Molecular basis of mucopolysaccharidosis type II: Mutations in the iduronate-2-sulphatase gene

A number of mutations in the X-chromosomal human iduronate-2-sulphatase gene have now been identified as the primary genetic defect leading to the clinical condition known as Hunter syndrome or mucopolysaccharidosis type II. The mutations that are tabulated include different deletions, splice-site and point mutations. From the group of 319 patients thus far studied by Southern analysis, 14 have a full deletion of the gene and 48 have a partial deletion or other gross rearrangements. All patients with full deletions or gross rearrangements have severe clinical presentations. Twenty-nine different “small” mutations have so far been characterised in a total of 32 patients. These include 4 nonsense and 13 missense mutations, 7 different small deletions from 1 to 3 bp, with most leading to a frameshift and premature chain termination, and 5 different splice-site mutations also leading to small insertions or deletions in the mRNA. A 60 bp deletion, that results from a new donor splice-site, has been observed in five unrelated patients with relatively mild clinical phenotypes. This information will not only be useful for MPS II patient and carrier diagnosis, but also will aid in the understanding of the structure and function of iduronate-2-sulphatase, and possibly in correlating genotype with phenotype. © 1993 Wiley-Liss, Inc.     

Mutational and structural analysis of Japanese patients with mucopolysaccharidosis type II

We investigated mutations of the iduronate-2-sulfatase (I2S) gene and structural characteristics of I2S to clarify genotype/phenotype relationships in 18 Japanese patients with mucopolysaccharidosis type II. The I2S gene was analyzed in five patients with a severe phenotype and in 13 patients with an attenuated phenotype. The tertiary structural model of the human I2S was constructed by homology modeling using the arylsulfatase structure as a template. We identified four missense mutations and a nonsense mutation in the severe phenotype; four missense, two nonsense, three frame shifts, and one each of splice and amino acid deletion in the attenuated phenotype. Seven of them (L73del, Q75X, G140R, C171R, V401 fs, C422 fs, and H441 fs) were novel mutations. Structural analysis indicated that the residues of the mutations found in the severe phenotype would have direct interactions with the active site residues or should break the hydrophobic core domain of I2S, whereas residues of the missense mutations found in the attenuated phenotype were located in the peripheral region. In addition, effects by deletion or frameshift mutations could also be interpreted by the structure. Structural analysis of mutant proteins would help in understanding the genotype/phenotype relationships of Hunter disease.     

Hunter disease in a girl caused by R468Q mutation in the iduronate-2-sulfatase gene and skewed inactivation of the X chromosome carrying the normal allele

Hunter disease is an X-linked recessive mucopolysaccharide storage disorder caused by iduronate-2-sulfatase deficiency and is rare in females. We describe here findings in a girl with Hunter disease of the severe type. She had a normal karyotype but a marked deficiency of iduronate-2-sulfatase activity in lymphocytes and cultured fibroblasts. In a sequence analysis of the iduronate-2-sulfatase gene, evidence was obtained for the R468Q (G¹⁴⁰³ to A) mutation, a common one in Hunter disease. RT-PCR showed her cDNA to represent only the R468Q allele, although at the genomic level she was a heterozygote with one normal allele. Her brother had the R468Q mutation, and their mother was a carrier of this mutation. The fusion products of CHO (TG^R,Neo^R) with patient's fibroblasts cultured in HAT/G418 selective medium, carried only the maternal allele. However, in genomic DNA from the patient's fibroblasts, only the paternal allele of the androgen receptor gene, a gene subjected to differential methylation of the inactive X-chromosome, was methylated. These findings strongly suggest that the severe form of Hunter disease in this girl was the result of selective expression of the maternal allele carrying the missense mutation R468Q, which in turn resulted from skewed X inactivation of the paternal nonmutant X chromosome. Hum Mutat 10:361–367, 1997. © 1997 Wiley-Liss, Inc.     

Identification of 9 novel IDS gene mutations in 19 unrelated Hunter syndrome (Mucopolysaccharidosis type II) patients

Hunter syndrome is an X-linked lysosomal storage disorder caused by a deficiency of the lysosomal enzyme iduronate-2-sulfatase (IDS). The IDS deficiency can be caused by several different types of mutations in the IDS gene. We have performed a molecular and mutation analysis of a total of 19 unrelated MPS II patients of different ethnic origin and identified 19 different IDS mutations, 9 of which were novel and unique. SSCP analysis followed by DNA sequencing revealed four novel missense mutations: S143F, associated with the 562C→T polymorphism, C184W, D269V and Y348H. Two novel nonsense mutations were found: Y103X (433C→A) and Y234X (826C→G). In two patients two novel minor insertions (421insA and 499insA) were identified. In one patient a complete IDS deletion was found, extending from locus DXS1185 to locus DXS466. © 1998 Wiley-Liss, Inc.     

A deletion involving exons 2–4 in the iduronate-2-sulfatase gene of a patient with intermediate Hunter syndrome

A large deletion in the iduronate-2-sulfatase (IDS) gene has been found in a patient affected by an intermediate form of Hunter syndrome (mucopolysaccharidosis II). The deletion involves exons 2–4, the breakpoints lying respectively in intron 1, at position 376, and in intron 4, at position 5725. cDNA analysis revealed a direct exon 1-exon 5 junction due to the deletion resulting in a frameshift mutation.     

Mutations of the iduronate-2-sulfatase (IDS) gene in patients with hunter syndrome (mucopolysaccharidosis II)

Genomic DNA and cDNA from fibroblasts from nine unrelated German patients with X-linked iduronate-2-sulfatase (IDS) deficiency showing variable clinical manifestation were screened for point mutations and small structural aberrations. Direct sequencing revealed a splice mutation skipping exon A, one nonsense mutation, and five missense mutations concerning the exons B, F and I of the IDS gene. Several novel missense mutations were found: A68E, S426X, I485R, Q293H, and D478G. One of the point mutations eliminating a recognition site for the restriction enzyme MspI was used as a direct marker for a prenatal diagnosis. A relationship between type of mutation and clinical picture could not be recognized. © 1994 Wiley-Liss, Inc.     

Localized donor cells in brain of a Hunter disease patient after cord blood stem cell transplantation

The efficacy of hematopoietic stem cell transplantation (HSCT) for Hunter disease (deficiency of iduronate-2-sulfatase, IDS) remains unclear. We treated a 6-year-old male suffering from a severe type of Hunter disease with cord blood stem cell transplantation (CBSCT); however, he died at 10 months post-therapy due to a laryngeal post-transplantation lymphoproliferative disorder. During the follow-up period after CBSCT, his hyperactivity, estimated mental age, and brain MR findings had not improved. We assessed the efficacy of CBSCT by biochemical and pathological analyses of the autopsied tissues. There were many distended cells with accumulated substrate in the brain, but not in the liver. IDS enzyme activity in the cerebrum remained very low, although that in the liver reached about 40% of the normal control level. However, a variable number of tandem repeats analyses demonstrated a weak donor-derived band not only in the liver but also in the cerebrum. Furthermore, IDS-immunoreactivity in the liver was recognized broadly not only in Kupffer cells but also in hepatocytes. On the other hand, IDS-immunoreactivity was recognized exclusively in CD68-positive microglia/monocytes in the patient’s brain; whereas that in the normal brain was also detected in neurons and oligodendrocytes. These donor-derived IDS-positive cells were predominantly localized in perivascular spaces and some of them were evidently present in the brain parenchyma. The efficacy of CBSCT was judged to be insufficient for the brain at 10 months post-therapy. However, the pathological detection of donor-derived cells in the brain parenchyma suggests the potential of HSCT for treatment of neurological symptoms in Hunter disease. This is the first neuropathological report documenting the distribution of donor-derived cells in the brain after CBSCT into a Hunter disease patient.     

Hunter disease (mucopolysaccharidosis type II) in a karyotypically normal girl

A female child of healthy, unrelated parents presented at 12 months of age with a history of moderately severe developmental delay, macrocephaly, dysmorphic facies, hypotonia, hepato-splenomegaly, mild generalized dysostosis multiplex, mucopolysacchariduria (dermatan and heparan sulfates), and Alder-Reilly bodies in peripheral blood leukocytes. Iduronate sulfatase activity in plasma was markedly depressed: 0.11 units/ml/h (normal, 1.75 ±0.56, N = 6). Analyses of arylsulfatases A, B, and C, heparan N-sulfatase, α-mannosidase, β-mannosidase, β-glucuronidase, β-hexosaminidase, β-galactosidase, and α-fucosidase activities in plasma, leukocytes, and/or cultured skin fibroblasts were all normal. Urinary sulfatide excretion was also within normal limits. Karyotypes of peripheral blood leukocytes and cultured skin fibroblasts were normal. Serum iduronate sulfatase activities in the parents were in the normal range (father, 1.63 units/ml/h; mother, 1.25 units/ml/h). The results of analyses of restriction fragment length polymorphisms (RFLP) of DNA from cultured skin fibroblasts with the use of probes for loci extending from Xpter to Xq28 showed X chromosome heterozygosity and confirmed the paternal origin of one of the X chromosomes. Studies on sulfur-35 uptake in mixed fibroblast cultures showed cross-correction of [³⁵S]-glycosaminoglycan accumulation between cells from the patient and normal cells or cells from a patient with Hurler disease; however, there was no cross-correction between cells from the patient and those from boys affected with classical Hunter disease. This represents only the second confirmed case of Hunter disease reported in a karyotypically normal girl.     

Changes in glycogen and glycosaminoglycan levels in hepatocytes of iduronate-2-sulfatase knockout mice before and after recombinant iduronate-2-sulfatase supplementation

Purpose

Mucopolysaccharidosis II (MPS II) is a lysosomal storage disorder caused by a deficiency of iduronate-2 sulfatase (IdS), which is involved in the degradation of glycosaminoglycan (GAG). In this study, the frequency of fasting hypoglycemia in patients with MPS II was investigated and changes in accumulation of glycogen and GAG in the hepatocytes of IdS-knockout (KO) mice were evaluated before and after recombinant IdS enzyme replacement therapy (ERT).

Materials and Methods

Plasma glucose levels were evaluated after an 8-hour fast in 50 patients with MPS II. The IdS-KO mice were divided into three groups (group 2; saline, group 3; 0.15 mg/kg of IdS, and group 4; 0.5 mg/kg of IdS); wild-type mice were included as controls (group 1). ERT was initiated intravenously at four weeks of age, and continued every week until 20 weeks of age.

Results

The mean glucose level after an 8-hour fast was 94.1 ± 23.7 mg/dL in the patients with MPS II. Two (4%) out of 50 patients had fasting hypoglycemia. For the mice, GAG in the lysosomes nearly disappeared and glycogen particles in the cytoplasm were restored to the normal range in group 4.

Conclusion

Glucose metabolism in patients with MPS II appeared to function well despite hepatocytic GAG accumulation and hypothetical glycogen depletion. A higher dose of IdS infusion in MPS II mice led to disappearance of lysosomal GAG and restoration of glycogen to the cytoplasm of hepatocytes.     

Characterization of iduronate-2-sulfatase gene-pseudogene recombinations in eight patients with Mucopolysaccharidosis type II revealed by a rapid PCR-based method

Various types of complex genetic rearrangements involving the iduronate-2-sulfatase (IDS) and its homologous pseudogene (IDS2, IDSP1) have so far been reported as the cause of Mucopolysaccharidosis type II (MPS2 or MPS II; Hunter syndrome). When using conventional mutational analyses, the occurrence in intronic regions of these rearrangements can be misleading. Here, we describe a rapid PCR-based method set up to detect possible gene/pseudogene recombinations among a series of Italian male patients who had negative results in the mutation analysis of the IDS gene. Our approach selected eight unrelated patients showing recombinations. The characterization of the proximal regions containing the breakpoints in the eight patients identified four different rearrangements due to both inversion and conversion events. Comparison of our data with previous publications confirmed that the recombinations between the IDS gene and the IDS2 pseudogene result from separate events, considering their occurrence at different positions within the same "hotspot" genomic region in unrelated patients. The RT-PCR analysis of the available cDNAs pointed out the different effects of similar rearrangements on the expression of the IDS gene. This method can be utilized effectively in the absence of the patients' cDNA, as well as for carrier detection among female family members. This advantageous approach reduces costs, is less time-consuming, and requires a smaller DNA quantity in comparison to the Southern blot hybridization technique often utilized for such complex rearrangements.     

Identification of 6 new mutations in the iduronate sulfatase gene

Mucopolysaccharidosis type II (Hunter syndrome) is an X‐linked lysosomal storage disorder caused by a deficiency of the enzyme iduronate‐2‐sulfatase. We sequenced genomic DNA and RT‐PCR products in the iduronate sulfatase (IDS) gene in 6 unrelated patients with Hunter syndrome to assess genotype / phenotype relationships and offer carrier testing where required. Six novel mutations were identified: four missense mutations, one four‐base pair deletion (596‐599delAACA) and a cryptic splice site mutation. Three of the missense mutations were significant amino acid substitutions (S143F, S491F, E341K) of which the latter two involve amino acids conserved amongst sulfatase enzymes. The patients identified with these mutations all had a severe clinical phenotype. One missense mutation with a minimal amino acid substitution (H342Y), in a non‐conserved region of the gene, was associated with a mild clinical phenotype. We identified a novel cryptic splice site (IVS5+934G>A) with some normal (wild type) mRNA processing. We predict that the normal mRNA product confered some residual functional enzyme, resulting in a mild phenotype associated with the absence of overt central nervous system disease. © 1999 Wiley‐Liss, Inc.     

General implications for CpG hot spot mutations: methylation patterns of the human iduronate-2-sulfatase gene locus

The methylation pattern at CpG sites of a housekeeping gene correlates with the likelihood of mutation. Mucopolysaccharidosis (MPS) type II, an X-linked disorder, results from the deficiency of iduronate-2-sulfatase (IDS). In these patients, over 35% of independent point mutations at the IDS gene locus were found at CpG sites as transitional events. To gain insight into the relationship between methylation status and CpG hot spot mutations, we investigated patterns of cytosine methylation in the entire IDS gene, except for introns 4-8. Bisulfite genomic sequencing was performed on the normal leukocyte DNA. Our data show that: 1) cytosine methylation at the CpG sites was extensive, except for those present from the promoter region to a portion of intron 3; 2) a sharp boundary of methylated-nonmethylated regions was observed at the 5'-flanking region, whereas a gradual change in methylation was observed in the 2.0-kb segment in the 3'-flanking region; 3) the boundary of the 5'-flanking region contained multiple Sp1 sites and the TATA box; 4) the CpG sites in exons 1 and 2 were hypomethylated and were associated only with rare transitional mutations, while the CpG sites in exon 3 were also hypomethylated, yet were associated with a high rate of transitional mutations; 5) there was no striking sex difference in the methylation patterns in active alleles; and, 6) the methylation in both strands was symmetrical, except at the boundary of methylated-unmethylated regions.     

Impact of Enzyme Replacement Therapy on Linear Growth in Korean Patients with Mucopolysaccharidosis Type II (Hunter Syndrome)

Hunter syndrome (or mucopolysaccharidosis type II [MPS II]) arises because of a deficiency in the lysosomal enzyme iduronate-2-sulfatase. Short stature is a prominent and consistent feature in MPS II. Enzyme replacement therapy (ERT) with idursulfase (Elaprase®) or idursulfase beta (Hunterase®) have been developed for these patients. The effect of ERT on the growth of Korean patients with Hunter syndrome was evaluated at a single center. This study comprised 32 patients, who had received ERT for at least 2 yr; they were divided into three groups according to their ages at the start of ERT: group 1 (<6 yr, n=14), group 2 (6-10 yr, n=11), and group 3 (10-20 yr, n=7). The patients showed marked growth retardation as they got older. ERT may have less effect on the growth of patients with the severe form of Hunter syndrome. The height z-scores in groups 2 and 3 revealed a significant change (the estimated slopes before and after the treatment were -0.047 and -0.007, respectively: difference in the slope, 0.04; P<0.001). Growth in response to ERT could be an important treatment outcome or an endpoint for future studies.

Graphical Abstract

相似文献   

Mutation analysis of the iduronate-2-sulfatase gene in patients with mucopolysaccharidosis type II (Hunter syndrome).

Iduronate-2-sulfatase (IDS) cDNA from fibroblasts of nine patients with Hunter syndrome (mucopolysaccharidosis type II) was screened for mutations using single strand conformation polymorphism analysis. Direct sequencing revealed a number of different mutations including missense or nonsense point mutations, deletions of one, two, or 60 base pairs, and a 22 base pair-insertion. Mutations of these types probably account for most IDS gene defects as only about 20% of Hunter patients have a complete deletion or gross structural alteration of their IDS gene. Thus the broad clinical variability amongst the Hunter patients may be due to the extensive genetic heterogeneity seen. The relationship between genotype and clinical phenotype is analysed in 12 Hunter patients.     

First experience of enzyme replacement therapy with idursulfase in Spanish patients with Hunter syndrome under 5 years of age: Case observations from the Hunter Outcome Survey (HOS)

Hunter syndrome (mucopolysaccharidosis type II [MPS II], OMIM309900) is a rare X-linked lysosomal storage disorder caused by deficiency of the enzyme iduronate-2-sulphatase, resulting in accumulation of glycosaminoglycans (GAGs), multisystem organ failure and early death. Enzyme replacement therapy (ERT) with idursulfase is commercially available since 2007. Early access programs were established since 2005. However, limited information on the effects of ERT in young children is available to date. The aim of this analysis was therefore to determine the effects of ERT on patients younger than 5 years of age. We report data from six Spanish patients with confirmed Hunter syndrome who were younger than 5 years at the start of ERT, and had been treated with weekly intravenous infusions of idursulfase between 6 and 14 months. Baseline and treatment data were obtained from the Hunter Outcome Survey (HOS). HOS is an international database of MPS II patients on ERT or candidates to be treated, that collects data in a registry manner. HOS is supported by Shire Human Genetic Therapies, Inc. (Cambridge, MA, USA). At baseline, all patients showed neurological abnormalities, including ventriculomegaly, hydrocephaly, cerebral atrophy, perivascular changes and white matter lesions. Other signs and symptoms included thoracic deformity, otitis media, joint stiffness and hepatosplenomegaly, demonstrating that children under 5 years old can also be severely affected. ERT reduced urinary GAG levels, and reduced spleen (n = 2) and liver size (n = 1) after only 8 months. Height growth was maintained within the normal range during ERT. Joint mobility either stabilized or improved during ERT. In conclusion, this case series confirms the early onset of signs and symptoms of Hunter syndrome and provides the first evidence of ERT beneficial effects in patients less than 5 years of age. Similar efficacy and safety profiles to those seen in older children can be suggested, although further studies including a direct comparison with older patients would still be required.     

Iduronate-2-sulfatase gene mutations in 16 patients with mucopolysaccharidosis type II (Hunter syndrome)

Mutations of the iduronate-2-sulfatase gene were identifiedin 16 patients with mucopolysaccharidosis type II (Hunter syndrome).Together with another 10 cases reported by us earlier it emergesthat about 20% of the patients have deletions of the whole geneor other major structural alterations. One, two or three basepair deletions are found in about 23% of the cases while theremaining about 57% carry point mutations predicting amlno acidreplacement, premature termination of translation, or aberrantsplicing. Molecular analysis of mRNA in splice site mutantsshowed that these latter defects frequently resulted in useof cryptic splice sites in exons or introns. 62% of the smalldeletions and point mutations have occurred in 3 of the 9 iduronate-2-sulfatasegene exons. Knowledge of the primary genetic defect allows fastand reliable carrier detection and prenatal diagnosis as wellas insight into the relationship between genotype and phenotype.     

Identification of iduronate sulfatase gene alterations in 70 unrelated Hunter patients

We studied 70 unrelated Hunter patients and found a gene alteration in every patient. The molecular heterogeneity was very important. Large gene rearrangements were identified in 14 patients. Forty-three different mutations were identified in the 56 other patients and 31 were not previously described. Deletions and insertions, splice site mutations were associated with a severe phenotype as nonsense mutations except Q531X. Only a few mutations were present in several patients making difficult genotype-phenotype correlations. Mutation identification allows accurate carrier detection improving prenatal diagnosis. The mother was not found to be a carrier in five cases among the 44 sporadic cases. Haplotype analysis demonstrated a higher frequency of mutations in male meiosis.     

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.