Carbapenem-Resistant Klebsiella pneumoniae Strains Exhibit Diversity in Aminoglycoside-Modifying Enzymes,Which Exert Differing Effects on Plazomicin and Other Agents

We measured in vitro activity of plazomicin, a next-generation aminoglycoside, and other aminoglycosides against 50 carbapenem-resistant Klebsiella pneumoniae strains from two centers and correlated the results with the presence of various aminoglycoside-modifying enzymes (AMEs). Ninety-four percent of strains were sequence type 258 (ST258) clones, which exhibited 5 ompK36 genotypes; 80% and 10% of strains produced Klebsiella pneumoniae carbapenemase 2 (KPC-2) and KPC-3, respectively. Ninety-eight percent of strains possessed AMEs, including AAC(6′)-Ib (98%), APH(3′)-Ia (56%), AAC(3)-IV (38%), and ANT(2″)-Ia (2%). Gentamicin, tobramycin, and amikacin nonsusceptibility rates were 40, 98, and 16%, respectively. Plazomicin MICs ranged from 0.25 to 1 μg/ml. Tobramycin and plazomicin MICs correlated with gentamicin MICs (r = 0.75 and 0.57, respectively). Plazomicin exerted bactericidal activity against 17% (1× MIC) and 94% (4× MIC) of strains. All strains with AAC(6′)-Ib were tobramycin-resistant; 16% were nonsusceptible to amikacin. AAC(6′)-Ib combined with another AME was associated with higher gentamicin, tobramycin, and plazomicin MICs than AAC(6′)-Ib alone (P = 0.01, 0.0008, and 0.046, respectively). The presence of AAC(3)-IV in a strain was also associated with higher gentamicin, tobramycin, and plazomicin MICs (P = 0.0006, P < 0.0001, and P = 0.01, respectively). The combination of AAC(6′)-Ib and another AME, the presence of AAC(3)-IV, and the presence of APH(3′)-Ia were each associated with gentamicin resistance (P = 0.0002, 0.003, and 0.01, respectively). In conclusion, carbapenem-resistant K. pneumoniae strains (including ST258 clones) exhibit highly diverse antimicrobial resistance genotypes and phenotypes. Plazomicin may offer a treatment option against strains resistant to other aminoglycosides. The development of molecular assays that predict antimicrobial responses among carbapenem-resistant K. pneumoniae strains should be a research priority.     

Novel Aminoglycoside 2″-Phosphotransferase Identified in a Gram-Negative Pathogen

Aminoglycoside 2″-phosphotransferases are the major aminoglycoside-modifying enzymes in clinical isolates of enterococci and staphylococci. We describe a novel aminoglycoside 2″-phosphotransferase from the Gram-negative pathogen Campylobacter jejuni, which shares 78% amino acid sequence identity with the APH(2″)-Ia domain of the bifunctional aminoglycoside-modifying enzyme aminoglycoside (6′) acetyltransferase-Ie/aminoglycoside 2″-phosphotransferase-Ia or AAC(6′)-Ie/APH(2″)-Ia from Gram-positive cocci, which we called APH(2″)-If. This enzyme confers resistance to the 4,6-disubstituted aminoglycosides kanamycin, tobramycin, dibekacin, gentamicin, and sisomicin, but not to arbekacin, amikacin, isepamicin, or netilmicin, but not to any of the 4,5-disubstituted antibiotics tested. Steady-state kinetic studies demonstrated that GTP, and not ATP, is the preferred cosubstrate for APH(2″)-If. The enzyme phosphorylates the majority of 4,6-disubstituted aminoglycosides with high catalytic efficiencies (k_cat/K_m = 10⁵ to 10⁷ M⁻¹ s⁻¹), while the catalytic efficiencies against the 4,6-disubstituted antibiotics amikacin and isepamicin are 1 to 2 orders of magnitude lower, due mainly to the low apparent affinities of these substrates for the enzyme. Both 4,5-disubstituted antibiotics and the atypical aminoglycoside neamine are not substrates of APH(2″)-If, but are inhibitors. The antibiotic susceptibility and substrate profiles of APH(2″)-If are very similar to those of the APH(2″)-Ia phosphotransferase domain of the bifunctional AAC(6′)-Ie/APH(2″)-Ia enzyme.     

UK-18,892: Resistance to Modification by Aminoglycoside-Inactivating Enzymes

UK-18,892, a new semisynthetic aminoglycoside, was active against bacteria possessing aminoglycoside-inactivating enzymes, with the exception of some known to possess AAC(6′) or AAD(4′) enzymes. This activity has been rationalized by using cell-free extracts of bacteria containing known inactivating enzymes, where it was shown that UK-18,892 was not a substrate for the APH(3′), AAD(2″), AAC(3), and AAC(2′) enzymes. It was also demonstrated that UK-18,892 protected mice against lethal infections caused by organisms possessing aminoglycoside-inactivating enzymes.     

Structural Basis of APH(3′)-IIIa-Mediated Resistance to N1-Substituted Aminoglycoside Antibiotics

Butirosin is unique among the naturally occurring aminoglycosides, having a substituted amino group at position 1 (N1) of the 2-deoxystreptamine ring with an (S)-4-amino-2-hydroxybutyrate (AHB) group. While bacterial resistance to aminoglycosides can be ascribed chiefly to drug inactivation by plasmid-encoded aminoglycoside-modifying enzymes, the presence of an AHB group protects the aminoglycoside from binding to many resistance enzymes, and hence, the antibiotic retains its bactericidal properties. Consequently, several semisynthetic N1-substituted aminoglycosides, such as amikacin, isepamicin, and netilmicin, were developed. Unfortunately, butirosin, amikacin, and isepamicin are not resistant to inactivation by 3′-aminoglycoside O-phosphotransferase type IIIa [APH(3′)-IIIa]. We report here the crystal structure of APH(3′)-IIIa in complex with an ATP analog, AMPPNP [adenosine 5′-(β,γ-imido)triphosphate], and butirosin A to 2.4-Å resolution. The structure shows that butirosin A binds to the enzyme in a manner analogous to other 4,5-disubstituted aminoglycosides, and the flexible antibiotic-binding loop is key to the accommodation of structurally diverse substrates. Based on the crystal structure, we have also constructed a model of APH(3′)-IIIa in complex with amikacin, a commonly used semisynthetic N1-substituted 4,6-disubstituted aminoglycoside. Together, these results suggest a strategy to further derivatize the AHB group in order to generate new aminoglycoside derivatives that can elude inactivation by resistance enzymes while maintaining their ability to bind to the ribosomal A site.Aminoglycosides encompass a vast group of molecules with important antibiotic activities. They are often prescribed for the treatment of serious nosocomial infections and, in some cases, protozoan infections (6). Moreover, their potential as antiviral agents has also been under intense investigation in recent years (33, 47, 50). The high efficacy of aminoglycosides as antibacterial agents is in part due to their bactericidal capability. Most aminoglycosides kill the bacteria by targeting the A site of the 16S rRNA (40). Upon binding of the drug, key nucleotides in the decoding region of the ribosome undergo conformational changes that promote the interactions between mRNA and near-cognate or noncognate tRNA, leading to errors in protein translation (45). Unfortunately, the extensive use of aminoglycosides has undermined their effectiveness, due to the emergence of resistance in pathogens. Resistance to aminoglycosides can predominantly be attributed to covalent modification of the drug catalyzed by plasmid-encoded aminoglycoside-modifying enzymes, especially the O-phosphotransferases, which generally give high levels of resistance (16). Covalent modification diminishes the antibiotics'' ability to bind to their targets, and therefore, they can no longer exert their bactericidal effects (34).Butirosins are unique among the naturally occurring aminoglycosides due to the (S)-4-amino-2-hydroxybutyrate (AHB) side chain moiety substituted at the amino group at position 1 (N1) of the 2-deoxystreptamine ring. While most aminoglycosides routinely lose their potency due to inactivation by an aminoglycoside-modifying enzyme, butirosin is able to elude many inactivating enzymes, thus retaining its bactericidal capabilities (51). This observation prompted the development of semisynthetic N1-substituted aminoglycoside antibiotics such as amikacin and arbekacin (kanamycin A and dibekacin derivated at N1 by AHB, respectively) (23, 26, 30, 31), isepamicin (gentamicin B substituted with 4-amino-2-hydroxypropionyl at N1) (41), and netilmicin (sisomicin with an ethyl group introduced at N1) (54). These compounds have been shown to be clinically useful against some aminoglycoside-resistant strains, such as methicillin-resistant Staphylococcus aureus (29). It is thought that the AHB and other acyl side chains at the 1-amino position hinder binding to the aminoglycoside-modifying enzymes without affecting binding to the ribosome A site. Recently, the capability of amikacin binding to the ribosome was illustrated by Kondo et al. in the crystal structure of an RNA fragment containing the A site in complex with amikacin (28).Nonetheless, many of these N1-substituted aminoglycosides are not immune to inactivation by all aminoglycoside kinases. For example, butirosin, amikacin, and isepamicin can be inactivated by 3′-aminoglycoside O-phosphotransferase type IIIa [APH(3′)-IIIa] via the addition of a phosphate group. APH(3′)-IIIa is found in many gram-positive bacteria, such as enterococci and staphylococci, and is perhaps the most-studied aminoglycoside resistance factor, as it has an unusually broad substrate profile (37).Considerable knowledge of the accommodation of the structurally diverse substrates by APH(3′)-IIIa has been gained in recent years. Crystal structures of APH(3′)-IIIa in the apo, nucleotide-bound, and ternary complexes, with both the nucleotide and the aminoglycoside antibiotic, have been determined (9, 18, 24). The ternary complexes confirmed the importance of electrostatic interactions in substrate binding and revealed that discrete pockets and a flexible binding loop are used to accommodate aminoglycosides of different shapes and sizes (18). To date, the conformations of several aminoglycosides, including those that are substituted at N1 such as amikacin, isepamicin, and butirosin, bound to APH(3′)-IIIa, have been studied by nuclear magnetic resonance (NMR) spectroscopy (12-14, 48). These studies suggest that different aminoglycosides may assume markedly different conformations and that there is little similarity between the binding properties of 4,5- and 4,6-disubstituted aminoglycosides. Moreover, a comparison of the aminoglycoside conformations observed in the ternary crystal structures of APH(3′)-IIIa and those obtained from NMR experiments shows limited resemblance. Most importantly, none of the NMR studies have indicated how the substitution at N1 is accommodated by the kinase. Here, we report the crystal structure of APH(3′)-IIIa in complex with AMPPNP [adenosine 5′-(β,γ-imido)triphosphate; a nonhydrolyzable ATP analog] and butirosin A, as well as a computationally deduced model for APH(3′)-IIIa bound with amikacin, a prototypical semisynthetic N1-substituted aminoglycoside. These results improve our understanding of the effectiveness of APH(3′)-IIIa as a resistant enzyme and provide information for the development of new derivatives.     

A New High-Level Gentamicin Resistance Gene,aph(2")-Id,in Enterococcus spp.

Enterococcus casseliflavus UC73 is a clinical blood isolate with high-level resistance to gentamicin. DNA preparations from UC73 failed to hybridize with intragenic probes for aac(6′)-Ie-aph(2")-Ia and aph(2")-Ic. A 4-kb fragment from UC73 was cloned and found to confer resistance to gentamicin in Escherichia coli DH5α transformants. Nucleotide sequence analysis revealed the presence of a 906-bp open reading frame whose deduced amino acid sequence had a region with homology to the aminoglycoside-modifying enzyme APH(2")-Ic and to the C-terminal domain of the bifunctional enzyme AAC(6′)-APH(2"). The gene is designated aph(2")-Id, and its observed phosphotransferase activity is designated APH(2")-Id. A PCR-generated intragenic probe hybridized to the genomic DNA from 17 of 118 enterococcal clinical isolates (108 with high-level gentamicin resistance) from five hospitals. All 17 were vancomycin-resistant Enterococcus faecium isolates, and pulsed-field typing revealed three distinct clones. The combination of ampicillin plus either amikacin or neomycin exhibited synergistic killing against E. casseliflavus UC73. Screening and interpretation of high-level aminoglycoside resistance in enterococci may need to be modified to include detection of APH(2")-Id.High-level gentamicin resistance (MIC ≥ 2,000 μg/ml) in enterococci is known to be associated with the aac(6′)-Ie-aph(2")-Ia gene, which encodes the bifunctional aminoglycoside-modifying enzyme AAC(6′)-APH(2") (14). The presence of this gene eliminates the synergism between a cell wall-active agent, such as ampicillin or vancomycin, and virtually all commercially available aminoglycosides—including gentamicin, tobramycin, netilmicin, kanamycin, and amikacin—except streptomycin (17). aph(2")-Ic is a midlevel gentamicin resistance gene (MIC = 256 μg/ml), found less commonly than aac(6′)-Ie-aph(2")-Ia in enterococci, that eliminates the synergism between ampicillin and gentamicin (6). We describe a new high-level gentamicin resistance gene initially found in Enterococcus casseliflavus that is distinct from aac(6′)-Ie-aph(2")-Ia and aph(2")-Ic.(This work was presented in part at the Infectious Diseases Society of America 34th Annual Meeting, New Orleans, La., 18 to 20 September 1996 [25], and the 97th General Meeting of the American Society for Microbiology, Miami Beach, Fla., 4 to 8 May 1997 [26].)     

R Factor-Mediated Aminoglycoside Antibiotic Resistance in Pseudomonas aeruginosa: a New Aminoglycoside 6′-N-Acetyltransferase

The newly introduced semisynthetic aminoglycoside antibiotics, i.e., 3′,4′-dideoxykanamycin B (DKB), 6′-N-methyl DKB (6′-Me-DKB) and amikacin (AK) have been found to be effective against gram-negative pathogens including Pseudomonas aeruginosa, which are resistant to the known aminoglycoside antibiotics. We have demonstrated in our stock cultures two types of P. aeruginosa strains resistant to DKB, i.e., (DKB^r.AK^r.6′-Me-DKB^s) and (DKB^r.AK^s.6′-Me-DKB^r) (where r = resistant; s = sensitive). Both groups of strains inactivate the drugs by acetylation. The acetylating enzyme was extracted from GN4925(DKB^r.AK^s.6′-Me-DKB^r) and purified by affinity chromatography. Enzymatic studies of the inactivation reaction and chemical studies of the inactivated products indicated that DKB and 6′-Me-DKB were inactivated by acetylation of the 6′-amino group of the drugs. This enzyme acetylates kanamycin A (KM-A), KM-B, DKB, 6′-Me-DKB, 6′-N-methyl kanamycin B, but not KM-C, AK, and gentamicin C₁. The enzyme is named aminoglycoside 6′-N-acetyltransferase 3. Genetic studies of two strains resistant to DKB and 6′-Me-DKB disclosed that the enzyme catalyzing inactivation of both DKB and 6′-Me-DKB was mediated by an R factor, i.e., R_ms167 and R_ms168, capable of conferring resistance to KM, DKB, and 6′-Me-DKB, in addition to resistance to gentamicin, streptomycin, and sulfanilamide, and resistance to tetracycline, chloramphenicol, streptomycin and sulfanilamide respectively.     

Aminoglycoside 6′-N-Acetyltransferase Variants of the Ib Type with Altered Substrate Profile in Clinical Isolates of Enterobacter cloacae and Citrobacter freundii

Three clinical isolates, Enterobacter cloacae EC1562 and EC1563 and Citrobacter freundii CFr564, displayed an aminoglycoside resistance profile evocative of low-level 6′-N acetyltransferase type II [AAC(6′)-II] production, which conferred reduced susceptibility to gentamicin but not to amikacin or isepamicin. Aminoglycoside acetyltransferase assays suggested the synthesis in the three strains of an AAC(6′) which acetylated amikacin practically as well as it acetylated gentamicin in vitro. Both compounds, however, as well as isepamicin, retained good bactericidal activity against the three strains. The aac genes were borne by conjugative plasmids (pLMM562 and pLMM564 of ca. 100 kb and pLMM563 of ca. 20 kb). By PCR mapping and nucleotide sequence analysis, an aac(6′)-Ib gene was found in each strain upstream of an ant(3")-I gene in a sulI-type integron. The size of the AAC(6′)-Ib variant encoded by pLMM562 and pLMM564, AAC(6′)-Ib₇, was deduced to be 184 (or 177) amino acids long, whereas in pLMM563 a 21-bp duplication allowing the recruitment of a start codon resulted in the translation of a variant, AAC(6′)-Ib₈, of 196 amino acids, in agreement with size estimates obtained by Western blot analysis. Both variants had at position 119 a serine instead of the leucine typical for the AAC(6′)-Ib variants conferring resistance to amikacin. By using methods that predict the secondary structure, these two amino acids appear to condition an α-helical structure within a putative aminoglycoside binding domain of AAC(6′)-Ib variants.     

Inhibition of Aminoglycoside Acetyltransferase Resistance Enzymes by Metal Salts

Aminoglycosides (AGs) are clinically relevant antibiotics used to treat infections caused by both Gram-negative and Gram-positive bacteria, as well as Mycobacteria. As with all current antibacterial agents, resistance to AGs is an increasing problem. The most common mechanism of resistance to AGs is the presence of AG-modifying enzymes (AMEs) in bacterial cells, with AG acetyltransferases (AACs) being the most prevalent. Recently, it was discovered that Zn²⁺ metal ions displayed an inhibitory effect on the resistance enzyme AAC(6′)-Ib in Acinetobacter baumannii and Escherichia coli. In this study, we explore a wide array of metal salts (Mg²⁺, Cr³⁺, Cr⁶⁺, Mn²⁺, Co²⁺, Ni²⁺, Cu²⁺, Zn²⁺, Cd²⁺, and Au³⁺ with different counter ions) and their inhibitory effect on a large repertoire of AACs [AAC(2′)-Ic, AAC(3)-Ia, AAC(3)-Ib, AAC(3)-IV, AAC(6′)-Ib′, AAC(6′)-Ie, AAC(6′)-IId, and Eis]. In addition, we determine the MIC values for amikacin and tobramycin in combination with a zinc pyrithione complex in clinical isolates of various bacterial strains (two strains of A. baumannii, three of Enterobacter cloacae, and four of Klebsiella pneumoniae) and one representative of each species purchased from the American Type Culture Collection.     

Bulky “Gatekeeper” Residue Changes the Cosubstrate Specificity of Aminoglycoside 2″-Phosphotransferase IIa

The aminoglycoside 2″-phosphotransferases APH(2″)-IIa and APH(2″)-IVa can utilize ATP and GTP as cosubstrates, since both enzymes possess overlapping but discrete structural templates for ATP and GTP binding. APH(2″)-IIIa uses GTP exclusively, because its ATP-binding template is blocked by a bulky tyrosine “gatekeeper” residue. Replacement of the “gatekeeper” residues M85 and F95 in APH(2″)-IIa and APH(2″)-IVa, respectively, by tyrosine does not significantly change the antibiotic susceptibility profiles produced by the enzymes. In APH(2″)-IIa, M85Y substitution results in an ∼10-fold decrease in the K_m value of GTP and an ∼320-fold increase in the K_m value of ATP. In APH(2″)-IVa, F95Y substitution results in a modest decrease in the K_m values of both GTP and ATP. Structural analysis indicates that in the APH(2″)-IIa M85Y mutant, tyrosine blocks access of ATP to the correct position in the binding site, while the larger nucleoside triphosphate (NTP)-binding pocket of the APH(2″)-IVa F95Y mutant allows the tyrosine to move away, thus giving access to the ATP-binding template.     

KPC-Producing Klebsiella pneumoniae Strains That Harbor AAC(6′)-Ib Exhibit Intermediate Resistance to Amikacin

The aminoglycoside-modifying enzyme AAC(6′)-Ib is common among carbapenem-resistant Klebsiella pneumoniae (CR-Kp) strains. We investigated amikacin (AMK) activity against 20 AAC(6′)-Ib-producing CR-Kp strains. MICs clustered at 16 to 32 μg/ml. By the time-kill study, AMK (1× and 4× the MIC) was bactericidal against 30% and 85% of the strains, respectively. At achievable human serum concentrations, however, the majority of strains showed regrowth, suggesting that AAC(6′)-Ib confers intermediate AMK resistance. AMK and trimethoprim-sulfamethoxazole (TMP-SMX) were synergistic against 90% of the strains, indicating that the combination may overcome resistance.     

High-Resolution Melt Curve Analysis for Identification of Single Nucleotide Mutations in the Quinolone Resistance Gene aac(6′)-Ib-cr

We have developed a simple PCR-based high-resolution melt curve analysis for identification of the quinolone resistance gene aac(6′)-Ib-cr through regions encompassing the two defining single nucleotide mutations. Dissociation curves showed 100% concordance with DNA sequencing, including the identification of a strain where aac(6′)-Ib and aac(6′)-Ib-cr coexist.The cr variant of aac(6′)-Ib encodes an aminoglycoside acetyltransferase that confers reduced susceptibility to ciprofloxacin and norfloxacin by N acetylation of their piperazinyl amines (8). aac(6′)-Ib-cr belongs to the group of plasmid-mediated quinolone resistance genes that determine small increases in the MICs that are sufficient to facilitate the selection of higher-level-resistance mutants (10). However, this low-level quinolone resistance is below the CLSI breakpoint for nonsusceptibility and is not detected in the clinical laboratory. Development of efficient techniques for detection of clinical isolates carrying aac(6′)-Ib-cr may improve optimization of antibiotic treatment. The resistance phenotype of AAC(6′)-Ib-cr is dependent on the effects of the individual mutations. Asp181Tyr (coded by G541T) produces a partial-resistance phenotype and Trp104Arg (coded by either T310C or T310A) no detectable resistance, but together, the two mutations confer the full resistance phenotype (the nucleotide positions correspond to GenBank accession number {"type":"entrez-nucleotide","attrs":{"text":"AF479774","term_id":"19698424","term_text":"AF479774"}}AF479774; see also the cr variant under GenBank accession number {"type":"entrez-nucleotide","attrs":{"text":"AY259086","term_id":"30349182","term_text":"AY259086"}}AY259086) (8). We previously showed that the gap-ligase chain reaction (LCR) is an inexpensive technique suited to large-scale surveys, albeit time-consuming (13).Improved real-time PCR machines and software analysis packages in recent years have enhanced the resolution of melting temperature (T_m) differences between amplicons from 2°C to 0.01°C in modern instruments (4, 7). Such resolution is now sufficient for identification of transitions or transversions that involve A ↔ C or G ↔ T and can be applied in high-resolution melting curve analysis (HRMA) to identify a single nucleotide change inside a full-length amplicon (12). Melt analysis and its more sophisticated high-resolution variant are being increasingly applied to identify quinolone resistance mutations in type II topoisomerases of Haemophilus influenzae (5) and Neisseria gonorrhoeae (11), to genotype Mycoplasma pneumoniae isolates (9), or to identify multidrug-resistant Mycobacterium tuberculosis (6). We developed and validated a real-time PCR-based HRMA using SYBR green I to rapidly detect aac(6′)-Ib-cr and distinguish it from aac(6′)-Ib.A homology search in GenBank identified 181 sequences described as aac(6′)-Ib, of which 22 corresponded to the aac(6′)-Ib-cr variant. Alignment of all sequences was used to design two pairs of primers (Geneious Pro 4) (2). The pair comprising aac6-5′278 (GTCGTACGTTGCTCTTGGAA) and aac6-5′352 (GGTCTATTCCGCGTACTCCT) and the pair comprising aac6-3′508 (GGGTTTGAGAGGCAAG GTA) and aac6-3′582 (GAATGCCTGGCGTGTTTG) amplified 73- and 74-bp products, designated the 5′ region and the 3′ region, respectively, that corresponded to nucleotides 278 to 352 and 508 to 582, respectively, in aac(6′)-Ib (GenBank accession number {"type":"entrez-nucleotide","attrs":{"text":"AF479774","term_id":"19698424","term_text":"AF479774"}}AF479774).In developing the HRMA method, we used four different alleles of aac(6′)-Ib that we had previously generated by site-directed mutagenesis (8): aac0, encoding wild-type aac(6′)-Ib; aac1, encoding aac(6′)-Ib-cr; and aac2 and aac3, encoding aac(6′)-Ib with single mutations T310C and G541T, respectively. The assay was validated on nine aac(6′)-ib-cr-positive and 10 wild-type strains from a collection of clinical isolates already screened for aac(6′)-Ib-cr by gap-LCR and verified by sequencing (13).Plasmid DNA from control strains was extracted using a QIAamp DNA minikit (Qiagen, Valencia, CA) in accordance with the manufacturer''s instructions. Colonies were transferred to Tris-HCl (pH 7.4) in a 2-ml screw-cap tube and heated for 2 min at 98°C to prepare DNA templates from tested strains.Real-time PCR and HRMA were performed using a Rotor-Gene 6000 apparatus (Corbett Life Science, Australia) in a total volume of 20 μl; the run consisted of 30 cycles at 93°C for 10 s, followed by 58°C for 10 s and 72°C for 6 s. The high-resolution-melt (HRM) conditions were 2 s at 95°C followed by 90 s at 55°C premelt, with an HRM ramp from 76°C to 86°C, rising by 0.04°C each step and holding for 2 s on each step. Gain optimization before the melt on all tubes was selected. SYBR green I (DyNAmo Flash SYBR green quantitative PCR [qPCR] kit; Finnzymes) was used with an excitation wavelength at 470 nm and detection at 510 nm. For normalization, the temperature ranges were 75.34°C to 77.51°C for the leading range and 82.39°C to 84.30°C for the trailing range. Calculations were done using the Rotor-Gene software program (version 1.7). A confidence value is provided as an integrity check of autocalled results. Serial 10-fold dilutions of extracted DNA from the control strains were amplified and subjected to HRMA. The distinctive typing that resulted from the type-specific melt profiles of the 5′ region (Fig. ​(Fig.11 A) and the 3′ region (Fig. ​(Fig.1B)1B) showed that all amplicons were reliably sorted into one of the two distinct groups within each region.Open in a separate windowFIG. 1.Dissociation curves. Normalized and temperature-shifted difference plots for mutant discrimination by HRMA. (A) Normalized melt curve plot of the 5′ region showing T → C transition and (as shown in the nested graph) the normalized temperature minus the temperature shift for the same amplicon (T). (B) Normalized melt curve plot of the 3′ region, showing G → T transversion and (as shown in the nested graph) the normalized temperature minus the temperature shift for the same amplicon (G). Corresponding nucleotides (C, G, and T) are depicted next to each curve. The nucleotide present in aac(6′)-Ib was used to normalize each temperature shift graph. Dotted lines correspond to a heterozygote.The estimated error rates for genotyping homozygotes as a function of their T_m varied from instrument to instrument, and this rate was found to be less than 0.01 at 0.5°C for an amplicon of 110 bp with the use of the Rotor-Gene 3000 instrument (4). The intra-assay variation was calculated for two replicas of four 10-fold dilutions of each mutant. The standard deviations (SD) of the T_m varied from 0.01 (with a T_m of 79.20°C for nucleotide T in the 5′ region and a 73-bp amplicon) to 0.055 (for nucleotide T in the 3′ region with a T_m of 79.26°C and an amplicon of 74 bp). The differences in T_m (ΔT_m) between amplicons for the 5′ and 3′ regions were 0.62°C and 0.71°C, respectively, with a confidence level above 97% in all cases.As expected, no PCR products were obtained from dozens of clinical strains lacking aac(6′)-Ib and its variant. We then assayed 43 carbapenemase-producing Enterobacteriaceae with an unknown aac(6′)-Ib genotype isolated from wounds, sputa, and urine samples. One and 41 isolates were positive for aac(6′)-Ib-cr and aac(6′)-Ib, respectively; the HRMA results for these amplicons were sorted in the expected group, with confidence averages of 97.9% for the 5′ region (SD = 2.3) and 97.1% for the 3′ region (SD = 2.1). For one strain, a dissociation curve was interpreted as having variations (less than 85% confidence) in both the 5′ and the 3′ regions (Fig. ​(Fig.1).1). The distinct T_m plot of this amplicon is visible on the normalized graphics (Fig. ​(Fig.1,1, nested graphics). Sequencing demonstrated double peaks corresponding to the nucleotides cytosine and thymine at position 310 and guanine and thymine at position 541 in aac(6′)-Ib-cr.PCR products were obtained for every strain used for validation, thus supporting the utility of the boiling extraction method as a reliable, fast, and inexpensive method for obtaining whole-cell DNA as a template for this PCR.HRMA may detect other mutations that are not the target of the screening within the amplified region. In addition, because the melting temperature is the same, the HRMA might not have detected a T310A mutation. Recently, a report on the detection of aac(6′)-Ib-cr through its T310C or T310A mutations by the use of an asymmetric concentration of primers to promote amplification of the DNA strand complementary to an unlabeled and 3′ phosphorylated probe for HRMA was published (1). An evolutionary step for aac(6′)-Ib with a single mutation in either position 310 or position 541 (not investigated in that study) is plausible (1, 3), and its identification would be an important contribution to the understanding of the evolution of aac(6′)-Ib-cr and the tracking of its epidemiology. By analyzing the two aac(6′)-Ib-cr-characterizing regions, we ensured the accuracy of detection of the cr variant, even indicating whether this variant had been determined by a mutation at position 541. We have developed a simple and rapid real-time PCR-based HRMA that is able to detect aac(6′)-Ib-cr and discriminate between the two aac(6′)-Ib single nucleotide mutations required for the ciprofloxacin resistance phenotype. This approach provides an improvement over laborious procedures such as gap-LCR or expensive sequencing methods. Further research is needed in applying rapid diagnostic procedures for the detection of additional plasmid-mediated quinolone resistance genes.     

High prevalence of plasmid-mediated quinolone resistance determinants qnr, aac(6')-Ib-cr, and qepA among ceftiofur-resistant Enterobacteriaceae isolates from companion and food-producing animals

Three kinds of plasmid-mediated quinolone resistance (PMQR) determinants have been discovered and have been shown to be widely distributed among clinical isolates: qnr genes, aac(6′)-Ib-cr, and qepA. Few data on the prevalence of these determinants in strains from animals are available. The presence of PMQR genes in isolates from animals was determined by PCR amplification and DNA sequencing. The production of extended-spectrum β-lactamases (ESBLs) and AmpC β-lactamases in the strains was detected, and their genotypes were determined. The genetic environment of PMQR determinants in selected plasmids was analyzed. All samples of ceftiofur-resistant (MICs ≥ 8 μg/ml) isolates of the family Enterobacteriaceae were selected from 36 companion animals and 65 food-producing animals in Guangdong Province, China, between November 2003 and April 2007, including 89 Escherichia coli isolates, 9 Klebsiella pneumoniae isolates, and isolates of three other genera. A total of 68.3% (69/101) of the isolates produced ESBLs and/or AmpC β-lactamases, mainly those of the CTX-M and CMY types. Of the 101 strains, PMQR determinants were present in 35 (34.7%) isolates, with qnr, aac(6′)-Ib-cr, and qepA detected alone or in combination in 8 (7.9%), 19 (18.8%), and 16 (15.8%) strains, respectively. The qnr genes detected included one qnrB4 gene, four qnrB6 genes, and three qnrS1 genes. Five strains were positive for both aac(6′)-Ib-cr and qepA, while one strain was positive for qnrS1, aac(6′)-Ib-cr, and qepA. qnrB6 was flanked by two copies of ISCR1 with an intervening dfr gene downstream and sul1 and qacEΔ1 genes upstream. In another plasmid, aac(6′)-Ib-cr followed intI1 and arr-3 was downstream. PMQR determinants are highly prevalent in ceftiofur-resistant Enterobacteriaceae strains isolated from animals in China. This is the first report of the occurrence of PMQR determinants among isolates from companion animals.     

Electronic effects on the mechanism of the NAD+ coenzyme reduction catalysed by a non-organometallic ruthenium(ii) polypyridyl amine complex in the presence of formate

In the present study, electronic effects on the mechanism of the NAD⁺ coenzyme reduction in the presence of formate, catalysed by a non-organometallic ruthenium(ii) polypyridyl amine complex, were investigated. The [Ru^II(terpy)(ampy)Cl]Cl (terpy = 2,2′:6′,2′′-terpyridine, ampy = 2-(aminomethyl)pyridine) complex was employed as the catalyst. The reactions were studied in a water/ethanol mixture as a function of formate, catalyst, and NAD⁺ concentrations at 37 °C. The overall process was found to be 11 to 18 times slower than for the corresponding ethylenediamine (en) complex as the result of π-back bonding effects of the ampy ligand. The mechanistic studies revealed a complete set of reactions that accounted for the overall catalytic cycle based on a formate-induced hydride transfer reaction to form the reduced coenzyme, NADH. The geometries of the ruthenium(ii)-ampy complexes involved in the catalytic cycle and free energy changes for the main steps were predicted by DFT calculations. Similar calculations were also performed for the analogues ruthenium(ii)-en and ruthenium(ii)-bipy complexes (bipy = 2,2′-bipyridine). The DFT calculated energies show that both the solvent-formato exchange and the formato-hydrido conversion reactions have negative (favourable) energies to proceed spontaneously. The reactions involving the en complex have the more negative (favourable) reaction energies, followed by the ampy complex, in agreement with faster reactions for en complexes and slower reactions for bipy complexes than for ampy complexes.

The graphical abstract represents the overall catalytic cycle in which the non-organometallic Ru(ii) formato complex releases CO₂ and transfers hydride to NAD⁺ to form NADH coenzyme.     

In vitro resistance selection and in vivo efficacy of morpholino oligomers against West Nile virus

We characterize in vitro resistance to and demonstrate the in vivo efficacy of two antisense phosphorodiamidate morpholino oligomers (PMOs) against West Nile virus (WNV). Both PMOs were conjugated with an Arg-rich peptide. One peptide-conjugated PMO (PPMO) binds to the 5′ terminus of the viral genome (5′-end PPMO); the other targets an essential 3′ RNA element required for genome cyclization (3′ conserved sequence I [3′ CSI] PPMO). The 3′ CSI PPMO displayed a broad spectrum of antiflavivirus activity, suppressing WNV, Japanese encephalitis virus, and St. Louis encephalitis virus, as demonstrated by reductions in viral titers of 3 to 5 logs in cell cultures, likely due to the absolute conservation of the 3′ CSI PPMO-targeted sequences among these viruses. The selection and sequencing of PPMO-resistant WNV showed that the 5′-end-PPMO-resistant viruses contained two to three mismatches within the PPMO-binding site whereas the 3′ CSI PPMO-resistant viruses accumulated mutations outside the PPMO-targeted region. The mutagenesis of a WNV infectious clone demonstrated that the mismatches within the PPMO-binding site were responsible for the 5′-end PPMO resistance. In contrast, a U insertion or a G deletion located within the 3′-terminal stem-loop of the viral genome was the determinant of the 3′ CSI PPMO resistance. In a mouse model, both the 5′-end and 3′ CSI PPMOs (administered at 100 or 200 μg/day) partially protected mice from WNV disease, with minimal to no PPMO-mediated toxicity. A higher treatment dose (300 μg/day) caused toxicity. Unconjugated PMOs (3 mg/day) showed neither efficacy nor toxicity, suggesting the importance of the peptide conjugate for efficacy. The results suggest that a modification of the peptide conjugate composition to reduce its toxicity yet maintain its ability to effectively deliver PMO into cells may improve PMO-mediated therapy.     

Target-induced activation of DNAzyme for highly sensitive colorimetric detection of bleomycin via DNA scission

In this work, a label-free and sensitive colorimetric sensing strategy for the detection of bleomycin (BLM) was developed on the basis of BLM-mediated activation of G-quadruplex DNAzyme via DNA strand scission. A G-quadruplex based hairpin probe (G4HP) containing the scission site (5′-GT-3′) of BLM at the loop region and guanine (G)-rich sequences at its 5′-end was employed in this protocol. In the presence of BLM, it may cleave the 5′-GT-3′ site of the hairpin probe with Fe(ii) as a cofactor, releasing the G-tetrads DNA fragment, which may further bind hemin to form a catalytic G-quadruplex-hemin DNAzyme. The resultant G-quadruplex DNAzyme has notable peroxidase-like activity, which effectively catalyzes the oxidation of 2,2′-azino-bis(3-ethylbenzothiozoline-6-sulfonic acid) (ABTS) by H₂O₂ to produce the blue-green-colored free-radical cation (ABTS^·+). Therefore, the detection of BLM can be achieved by observing the color transition with the naked eye or measuring the absorbance at a wavelength of 420 nm using a UV-Vis spectrophotometer. Attributing to the specific BLM-induced DNA strand scission and the effective locking of G-tetrads in the stem of the G4HP, the colorimetric sensing strategy exhibits high sensitivity and selectivity for detection of BLM in human serum samples, which might hold great promise for BLM assay in biomedical and clinical research.

A label-free and sensitive colorimetric strategy for bleomycin detection was developed based on target-induced activation of DNAzyme via DNA scission.     

Mechanism studies of addition reactions between the pyrimidine type radicals and their 3′/5′ neighboring deoxyguanosines

To clarify the biologically significant sequence effect existing in the formation of the pyrimidine-type radicals induced DNA intrastrand cross-links, addition mechanisms between the uridine-5-methyl (˙U_CH2), 6-hydroxy-5,6-dihydrothymidine-5-yl (˙T_6OH), and 6-hydroxy-5,6-dihydrocytidine-5-yl (˙C_6OH) radicals and their 3′/5′ neighboring deoxyguanosines (dG) are explored in the present study employing the model 5′-G(˙U_CH2)-3′, 5′-(˙U_CH2)G-3′, 5′-G(˙T_6OH)-3′, 5′-(˙T_6OH)G-3′, 5′-G(˙C_6OH)-3′, and 5′-(˙C_6OH)G-3′ sequences. It is found that the 5′ G/C₈ additions of the three radicals are all simple direct one-step reactions inducing only relatively small structural changes, while a conformational adjustment involving orientation transitions of both nucleobase moieties and twisting of the DNA backbone is indispensable for each 3′ G/C₈ addition. Furthermore, markedly positive reaction free energy requirements are estimated for these conformational transformations making the 3′ G/C₈ additions of the three radicals thermodynamically much more unfavorable than the corresponding 5′ G/C₈ additions. Such essential conformational adjustments along the 3′ G/C₈ addition paths that structurally greatly influence the local DNA structures and thermodynamically substantially reduce the addition efficiencies may be the reasons responsible for the differences in the formation yields and biological consequences of the pyrimidine-type radicals induced DNA intrastrand cross-link lesions.

For each radical, the 5′ G/C₈ addition is a simple direct one-step reaction, while a structurally significant and thermodynamically markedly unfavorable conformational adjustment is indispensable for the 3′ G/C₈ addition.     

Synthesis,gene silencing activity,thermal stability,and serum stability of siRNA containing four (S)-5′-C-aminopropyl-2′-O-methylnucleosides (A,adenosine; U,uridine; G,guanosine; and C,cytidine)

Herein, we report the synthesis of (S)-5′-C-aminopropyl-2′-O-methyladenosine and (S)-5′-C-aminopropyl-2′-O-methylguanosine phosphoramidites and the properties of small interfering RNAs (siRNAs) containing four (S)-5′-C-aminopropyl-2′-O-methylnucleosides (A, adenosine; U, uridine; G, guanosine; and C, cytidine). The siRNAs containing (S)-5′-C-aminopropyl-nucleosides at the 3′- and 5′-regions of the passenger strand were well tolerated for RNA interference (RNAi) activity. Conversely, the (S)-5′-C-aminopropyl modification in the central region of the passenger strand decreased the RNAi activity. Furthermore, the siRNAs containing three or four consecutive (S)-5′-C-aminopropyl-2′-O-methylnucleosides at the 3′- and 5′-regions of the passenger strand exhibited RNAi activity similar to that of the corresponding 2′-O-methyl-modified siRNAs. Finally, it was observed that (S)-5′-C-aminopropyl modifications effectively improved the serum stability of the siRNAs, compared with 2′-O-methyl modifications. Therefore, (S)-5′-C-aminopropyl-2′-O-methylnucleosides would be useful for improving the serum stability of therapeutic siRNA molecules without affecting their RNAi activities.

(S)-5′-C-Aminopropyl-2′-O-methylnucleosides would be useful for improving the serum stability of therapeutic siRNA molecules without affecting their RNAi activities.     

Synthesis and evaluation of (S)-5′-C-aminopropyl and (S)-5′-C-aminopropyl-2′-arabinofluoro modified DNA oligomers for novel RNase H-dependent antisense oligonucleotides

We designed and synthesized two novel thymidine analogs: (S)-5′-C-aminopropyl-thymidine and (S)-5′-C-aminopropyl-2′-β-fluoro-thymidine. Then, DNA oligomers containing these analogs were synthesized, and their functional properties were evaluated. Compared with the naturally occurring thymidine, it was revealed that (S)-5′-C-aminopropyl-2′-arabinofluoro-thymidine was sufficiently thermally stable, while (S)-5′-C-aminopropyl-thymidine featured thermal destabilization. The difference in thermal stability resulted from a moderate change in the secondary structure of the DNA/RNA duplexes and a molecular fluctuation in monomers derived from the (S)-5′-C-aminopropyl side chain, as well as from a variation in sugar puckering derived from the 2′-arabinofluoro modification. Meanwhile, the incorporation of these analogs significantly enhanced the nuclease resistance of the DNA oligomers. Moreover, the (S)-5′-C-aminopropyl-2′-arabinofluoro-modified DNA/RNA duplexes showed a superior ability to activate RNase H-mediated cleavage of the RNA strand compared to the (S)-5′-C-aminopropyl-modified DNA/RNA duplexes.

We designed and synthesized two novel thymidine analogs: (S)-5′-C-aminopropyl-thymidine and (S)-5′-C-aminopropyl-2′-β-fluoro-thymidine.     

Designing triazatruxene-based donor materials with promising photovoltaic parameters for organic solar cells

To address the increasing demand of efficient photovoltaic compounds for modern hi-tech applications, efforts have been made herein to design and explore triazatruxene-based novel donor materials with greater efficiencies. Five new molecules, namely M1–M5, were designed by structural modification of acceptor moiety (rhodanine-3-acetic acid) of well known experimentally synthesized JY05 dye (reference R), and their optoelectronic properties are evaluated to be used as donor molecules in organic solar cells. In these molecules M1–M5, triazatruxene acts as a donor unit and benzene spaced different end-capped moieties including 2-(4-(dicyanomethylene)-2-thioxothiazolidin-3-yl)acetic acid (A1), (E)-2-(4-(1-cyano-2-methoxy-2-oxoethylidene)-2-thioxothiazolidin-3-yl)acetic acid (A2), (Z)-2-(3′-ethyl-4′-oxo-2,2′-dithioxo-3′,4′-dihydro-2′H,5H-[4,5′-bithiazolylidene]-3(2H)-yl)acetic acid (A3), (Z)-2-(4′-(dicyano-methylene)-3′-ethyl-2,2′-dithioxo-3′,4′-dihydro-2′H,5H-[4,5′-bithiazol-ylidene]-3(2H)-yl)acetic acid (A4) and 2-((4Z,4′E)-4′-(1-cyano-2-methoxy-2-oxoethylidene)-3′-ethyl-2,2′-dithioxo-3′,4′-dihydro-2′H,5H-[4,5′-bithiazolylidene]-3(2H)-yl)acetic acid (A5) respectively, as acceptor units. The electronic, photophysical and photovoltaic properties of the designed molecules M1–M5 have been compared with reference molecule R. All designed molecules exhibit reduced energy gap in the region of 1.464–2.008 eV as compared to reference molecule (2.509 eV). Frontier molecular orbital (FMO) surfaces confirm the transfer of charge from donor to acceptor units. All designed molecules M1–M5 exhibited an absorption spectrum in the visible region and they were broader as compared to that of reference R. Especially, M5 with highest λ_max value 649.26 nm and lowest transition energy value 1.90 eV was accredited to the strong electron withdrawing end-capped acceptor moiety A5. The highest value of open circuit voltage (V_oc) 1.02 eV with respect to HOMO_donor–LUMO_BTP-4Cl was shown by M5 among all investigated molecules which was 0.15 V larger than reference molecule R. The designed molecule M5 is proven to be the best candidate for both electron and hole transport mobilities due to its smallest λ_e (0.0212 eV) and λ_h (0.0062 eV) values among all studied molecules.

Five new molecules (M1–M5) were designed by structural modification of acceptor moiety (rhodanine-3-acetic acid) of well-known synthesized dye JY05, and their optoelectronic properties are evaluated to be used as donor molecules in organic solar cells.