them, 596C>T and 602C>T resulted in amino acid substitutions (Thr199Ile and Thr201Met, respectively).     

Seven novel single nucleotide polymorphisms in the human SLC22A1 gene encoding organic cation transporter 1 (OCT1)

Twenty genetic variations, including seven novel ones, were found in the human SLC22A1 gene, which encodes organic cation transporter 1, from 116 Japanese individuals. The novel variations were as follows: -94C>A in the 5'-untranslated region (A of the translation start codon is numbered +1 in the cDNA sequence; MPJ6_OC1001), 350C>T (MPJ6_OC1004), IVS1-35T>C (MPJ6_OC1006), 561G>A (MPJ6_OC1010), IVS6+75C>G (MPJ6_OC1014), IVS8+108A>G (MPJ6_OC1017), and 1671_1673delATG (MPJ6_OC1020). The frequencies were 0.082 for IVS1-35T>C, 0.022 for IVS6+75C>G, 0.009 for 561G>A, and 0.004 for the other 4 variations. Among them, 350C>T resulted in the amino acid substitution Pro117Leu, which is located in the large extracellular loop between transmembrane domains 1 and 2. Also, we detected the four previously reported nonsynonymous variations, 123C>G (Phe41Leu), 480C>G (Phe160Leu), 1022C>T (Pro341Leu), and 1222A>G (Met408Val) with frequencies of 0.004, 0.086, 0.168, and 0.810, respectively.     

Genetic polymorphisms of UGT1A6 in a Japanese population

Thirteen single nucleotide polymorphisms (SNPs), including 6 novel ones, were found in exon 1 and its flanking region of UDP-glucuronosyltransferase (UGT) 1A6 from 195 Japanese subjects. Several novel SNPs were identified, including 269G>A (R90H), 279A>G (S93S), and 308C>A (S103X) in exon 1, and IVS1+109C>T, IVS1+120A>G, and IVS1+142C>T in the intron downstream of exon 1. Among these SNPs, 308C>A confers termination of translation at codon 103, resulting in the production of an immature protein that probably lacks enzymatic activity. The allele frequencies were 0.003 for all the 6 SNPs. In addition, the 3 known nonsynonymous SNPs were detected: 19T>G (S7A), 541A>G (T181A), and 552A>C (R184S) with frequencies of 0.226, 0.218, and 0.226, respectively. High linkage disequilibrium was observed among 19T>G (S7A), 315A>G (L105L), 541A>G (T181A), 552A>C (R184S), and IVS1+130G>T, as reported in Caucasian and African-American populations. Then, 11 haplotypes in UGT1A6 were estimated. The novel nonsynonymous variant, 269A or 308A, was shown to be located on the same DNA strand together with 19G, 315G, 541G, 552C, and IVS1+130T. Our results provide fundamental and useful information for genotyping UGT1A6 in the Japanese, and probably Asian populations.     

Twenty novel genetic variations and haplotype structures of the DCK gene encoding human deoxycytidine kinase (dCK)

Deoxycytidine kinase (dCK) is a rate-limiting enzyme in the activation of nucleoside anticancer drugs, such as gemcitabine and cytarabine (Ara-C), to their active metabolites. In this study, the 5'-flanking region, 7 exons and their flanking introns of DCK were comprehensively screened for genetic variations in 256 Japanese cancer patients administered gemcitabine. Twenty-nine genetic variations, including twenty novel ones, were found: 11 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 1 in the coding exon, 9 in the 3'-UTR, and 7 in the introns. The novel variations included -1110C>T, -757G>A, -639C>T, -465G>A, -402T>C, -224C>A, -199C>G, IVS1+38G>T, IVS2+78_+83delTTTTTC, IVS3-9C>T, IVS4+12T>C, IVS5+39T>C, 1357A>G, 1545A>T, 1572delA, 1736G>A, 1749G>A, 1838T>C, 1889G>A, and 2048A>T. The frequencies were 0.01 for IVS2+78_ +83delTTTTTC, 0.008 for -402T>C, 0.006 for -639C>T and IVS4+12T>C, 0.004 for -757G>A and 1572delA, and 0.002 for the other 14 variations. A known nonsynonymous SNP 364C>T (Pro122Ser) was detected at a 0.061 frequency. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 24 haplotypes were identified or inferred. Our findings suggest considerable ethnic differences in genetic variations of DCK and provide fundamental and useful information for genotyping DCK in the Japanese and probably other Asian populations.     

Genetic variations and haplotypes of UGT1A4 in a Japanese population

Nineteen genetic variations, including 11 novel ones, were found in exon 1 and its flanking region of the UDP-glucuronosyltransferase (UGT) 1A4 gene from 256 Japanese subjects, consisting of 60 healthy volunteers, 88 cancer patients and 108 arrhythmic patients. These variations include -217T>G and -36G>A in the 5'-flanking region, 30G>A (P10P), 127delA (43fsX22; frame-shift from codon 43 resulting in the termination at the 22nd codon, codon 65), 175delG (59fsX6), 271C>T (R91C), 325A>G (R109G), and 357T>C (N119N) in exon 1, and IVS1+1G>T, IVS1+98A>G and IVS1+101G>T in the following intron. Among them, 127delA and 175delG can confer early termination of translation, resulting in an immature protein that probably lacks enzymatic activity. Variation IVS1+1G>T is located at a splice donor site and thus may lead to aberrant splicing. Since we did not find any significant differences in the frequencies of all the variations among the three subject groups, the data were analyzed as one group. The allele frequencies of the novel variations were 0.006 for IVS1+101G>T, 0.004 for 30G>A (P10P) and 357T>C (N119N), and 0.002 for the 8 other variations. In addition, the two known nonsynonymous single nucleotide polymorphisms (SNPs), 31C>T (R11W) and 142T>G (L48V), were found at 0.012 and 0.129 frequencies, respectively. The SNP 70C>A (P24T), mostly linked with 142T>G (L48V) in German Caucasians, was not detected in this study. Sixteen haplotypes were identified or inferred, and some haplotypes were confirmed by cloning and sequencing. It was shown that most of 142T>G (L48V) was linked with -219C>T, -163G>A, 448T>C (L150L), 804G>A (P268P), and IVS1+43C>T, comprising haplotype *3a; haplotype *4a harbors 31C>T (R11W); 127delA (43fsX22) and 142T>G (L48V) were linked (haplotype *5a); 175delG (59fsX6) was linked with 325A>G (R109G) (*6a haplotype); and -219C>T, -163G>A, 142T>G (L48V), 271C>T (R91C), 448T>C (L150L), 804G>A (P268P), and IVS1+43C>T comprised haplotype *7a. Our results provide fundamental and useful information for genotyping UGT1A4 in the Japanese and probably Asian populations.     

Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1)

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.     

A silent mutation (2939G>A, exon 6; CYP2D6*59) leading to impaired expression and function of CYP2D6

We analyzed CYP2D6 in two individuals characterized by impaired sparteine oxidation (intermediate metabolizer phenotype) and genotype 2D62/4 (1661G>C; 2850C>T; 4180G>C) usually associated with normal function. Full genomic sequencing and haplotype analysis confirmed the previously identified silent mutation 2939G>A in exon 6 (former allele variant 2D62J, now termed 2D659), as well as an additional novel 2291G>A change in intron 4. Transient expression in Huh7 hepatoma cells of the entire CYP2D6 gene of constructs carrying either both or only the 2939G>A change resulted in about three-fold reduced levels of mRNA, immunoreactive 2D6 protein and propafenone hydroxylase activity. These data demonstrate profound effects of a silent mutation on expression and function of CYP2D6, resulting in impaired drug oxidation phenotype. The 2939G>A single nucleotide polymorphism in exon 6 was present heterozygously in two individuals out of 308 (0.65%), corresponding to an allele frequency of 0.3%. Genotyping for this mutation thus improves phenotype-genotype correlation for CYP2D6 and may help to predict adverse drug treatment events.     

Twelve novel single nucleotide polymorphisms in the CES2 gene encoding human carboxylesterase 2 (hCE-2)

Twelve novel single nucleotide polymorphisms (SNPs) were found in the CES2 gene from 153 Japanese individuals, who were administered irinotecan or steroidal drugs. The detected SNPs were as follows:1) SNP, MPJ6_CS2001; GENE NAME, CES2; ACCESSION NUMBER, NT_010498.13; LENGTH, 25 bases; 5'-CTGGAACAACTCG/CCTCCCCTCGGAA-3'. 2) SNP, MPJ6_CS2002; GENE NAME, CES2; ACCESSION NUMBER, NT_010498.13; LENGTH, 25 bases; 5'-AACCACCACCGCT/CGATCCTAGCAGG-3'. 3) SNP, MPJ6_CS2003; GENE NAME, CES2; ACCESSION NUMBER, NT_010498.13; LENGTH, 25 bases; 5'-AAATGTTTGTCAA/GGTGGATAAATGA-3'. 4) SNP, MPJ6_CS2004; GENE NAME, CES2; ACCESSION NUMBER, NT_010498.13; LENGTH, 25 bases; 5'-CCTCCTATCGATC/GCCCCAGCGCGCT-3'. 5) SNP, MPJ6_CS2005; GENE NAME, CES2; ACCESSION NUMBER, NT_010498.13; LENGTH, 25 bases; 5'-GCCAGTCCCATCC/TGGACCACACACA-3'. 6) SNP, MPJ6_CS2006; GENE NAME, CES2; ACCESSION NUMBER, NT_010498.13; LENGTH, 25 bases; 5'-GCTGGGCAACCCG/AGGCTGAGCGGGG-3'. 7) SNP, MPJ6_CS2007; GENE NAME, CES2; ACCESSION NUMBER, NT_010498.13; LENGTH, 25 bases; 5'-CAAGCACGCAACC/TGGCAACTGGGGC-3'. 8) SNP, MPJ6_CS2008; GENE NAME, CES2; ACCESSION NUMBER, NT_010498.13; LENGTH, 25 bases; 5'-CATGGAGAGTGGC/TGTGGCCCTCCTG-3'. 9) SNP, MPJ6_CS2009; GENE NAME, CES2; ACCESSION NUMBER, NT_010498.13; LENGTH, 25 bases; 5'-CCTGTTCTTGGCC/TAGGGCCTTGGGC-3'. 10) SNP, MPJ6_CS2010; GENE NAME, CES2; ACCESSION NUMBER, NT_010498.13; LENGTH, 25 bases; 5'-CCCATCCCCAGCT/AACAGACTCTCTC-3'. 11) SNP, MPJ6_CS2011; GENE NAME, CES2; ACCESSION NUMBER, NT_010498.13; LENGTH, 25 bases; 5'-TCCACCTGGGGTA/GGATGTTGCCTCC-3'. 12) SNP, MPJ6_CS2013; GENE NAME, CES2; ACCESSION NUMBER, NT_010498.13; LENGTH, 25 bases; 5'-GGACTGGGGACCG/AAGGTCTCGGGGG-3'The frequencies were 0.029 for MPJ6_CS2004 and CS2013, 0.026 for MPJ6_CS2009, 0.013 for MPJ6_CS2001, 0.007 for MPJ6_CS2003, and 0.003 for the other 7 SNPs. Among these SNPs, MPJ6_CS2005 (100C>T) resulted in an amino acid alteration (R34W), and MPJ6_CS2007 (579C>T) and MPJ6_CS2008 (765C>T) were synonymous (T193T and G255G, respectively). Furthermore, MPJ6_CS2011 (IVS8-2A>G) resulted in variation at ther 3' splice acceptor site.     

Characterization of novel CYP2A6 polymorphic alleles (CYP2A6*18 and CYP2A6*19) that affect enzymatic activity.

Genetic polymorphisms of CYP2A6 gene are known as a causal factor of the interindividual differences in nicotine metabolism. We found three novel CYP2A6 alleles. The CYP2A6(*)18A allele has a single nucleotide polymorphism (SNP) of A5668T (A1175T, Y392F) in exon 8. The CYP2A6(*)18B allele has synonymous SNPs of G51A (G51A), T5684C (T1191C), and T5702C (T1209C) in addition to A5668T (A1175T, Y392F). The CYP2A6(*)19 allele has the SNPs of A5668T (A1175T, Y392F), T6354C (intron 8), and T6558C (T1412C, I471T) as well as the conversion with the CYP2A7 sequence in the 3'-untranslated region, in which the latter two changes correspond to CYP2A6(*)7. Ethnic differences in the frequencies of these alleles were observed between whites, African-Americans, Japanese, and Koreans. Wild or variant CYP2A6 (CYP2A6(*)18, CYP2A6(*)19, and CYP2A6(*)7) were expressed in Escherichia coli. For coumarin 7-hydroxylation and 5-fluorouracil formation from tegafur, the K(m) values were increased, and V(max) values were decreased in CYP2A6.18 compared with those in CYP2A6.1, resulting in decreased clearance to 50 and 35% of that of the wild type, respectively. The K(m) and V(max) values for nicotine C-oxidation were both increased, resulting in no change of clearance. In CYP2A6.19, the effects on the coumarin 7-hydroxylation and 5-fluorouracil formation (increased K(m) and decreased V(max)) were prominent, resulting in decreased clearance to 8% of those of the wild type. For nicotine C-oxidation, the K(m) and V(max) values were both decreased, resulting in decreased clearance to 30% of that of the wild type. The changes of the kinetics in CYP2A6.19 were similar to those in CYP2A6.7. In vivo nicotine metabolism was evaluated in whites (n = 56) and Koreans (n = 40). Although the CYP2A6(*)18 and CYP2A6(*)19 alleles were found only heterozygously, a subject with CYP2A6(*)7/CYP2A6(*)19 showed a lower cotinine/nicotine ratio of the plasma concentration compared with homozygotes of the CYP2A6(*)1A, supporting the in vitro results that the CYP2A6(*)19 allele leads to decreased enzymatic activity.     

Single nucleotide polymorphisms of ABCB1 (MDR1) gene and distinct haplotype profile in a West Black African population

Objective The ABCB1 (MDR1) multidrug transporter plays a key role in determining drug bioavailability. Differences in drug response exist among different ethnic groups. However, until now, no haplotype data are available in a Black African population.Methods Exons 2, 7, 10, 11, 12, 14, 17, 21, 26, and the surrounding intronic regions were sequenced using genomic DNA from 111 Beninese subjects to examine 19 intragenic single nucleotide polymorphisms (SNPs). Linkage disequilibrium analysis and haplotypes were generated using the expectation–maximization algorithm.Results We identified 12 SNPs, 3 of which were novel: IVS9-57delA, IVS9-8T>A, 1662G>C (exon 14). The most common SNP was IVS14+38A>G. At the MRD1 locus, 53 haplotypes were inferred from the SNP data sets. The 4 SNPs, IVS6+139C>T, IVS9-44A>G, 1236C>T, and 3435C>T, showed strong linkage disequilibrium with each other, confirming the block concept. Moreover, our findings suggest that ABCB1 exonic SNPs are less frequently observed in our population than in African-Americans.Conclusion Our data are compatible with a close evolutionary relationship in Black Africans from Benin.     

Search for the molecular basis of ultra-rapid CYP2C9-catalysed metabolism: relationship between SNP IVS8-109A>T and the losartan metabolism phenotype in Swedes

Aim

To search for a relationship between ultra-rapid metabolism catalysed by cytochrome P450 2C9 (CYP2C9) and its genotypes.

Methods

DNA from a Swedish ultra-rapid metaboliser patient [losartan metabolic ratio (MR) <0.13] and three healthy Swedes with normal CYP2C9 activity and a MR of about 1 were assessed for variation in the CYP2C9 gene. Direct DNA sequencing was performed for all exons and exon–intron junctions and also for ?2100?bp of the 5′-flanking regions of the CYP2C9 gene. This analysis revealed four intronic mutations [single nucleotide polymorphisms (SNPs) 1–4] in the three samples with normal MR while no variation was observed in the ultra-rapid metaboliser. PCR/restriction fragment length polymorphism and allele-specific PCR methods were subsequently developed to screen 85 Swedes and 128 Koreans without CYP2C9*2 or *3.

Results

We found a significant relationship between SNP 4 (IVS8-109A>T) and CYP2C9 activity (χ²-test, p?=?0.011) in the Swedes. Twenty Swedes with the lowest MR were compared with 20 Swedes with the highest MR, revealing a strong association (p?=?0.001) between SNP4 and higher MR. For homozygous SNP 1 (IVS1+83T>C), SNP 2 (IVS2+73T>C), and SNP 3 (IVS6+95A>G), no phenotype and genotype relationships were found, but the MR was generally higher among the Swedes compared to the Koreans (Mann–Whitney test, p?Conclusions We found that the SNP 4 IVS8-109T allele is associated with a higher CYP2C9 MR in healthy Swedish subjects, but further investigations need to be carried out to establish a molecular explanation for ultra-rapid CYP2C9-catalysed metabolism. Haplotype based on SNPs 1–4 did not seem to contribute to variation in the MR of the Korean subjects nor play a role in determining the MR of the Swedish ones.     

Fourteen novel genetic variations and haplotype structures of the TYMS gene encoding human thymidylate synthase (TS)

Forty genetic variations including 14 novel ones were found in the human TYMS gene, which encodes thymidylate synthase, in 263 Japanese cancer patients who received 5-fluorouracil (FU)-based chemotherapy. Three novel variations were located within the 28-bp tandem repeat sequence in the 5'-untranslated region (UTR) and were designated 5Rc, 3Rc-ins and 4Rc. Allele frequencies were 0.021 for 5Rc, 0.006 for 3Rc-ins and 0.002 for 4Rc. Other novel variations included -133G>C and -125G>C in the 5'-UTR; IVS1-278G>A, IVS2-68C>T, IVS2-23T>C, IVS4+122_+123insATTG, IVS4-141G>A, IVS5-100A>T and IVS6-111G>A in the introns; and 1244(*302)A>G and 1264(*322)G>A in the 3'-UTR. The allele frequencies were 0.34 for IVS4+122_+123insATTG, 0.042 for -133G>C, 0.011 for IVS4-141G>A, 0.006 for -125G>C, 0.004 for IVS1-278G>A, IVS2-68C>T, 1244(*302)A>G and 1264(*322)G>A, and 0.002 for IVS2-23T>C, IVS5-100A>T and IVS6-111G>A. Using the detected polymorphisms, linkage disequilibrium (LD) analysis was performed, which divided the TYMS gene into three LD blocks. The 28-bp tandem repeat sequence in the 5'-UTR was assigned as Block 2 with a total of 7 alleles. In Blocks 1 and 3, 7 and 19 haplotypes were determined/inferred, respectively. Our findings provide fundamental and useful information for genotyping TYMS in the Japanese and probably other Asian populations.     

Five novel single nucleotide polymorphisms in the CYP2C8 gene, one of which induces a frame-shift

Five novel single nucleotide polymorphisms (SNPs) were found in exon 3 and introns 1, 3, 7, and 8 in cytochrome P450 (CYP) 2C8 gene from 54 Japanese individuals, who were administered the anti-arrhythmic drug amiodarone. The detected SNPs were as follows: 1) SNP, MPJ6_2C8014; GENE NAME, CYP2C8; ACCESSION NUMBER, NT_008769; LENGTH, 25 bases; 5'-ATTCAGAAATATC/TGAATCTATGTGT-3' 2) SNP, MPJ6_2C8015; GENE NAME, CYP2C8; ACCESSION NUMBER, NM_000770 and NT_008769; LENGTH, 25 bases; 5'-GGAGGAGTTGAGA/-AAAACCAAGGGT-3'. 3) SNP, MPJ6_2C8016; GENE NAME, CYP2C8; ACCESSION NUMBER, NT_008769; LENGTH, 25 bases; 5'-ATTTGTAAGATAT/-TGTTTAAAATTT-3' 4) SNP, MPJ6_2C8017; GENE NAME, CYP2C8; ACCESSION NUMBER, NT_008769; LENGTH, 25 bases; 5'-TTGGTTCCAACCC/TTCTAACAACACA-3' 5) SNP, MPJ6_2C8018; GENE NAME, CYP2C8; ACCESSION NUMBER, NT_008769; LENGTH, 25 bases; 5'-GATAGCAAATATA/GTCTCTTTTTGTA-3' Among these SNPs, MPJ6_2C8015 was expected to cause a frame-shift due to the deletion of adenine 471, resulting in amino acid alterations from codon 159 and an early stop codon at residue 177. Therefore, the variant enzyme is most likely to be inactive since it lacks 64% of the protein structure, including the heme-binding site and 5 out of 6 substrate recognition sites.     

Three novel single nucleotide polymorphisms of the human thiopurine S-methyltransferase gene in Japanese individuals

In this study, the entire coding sequence and the exon-intron junctions of the thiopurine S-methyltransferase (TPMT) gene from 200 Japanese individuals were screened for mutation. Three novel single nucleotide polymorphisms (SNPs) were identified-106G>A in exon 3 (Gly36Ser, *20 allele), 967A>G in 3'-untranslated region, and -87C>T in intron 8. The allele frequencies were 0.003 for 106G>A, 0.003 for 967A>G, and 0.010 for IVS8 -87C>T. In addition, the three known SNPs, 474T>C (Ile158Ile), 719A>G (Tyr240Cys, *3C allele), and IVS4 +35C>T were detected at frequencies of 0.299, 0.010, and 0.421, respectively.     

Twelve novel single nucleotide polymorphisms in ABCB1/MDR1 among Japanese patients with ventricular tachycardia who were administered amiodarone

Twelve novel single nucleotide polymorphisms (SNPs) were found in the gene encoding the ATP-binding cassette transporter, P-glycoprotein, from 60 Japanese individuals who were administered the anti-antiarrythmic drug, amiodarone. The detected SNPs were as follows: 1) SNP, MPJ6_AB1017 (IVS6-109); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 2) SNP, MPJ6_AB1018 (IVS7+14); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 3) SNP, MPJ6_AB1021 (IVS9-44); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 4) SNP, MPJ6_AB1052 (IVS12+17); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 5) SNP, MPJ6_AB1029 (IVS15-69); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 6) SNP, MPJ6_AB1040 (IVS24+16); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 7) SNP, MPJ6_AB1053 (IVS27-189); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 8) SNP, MPJ6_AB1054 (IVS27-172); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 9) SNP, MPJ6_AB1048 (IVS27-167); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 10) SNP, MPJ6_AB1055 (IVS27-152); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 11) SNP, MPJ6_AB1049 (IVS27-119); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 12) SNP, MPJ6_AB1051 (at nucleotide 3751 (exon 28) from the A of the translation initiation codon); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168. Among these SNPs, only MPJ6_AB1051 resulted in an amino acid alteration, V1251I.