CD73 is a phenotypic marker of effector memory Th17 cells in inflammatory bowel disease

Purinergic signaling and associated ectonucleotidases, such as CD39 and CD73, have been implicated in the pathogenesis of inflammatory bowel disease (IBD). CD39 is known to be a Treg memory cell marker, and here we determine the phenotype and function of CD73⁺CD4⁺ T lymphocytes in patients with IBD. We describe elevated levels of CD73⁺CD4⁺ T cells in the peripheral blood and intestinal lamina propria of patients with active IBD. The functional phenotype of these CD73⁺CD4⁺ T cells was further determined by gene expression, ecto‐enzymatic activity, and suppressive assays. Increased numbers of CD73⁺CD4⁺ T cells in the periphery and lamina propria were noted during active inflammation, which returned to baseline levels following anti‐TNF treatment. Peripheral CD73⁺CD4⁺ T cells predominantly expressed CD45RO, and were enriched with IL‐17A⁺ cells. The CD73⁺CD4⁺ cell population expressed higher levels of RORC, IL‐17A, and TNF, and lower levels of FOXP3 and/or CD25, than CD73^?CD4⁺ T cells. Expression of CD73 by peripheral CD4⁺ T cells was increased by TNF, and decreased by an anti‐TNF monoclonal antibody (infliximab). In vitro, these peripheral CD73⁺CD4⁺ T cells did not suppress proliferation of CD25^? effector cells, and expressed higher levels of pro‐inflammatory markers. We conclude that the CD73⁺CD4⁺ T‐cell population in patients with active IBD are enriched with cells with a T‐helper type 17 phenotype, and could be used to monitor disease activity during treatment.     

Effector T‐cell differentiation during viral and bacterial infections: Role of direct IL‐12 signals for cell fate decision of CD8+ T cells

To study the role of IL‐12 as a third signal for T‐cell activation and differentiation in vivo, direct IL‐12 signaling to CD8⁺ T cells was analyzed in bacterial and viral infections using the P14 T‐cell adoptive transfer model with CD8⁺ T cells that lack the IL‐12 receptor. Results indicate that CD8⁺ T cells deficient in IL‐12 signaling were impaired in clonal expansion after Listeria monocytogenes infection but not after infection with lymphocytic choriomeningitis virus, vaccinia virus or vesicular stomatitis virus. Although limited in clonal expansion after Listeria infection, CD8⁺ T cells deficient in IL‐12 signaling exhibited normal degranulation activity, cytolytic functions, and secretion of IFN‐γ and TNF‐α. However, CD8⁺ T cells lacking IL‐12 signaling failed to up‐regulate KLRG1 and to down‐regulate CD127 in the context of Listeria but not viral infections. Thus, direct IL‐12 signaling to CD8⁺ T cells determines the cell fate decision between short‐lived effector cells and memory precursor effector cells, which is dependent on pathogen‐induced local cytokine milieu.     

Circulating T cells to infliximab are detectable mainly in treated patients developing anti‐drug antibodies and hypersensitivity reactions

Antibodies recognizing infliximab (IFX) may develop in a proportion of treated patients, leading to loss of response or hypersensitivity reactions (HRs). T cell response to IFX has been poorly investigated. This paper was addressed to detect IFX‐specific T cells in treated patients with inflammatory diseases developing, or not, anti‐drug antibodies (ADA) and to correlate the presence of specific T cells with the clinical outcomes of the treatment. A co‐culture system of IFX‐loaded dendritic cells and purified autologous CD4⁺ T cells was used to detect memory T cells in 32 ADA⁺ and 39 ADA^– IFX‐treated patients and control groups. The cytokine profile of IFX‐specific T cells was also studied in culture supernatants. IFX‐specific cell proliferation was detected mainly in cells from ADA⁺ patients, irrespective of their different diseases. HR patients displayed higher T cell proliferation than non‐responder and tolerant patients. A mixed [interferon (IFN)‐γ, interleukin (IL)‐13, IL‐10] cytokine profile was shown in cells from ADA⁺ patients, while IL‐10 was the most frequently detected cytokine in the supernatants of cultures from ADA‐ patients. Immunoglobulin (Ig)E⁺ADA⁺ patients with previous HRs exhibited a more pronounced type 2 profile than IgE^–ADA⁺ patients. This work provides evidence that IFX‐specific circulating T cells are detectable mainly in ADA⁺ patients with HRs, regardless of their disease. The IFX‐induced cytokine pattern partially correlates with the ADA isotype.     

Multiple Antigen Peptide Containing B and T Cell Epitopes of F1 Antigen of Yersinia pestis Showed Enhanced Th1 Immune Response in Murine Model

Yersinia pestis is a facultative bacterium that can survive and proliferate inside host macrophages and cause bubonic, pneumonic and systemic infection. Apart from humoral response, cell‐mediated protection plays a major role in combating the disease. Fraction 1 capsular antigen (F1‐Ag) of Y. pestis has long been exploited as a vaccine candidate. In this study, F1‐multiple antigenic peptide (F1‐MAP or MAP)‐specific cell‐mediated and cytokine responses were studied in murine model. MAP consisting of three B and one T cell epitopes of F1‐antigen with one palmitoyl residue was synthesized using Fmoc chemistry. Mice were immunized with different formulations of MAP in poly DL‐lactide‐co‐glycolide (PLGA) microspheres. F1‐MAP with CpG oligodeoxynucleotide (CpG‐ODN) as an adjuvant showed enhanced in vitro T cell proliferation and Th1 (IL‐2, IFN‐γ and TNF‐α) and Th17 (IL‐17A) cytokine secretion. Similar formulation also showed significantly higher numbers of cytokine (IL‐2, IFN‐γ)‐secreting cells. Moreover, F1‐MAP with CpG formulation showed significantly high (P < 0.001) percentage of CD4⁺ IFN‐γ⁺ cells as compared to CD8⁺ IFN‐γ⁺ cells, and also more (CD4‐ IFN‐γ)⁺ cells secrete perforin and granzyme as compared to (CD8‐ IFN‐γ)⁺ showing Th1 response. Thus, the study highlights the importance of Th1 cytokine and existence of CD4⁺ and CD8⁺ immune response. This study proposes a new perspective for the development of vaccination strategies for Y. pestis that trigger T cell immune response.     

Aberrant plasmacytoid dendritic cell distribution and function in patients with Crohn's disease and ulcerative colitis

Dendritic cell (DC) function is believed to be of critical importance for the pathogenesis of inflammatory bowel disease (IBD). To date, most research in animal models and the few human data available is restricted to myeloid DC, while plasmacytoid DC (pDC) capable of controlling both innate and adaptive immune responses have not yet been investigated systematically in human Crohn's disease (CD) or ulcerative colitis (UC). CD11c^‐, CD303⁺/CD304⁺ and CD123⁺ pDC from peripheral blood (n = 90), mucosal tissue (n = 28) or mesenteric lymph nodes (n = 40) (MLNs) of patients with UC and CD or controls were purified and cultured. Thereafter, pDC were enumerated, phenotyped and cytokine secretion measured by flow cytometry (FACS), immunohistochemistry and/or cytometric bead array, respectively. Interferon (IFN)‐α secretion following cytosine phosphatidyl guanine (CpG) A oligodeoxynucleotide (ODN) 2216 (5′‐GGGGGACGATCGTCGGGGGG‐3′) stimulation was assessed by enzyme‐linked immunosorbent assay (ELISA). We found a significantly higher frequency of pDC in the inflamed colonic mucosa and MLN of IBD patients. Moreover, the fraction of CD40 and CD86 expressing cultured peripheral blood pDC was significantly higher in flaring UC and CD patients and their secretion of tumour necrosis factor (TNF)‐α, interleukin (IL)‐6 and IL‐8 were increased significantly compared with controls. In contrast, the IFN‐α secretion of peripheral blood pDC isolated from flaring IBD, particularly in UC patients, was reduced significantly compared with controls. Our data suggest an aberrant distribution and function of pDC in IBD, contrary to their generally implicated role as inducers of tolerance. We speculate that the impaired IFN‐α secretion may relate to the hypothesized defect in innate immunity in IBD and could also impact upon the generation of regulatory T cells (T_reg).     

Multifunctional CD4+ T cells correlate with active Mycobacterium tuberculosis infection

Th1 CD4⁺ T cells and their derived cytokines are crucial for protection against Mycobacterium tuberculosis. Using multiparametric flow cytometry, we have evaluated the distribution of seven distinct functional states (IFN‐γ/IL‐2/TNF‐α triple expressors, IFN‐γ/IL‐2, IFN‐γ/TNF‐α or TNF‐α/IL‐2 double expressors or IFN‐γ, IL‐2 or TNF‐α single expressors) of CD4⁺ T cells in individuals with latent M. tuberculosis infection (LTBI) and active tuberculosis (TB). We found that triple expressors, while detectable in 85–90%TB patients, were only present in 10–15% of LTBI subjects. On the contrary, LTBI subjects had significantly higher (12‐ to 15‐fold) proportions of IL‐2/IFN‐γ double and IFN‐γ single expressors as compared with the other CD4⁺ T‐cell subsets. Proportions of the other double or single CD4⁺ T‐cell expressors did not differ between TB and LTBI subjects. These distinct IFN‐γ, IL‐2 and TNF‐α profiles of M. tuberculosis‐specific CD4⁺ T cells seem to be associated with live bacterial loads, as indicated by the decrease in frequency of multifunctional T cells in TB‐infected patients after completion of anti‐mycobacterial therapy. Our results suggest that phenotypic and functional signatures of CD4⁺ T cells may serve as immunological correlates of protection and curative host responses, and be a useful tool to monitor the efficacy of anti‐mycobacterial therapy.     

Relationship of CD146 expression to secretion of interleukin (IL)‐17, IL‐22 and interferon‐γ by CD4+ T cells in patients with inflammatory arthritis

Expression of the adhesion molecule, CD146/MCAM/MelCAM, on T cells has been associated with recent activation, memory subsets and T helper type 17 (Th17) effector function, and is elevated in inflammatory arthritis. Th17 cells have been implicated in the pathogenesis of rheumatoid arthritis (RA) and spondyloarthritides (SpA). Here, we compared the expression of CD146 on CD4⁺ T cells between healthy donors (HD) and patients with RA and SpA [ankylosing spondylitis (AS) or psoriatic arthritis (PsA)] and examined correlations with surface markers and cytokine secretion. Peripheral blood mononuclear cells (PBMC) were obtained from patients and controls, and synovial fluid mononuclear cells (SFMC) from patients. Cytokine production [elicited by phorbol myristate acetate (PMA)/ionomycin] and surface phenotypes were evaluated by flow cytometry. CD146⁺CD4⁺ and interleukin (IL)‐17⁺CD4⁺ T cell frequencies were increased in PBMC of PsA patients, compared with HD, and in SFMC compared with PBMC. CD146⁺CD4⁺ T cells were enriched for secretion of IL‐17 [alone or with IL‐22 or interferon (IFN)‐γ] and for some putative Th17‐associated surface markers (CD161 and CCR6), but not others (CD26 and IL‐23 receptor). CD4⁺ T cells producing IL‐22 or IFN‐γ without IL‐17 were also present in the CD146⁺ subset, although their enrichment was less marked. Moreover, a majority of cells secreting these cytokines lacked CD146. Thus, CD146 is not a sensitive or specific marker of Th17 cells, but rather correlates with heterogeneous cytokine secretion by subsets of CD4⁺ helper T cells.     

TLR2 engagement on memory CD8+ T cells improves their cytokine‐mediated proliferation and IFN‐γ secretion in the absence of Ag

Persistence of memory CD8⁺ T cells is known to be largely controlled by common gamma chain cytokines, such as IL‐2, IL‐7 and IL‐15. However, other molecules may be involved in this phenomenon. We show here that TLR2^?/? mice have a decreased frequency of memory phenotype CD8⁺ T cells when compared with WT mice. This prompted us to investigate the role of TLR2 in the homeostasis of memory CD8⁺ T cells. We describe here a new TLR2‐dependent mechanism which, in the absence of specific antigen, directly controls memory CD8⁺ T‐cell proliferation and IFN‐γ secretion. We demonstrate that TLR2 engagement on memory CD8⁺ T cells increases their proliferation and expansion induced by IL‐7 both in vitro and in vivo. We also show that TLR2 ligands act in synergy with IL‐2 to induce IFN‐γ secretion in vitro. Both conclusions are obtained with spontaneously arising memory phenotype and antigen‐specific memory CD8⁺ T cells. Altogether, our data support the idea that continuous TLR2 signaling in response to microbial stimuli or endogenous danger signals might directly contribute to the maintenance of the diversity memory CD8⁺ T cells in the organism.     

Cells with regulatory function of the innate and adaptive immune system in primary Sjögren's syndrome

The aim of the present study was to describe subsets of cells with regulatory properties in primary Sjögren's syndrome (pSS), and to correlate these cell populations with clinical symptoms. Among the 32 investigated patients, 23 had extraglandular manifestations (EGMs), while nine had only glandular symptoms. Twenty healthy individuals served as controls. The percentages of natural killer (NK), natural killer T cells (NK T), interleukin (IL)‐10 producing T regulatory type 1 (Tr1) cells and CD4⁺CD25⁺ regulatory T cells (T_reg) cells were determined by flow cytometry and serum cytokine levels of IL‐4, IL‐6, IL‐10, tumour necrosis factor (TNF)‐α and interferon (IFN)‐γ were evaluated by enzyme‐linked immunosorbent assay (ELISA). Functional tests were carried out to assess the suppressor properties of T_reg cells in patients and controls. Peripheral NK, NK T and Tr1 cell percentages were elevated in pSS, while CD4⁺CD25⁺ T_reg cells showed reduced frequencies in patients compared to controls. In pSS, elevated percentages of NK T, Tr1 and CD4⁺CD25⁺ T_reg cells were observed in patients with EGMs, when compared to patients with sicca symptoms only. CD4⁺CD25⁺ T_reg cell percentages showed a negative correlation with sialometry values. The in vitro functional assay demonstrated lower suppression activity of CD4⁺CD25⁺ T_reg cells in patients compared to controls. Serum IL‐6 and TNF‐α levels were elevated, while IL‐10 was decreased in patients compared to controls. Negative correlation was found between IL‐10 levels and the percentages of Tr1 cells. Changes in the investigated subsets of regulatory cells in pSS may contribute to the development and progression of the disease.     

n‐Butyrate Anergized Effector CD4+ T Cells Independent of Regulatory T cell Generation or Activity

CD4⁺ T cell anergy reflects the inability of CD4⁺ T cells to respond functionally to antigenic stimulation through proliferation or IL‐2 secretion. Histone deacetylase (HDAC) inhibitors have been shown to induce anergy in antigen‐activated CD4⁺ T cells. However, questions remain if HDAC inhibitors mediate anergy through direct action upon activated CD4⁺ T cells or through the generation and/or enhancement of regulatory T (T_reg) cells. To assess if HDAC inhibitor n‐butyrate induces anergy independent of the generation or expansion of FoxP3⁺ T_reg cells in vitro, we examine n‐butyrate‐treated murine CD4⁺ T cells for anergy induction and FoxP3⁺ T_reg activity. Whereas n‐butyrate decreases CD4⁺ T cell proliferation and IL‐2 secretion, n‐butyrate did not augment FoxP3 protein production or confer a suppressive phenotype upon CD4⁺ T cells. Collectively, these data suggest that HDAC inhibitors can facilitate CD4⁺ T cell functional unresponsiveness directly and independently of T_reg cell involvement.     

Expression of interleukin (IL)‐19 and IL‐24 in inflammatory bowel disease patients: a cross‐sectional study

Interleukin (IL)‐19 and IL‐24 belong to the IL‐20 subfamily, and are involved in host defence against bacteria and fungi, tissue remodelling and wound healing. Nevertheless, no previous studies have explored their expression in Mexican mestizo patients with inflammatory bowel disease (IBD). The aim of the study was to characterize and to enumerate peripheral and tissue IL‐19‐ and IL‐24‐producing cells, as well as gene expression in patients with IBD with regard to its clinical activity. We studied a total of 77 patients with ulcerative colitis (UC), 36 Crohn's disease (CD) and 33 patients as control group (without endoscopic evidence of intestinal inflammation). Gene expression was measured by real‐time–polymerase chain reaction (RT–PCR). Protein expression was detected in biopsies by immunohistochemistry and in freshly isolated peripheral blood mononuclear cells by flow cytometry. IL‐19 and IL‐24 gene expression was elevated significantly in patients with active IBD versus the inactive disease and non‐inflammatory control groups (P < 0·05). However, IL‐19‐ and IL‐24‐producing cells were only increased in active CD versus active UC and non‐inflammatory tissues (P < 0·05). IL‐19 was produced conspicuously by circulating B cells and monocytes in patients with inactive disease (P < 0·05). Conversely, IL‐24 was noticeably synthesized by peripheral B cells, CD4⁺ T cells, CD8⁺ T cells and monocytes in patients with active disease. In conclusion, IL‐19‐ and IL‐24‐producing cells in active CD patients were increased compared with active UC and non‐inflammatory tissues. These cytokines could significantly shape and differentiate inflammatory process, severity and tolerance loss between UC and CD pathophysiology.     

Pattern and diversity of cytokine production differentiates between Mycobacterium tuberculosis infection and disease

Tuberculosis (TB) remains a global health problem. The solution involves development of an effective vaccine, but has been limited by incomplete understanding of what constitutes protective immunity during natural infection with Mycobacterium tuberculosis. In this study, M. tuberculosis‐specific responses following an overnight whole‐blood assay were assessed by intracellular cytokine staining and luminex, and compared between TB cases and exposed household contacts. TB cases had significantly higher levels of IFN‐γ⁺TNF‐α⁺IL‐2⁺CD4⁺T cells compared with contacts. TB cases also had a significantly higher proportion of cells single‐positive for TNF‐α, but lower proportion of cells producing IL‐2 alone and these differences were seen for both CD4⁺and CD8⁺ T cells. Cytokine profiles from culture supernatants were significantly biased toward a Th1 phenotype (IFN‐γ and IL‐12(p40)) together with a complete abrogation of IL‐17 secretion in TB cases. Our data indicate that despite a robust response to TB antigens in active TB disease, changes in the pattern of cytokine production between TB infection and disease clearly contribute to disease progression.     

Interleukin‐21 (IL‐21) synergizes with IL‐2 to enhance T‐cell receptor‐induced human T‐cell proliferation and counteracts IL‐2/transforming growth factor‐β‐induced regulatory T‐cell development

Interleukin‐2 (IL‐2) is a mainstay for current immunotherapeutic protocols but its usefulness in patients is reduced by severe toxicities and because IL‐2 facilitates regulatory T (Treg) cell development. IL‐21 is a type I cytokine acting as a potent T‐cell co‐mitogen but less efficient than IL‐2 in sustaining T‐cell proliferation. Using various in vitro models for T‐cell receptor (TCR)‐dependent human T‐cell proliferation, we found that IL‐21 synergized with IL‐2 to make CD4⁺ and CD8⁺ T cells attain a level of expansion that was impossible to obtain with IL‐2 alone. Synergy was mostly evident in naive CD4⁺ cells. IL‐2 and tumour‐released transforming growth factor‐β (TGF‐β) are the main environmental cues that cooperate in Treg cell induction in tumour patients. Interleukin‐21 hampered Treg cell expansion induced by IL‐2/TGF‐β combination in naive CD4⁺ cells by facilitating non‐Treg over Treg cell proliferation from the early phases of cell activation. Conversely, IL‐21 did not modulate the conversion of naive activated CD4⁺ cells into Treg cells in the absence of cell division. Treg cell reduction was related to persistent activation of Stat3, a negative regulator of Treg cells associated with down‐modulation of IL‐2/TGF‐β‐induced phosphorylation of Smad2/3, a positive regulator of Treg cells. In contrast to previous studies, IL‐21 was completely ineffective in counteracting the suppressive activity of Treg cells on naive and memory, CD4⁺ and CD8⁺ T cells. Present data provide proof‐of‐concept for evaluating a combinatorial approach that would reduce the IL‐2 needed to sustain T‐cell proliferation efficiently, thereby reducing toxicity and controlling a tolerizing mechanism responsible for the contraction of the T‐cell response.     

Activation of p38 mitogen-activated protein kinase is critical step for acquisition of effector function in cytokine-activated T cells, but acts as a negative regulator in T cells activated through the T-cell receptor

Peripheral blood CD4⁺ CD45RO⁺ T cells activated in vitro are able to induce expression of tumour necrosis factor‐α (TNF‐α) in monocytes via a contact‐dependent mechanism. Activation is achieved either with interleukin‐2 (IL‐2)/IL‐6/TNF‐α over an 8‐day period or cross‐linking CD3 using anti‐CD3 antibody for 48 hr. In this paper, we show that the p38 mitogen‐activated protein kinase (MAPK) signalling pathway played different roles in the generation of effector function in these two types of activated T cells. In anti‐CD3 activated T cells, p38 MAPK is a negative regulator for anti‐CD3 induced cell proliferation and has no significant effect on the acquisition of either the effector function (induction of monocyte‐derived TNF‐α) or production of T‐cell cytokines. In contrast, the p38 MAPK signalling pathway is required for the acquisition of cytokine‐induced effector function and promotes cell proliferation and cytokine production.     

Endogenous interleukin‐6 amplifies interleukin‐17 production and corticoid‐resistance in peripheral T cells from patients with multiple sclerosis

Interleukin‐6 (IL‐6) has been implicated in the induction of pathogenic IL‐17‐producing T cells in autoimmune diseases, and studies evaluating the role of this cytokine in T‐cell function in patients with multiple sclerosis (MS) are lacking. Our objective was to evaluate the role of IL‐6 receptor (IL‐6R) signalling on in vitro functional status of T cells from patients with relapsing–remitting MS during clinical remission. Our results demonstrated that, even during the remission phase, activated T cells from patients produce higher levels of IL‐17, and this cytokine was positively correlated with disease severity, as determined by Expanded Disability Status Scale score. In the MS group, the blockade of IL‐6R signalling by anti‐IL‐6R monoclonal antibody reduced IL‐17 production and elevated IL‐10 release by activated CD4⁺ T cells, but it did not alter the production of these cytokines by activated CD8⁺ T cells. Blockade of IL‐6R signalling also reduced the ability of monocytes to up‐regulate T helper type 17 phenotype in patients with MS. Finally, both cell proliferation and IL‐17 release by CD4⁺ and, mainly, CD8⁺ T cells from patients with MS were less sensitive to hydrocortisone inhibition than control group. Interestingly, IL‐6R signalling blockade restored the ability of hydrocortisone to inhibit both T‐cell proliferation and IL‐17 production. Collectively, these results suggest that IL‐6 might be involved in MS pathogenesis by enhancing IL‐17 production and reducing corticoid inhibitory effects on activated T cells.     

Unicompartmental and bicompartmental knee osteoarthritis show different patterns of mononuclear cell infiltration and cytokine release in the affected joints

It is still controversial which cell types are responsible for synovial inflammation in osteoarthritic (OA) joints. The aim of this study was to quantify the mononuclear cell populations and their cytokines in patients with different knee OA subtypes. Synovial membrane (SM), synovial fluid (SF) and peripheral blood (PB) were harvested from patients with unicompartmental (UC) and bicompartmental (BC) knee OA. Frequencies of mononuclear cells were assessed by flow cytometry in PB and SM. Naive SF samples were analysed for a broad variety of cytokines by multiplex analysis. SM of both groups displayed a distinct mononuclear cell infiltration, with CD14⁺ macrophages being the major cell population, followed by CD4⁺ T cells and only small numbers of CD8⁺ T, CD19⁺ B and CD16⁺CD56⁺ natural killer (NK) cells. Between the two groups, SM of BC OA showed significantly higher amounts of mononuclear cells (135·7 ± 180 versus 805 ± 675 cells/mg, P = 0·0009) and higher CD4⁺ T cell presence (3·4 ± 4·6 versus 9·1 ± 7·5%, P = 0·0267). SF of BC OA displayed significantly higher concentrations for a number of proinflammatory cytokines [CXCL1, eotaxin, interferon (IFN)‐γ, interleukin (IL)‐7, IL‐8, IL‐9, IL‐12]. UC and BC OA show significant differences in their synovial inflammatory pattern. Whereas in UC OA CD14⁺ macrophages are the predominant cell population, BC OA has a higher inflammatory profile and seems to be driven by CD14⁺ macrophages and CD4⁺ T cells. Inclusion of clinical information into the analysis of cellular and molecular results is pivotal in understanding the pathophysiology of OA.     

TRAF2 regulates peripheral CD8+ T‐cell and NKT‐cell homeostasis by modulating sensitivity to IL‐15

In this study, a critical and novel role for TNF receptor (TNFR) associated factor 2 (TRAF2) is elucidated for peripheral CD8⁺ T‐cell and NKT‐cell homeostasis. Mice deficient in TRAF2 only in their T cells (TRAF2TKO) show ∼40% reduction in effector memory and ∼50% reduction in naïve CD8⁺ T‐cell subsets. IL‐15‐dependent populations were reduced further, as TRAF2TKO mice displayed a marked ∼70% reduction in central memory CD8⁺CD44^hiCD122⁺ T cells and ∼80% decrease in NKT cells. TRAF2TKO CD8⁺CD44^hi T cells exhibited impaired dose‐dependent proliferation to exogenous IL‐15. In contrast, TRAF2TKO CD8⁺ T cells proliferated normally to anti‐CD3 and TRAF2TKO CD8⁺CD44^hi T cells exhibited normal proliferation to exogenous IL‐2. TRAF2TKO CD8⁺ T cells expressed normal levels of IL‐15‐associated receptors and possessed functional IL‐15‐mediated STAT5 phosphorylation, however TRAF2 deletion caused increased AKT activation. Loss of CD8⁺CD44^hiCD122⁺ and NKT cells was mechanistically linked to an inability to respond to IL‐15. The reduced CD8⁺CD44^hiCD122⁺ T‐cell and NKT‐cell populations in TRAF2TKO mice were rescued in the presence of high dose IL‐15 by IL‐15/IL‐15Rα complex administration. These studies demonstrate a critical role for TRAF2 in the maintenance of peripheral CD8⁺ CD44^hiCD122⁺ T‐cell and NKT‐cell homeostasis by modulating sensitivity to T‐cell intrinsic growth factors such as IL‐15.     

Chronic myelogenous leukemia maintains specific CD8+ T cells through IL‐7 signaling

Chronic myelogenous leukemia (CML) is a malignant myeloproliferative disease of hematopoietic stem cells. The disease progresses after several years from an initial chronic phase to a blast phase. Leukemia‐specific T cells are regularly detected in CML patients and may be involved in the immunological control of the disease. Here, we analyzed the role of leukemia‐specific CD8⁺ T cells in CML disease control and the mechanism that maintains CD8⁺ T‐cell immunosurveillance in a retroviral‐induced murine CML model. To study antigen‐specific immune responses, the glycoprotein of the lymphocytic choriomeningitis virus was used as model leukemia antigen. Leukemia‐specific CTL activity was detectable in vivo in CML mice and depletion of CD8⁺ T cells rapidly led to disease progression. CML‐specific CTL were characterized by the expression of the IL‐7 receptor α‐chain. In addition, leukemia cells produced IL‐7 that was crucial for the maintenance of leukemia‐specific CTL and for disease control. Therefore, CML cells maintain the specific CD8⁺ T‐cell‐mediated immune control by IL‐7 secretion. This results in prolonged control of disease and probably contributes to the characteristic chronic phase of the disease.