Fabrication of oligonucleotide microarray for the detection of Japanese encephalitis virus

A low-density oligonucleotide microarray was used for the detection of Japanese encephalitis virus (JEV) , combining with restriction display PCR labeling method. The hybridization targets were amplified from 6 plasmids containing several JEV gene fragments. Corresponding oligonucleotide probe spots were detected unambiguously. We claim that the oligonucleotide microarray technology is feasible and may have potential for clinical laboratory application.     

An oligonucleotide probe for the detection of hepatitis B virus DNA in serum

A novel and practical assay for the detection of hepatitis B virus (HBV) DNA in serum is described that utilizes as probe a 21-nucleotide sequence 5'-d (CTTCGCTTCACCTCTGCACGT) labelled at the 3'-end with [32P]ddAMP. The oligonucleotide probe sequence occurs in all known HBV genomes and is complementary to a region near the end of the single-stranded gap. It includes the 11-nucleotide direct repeat 5'-d(TTCACCTCTGC). The method was tested on 988 serum HBsAg-positive or -negative specimens and compared to results with HBV DNA probe, with over 98% concordance between the methods. The sensitivity of the two assays was comparable. The assay was developed for testing serum samples fixed to nylon or nitrocellulose membranes. Hybridization time could be shortened to a few hours as compared to 16 h for HBV DNA probes. Immaculate backgrounds were obtained by using a hybridization medium containing polyethylene glycol, heparin and pyrophosphate, and a particular washing procedure.     

Amplification-free detection of grapevine viruses using an oligonucleotide microarray

A single-colour microarray hybridization system was designed and evaluated for the detection of viruses infecting grapevine. Total RNA (≥0.5μg) from infected plants was converted to cDNA and labelled with Cy3 using two different strategies. While amine-modified and labelled cDNA was adequate for the detection of nepoviruses, the 3DNA technique, a post-hybridization detection method that uses intensely fluorescent dendrimer reagents, was required for the detection of closteroviruses in infected plants. Threshold detection levels were based on the ratio between viral specific and 18S rRNA positive control signal intensities. Oligonucleotides between 27 and 75 nucleotides in length were evaluated and compared. Viruses detected include eight nepoviruses, two vitiviruses, and one each of closterovirus, foveavirus, ampelovirus, maculavirus and sadwavirus. Results of this work demonstrate the potential of microarray technique to detect viral pathogens without sequence bias amplification of template RNA.     

Molecular detection and identification of influenza viruses by oligonucleotide microarray hybridization

Microarrays of virus-specific oligonucleotides may provide a method of screening samples for the presence or absence of a large variety of viruses simultaneously. Influenza viruses are ideal for evaluating such microarrays because of their genetic and host diversity, and the availability of an extensive sequence database. A collection of 476 influenza virus-specific oligonucleotides was spotted onto glass slides as probes. Viral RNAs were reverse transcribed and amplified by PCR, and the products were labeled with cyanine dyes. The presence of viruses and their identities were determined by hybridization. The fluorescence intensities of oligonucleotide spots were highly reproducible within each slide and satisfactorily proportional between experiments. However, the intensities of probe spots completely complementary to target sequences varied from background to saturation. The variations did not correlate with base composition, nucleotide sequence, or internal secondary structures. Therefore, thresholds for determining whether hybridization to a spot should be judged as positive were assigned individually. Considering only positive spots from probes predicted to be monospecific for influenza virus species, subtype, host source, or gene segment, this method made correct identifications at the species, hemagglutinin subtype, and gene segment levels. Monospecific neuraminidase (NA) subtype probes were insufficiently diverse to allow confident NA subtype assignment. Incorporating positive spots from polyspecific probes into the identification scheme gave similar results. Overall, the results demonstrate the potential of microarray-based oligonucleotide hybridization for multiple virus detection.     

Evaluation of the TB-Biochip oligonucleotide microarray system for rapid detection of rifampin resistance in Mycobacterium tuberculosis

The TB-Biochip oligonucleotide microarray system is a rapid system to detect mutations associated with rifampin (RIF) resistance in mycobacteria. After optimizing the system with 29 laboratory-generated rifampin-resistant mutants of Mycobacterium tuberculosis, we evaluated the performance of this test using 75 clinical isolates of Mycobacterium tuberculosis. With this small sample set, the TB-Biochip system displayed a sensitivity of 80% and a specificity of 100% relative to conventional drug susceptibility testing results for RIF resistance. For these samples (approximately 50% tested positive), the positive predictive value was 100% and the negative predictive value was 85%. Four of the seven observed discrepancies were attributed to rare and new mutations not represented in the microarray, while three of the strains with discrepant results did not carry mutations in the RIF resistance-determining region. The results of this study confirm the utility of the system for rapid detection of RIF resistance and suggest approaches to increasing its sensitivity.     

Comparison of methods for detection of vaccinia virus in patient specimens

We analyzed a shell vial culture assay (SVA), real-time PCR, and a direct fluorescent antibody assay (DFA) for rapid detection of vaccinia virus from vaccination sites of Dryvax vaccine recipients. Of 47 samples assayed, 100% were positive by PCR, 89% were positive by SVA, and 40% were positive by DFA. DFA was limited by the need for adequate numbers of cells, with 32% of samples inadequate for interpretation. DFA performed better with specimens from patients who had not previously received the vaccine. PCR was positive for longer times postvaccination than was SVA. Infectious virus could be recovered after 45 min of acetone fixation of shell vial coverslips. Commercially available polyclonal antibodies cross-reacted with other orthopoxviruses and herpes simplex 1, but commercially available monoclonal antibodies were specific for vaccinia virus. In summary, PCR was the most sensitive test for detecting vaccinia virus in clinical specimens, while the DFA was the most rapid but the least sensitive test.     

An oligonucleotide-based microarray for detection of plant RNA viruses

Currently, some of the methods used most widely for diagnosis and detection of plant viruses are ELISA, PCR, bioassays and electron microscopy. These methods only target one or a few species in each assay or they are time consuming and require expertise. Microarray-based approaches offer an alternative to these methods as microarrays with virus-specific probes could be capable of detecting an almost unlimited number of virus species in one assay. In the present study, the feasibility of this strategy was studied by constructing a microarray with 150 probes potentially capable of detecting 52 viruses from a broad range of genera. The array was printed in 16 subarrays to allow testing of several samples on each slide. Hybridizations with cDNA from plants infected with 52 different virus species showed that out of the 52 species tested, 49 were positive and identified correctly to species level. This array represents the largest published microarray for plant virus detection in terms of the number of targeted species and is thus an important milestone towards the construction of a generic microarray able to detect most, if not all, plant RNA viruses.     

Genotyping of measles virus in clinical specimens on the basis of oligonucleotide microarray hybridization patterns

An oligonucleotide microarray hybridization method for identification of most known measles virus (MV) genotypes was developed. Like the conventional genotyping method, the microarray relied on detecting sequence differences in the 450-nucleotide region coding for the COOH-terminal 150 amino acids of the nucleoprotein (N). This region was amplified using PCR primers binding to all known MV genotypes. The microarray included 71 pairs of oligonucleotide probes (oligoprobes) immobilized on glass slides. Each pair consisted of a genotype-specific oligoprobe, which matched the sequence of only one target genotype, and a control oligoprobe, which contained mismatches at the nucleotide positions unique to this genotype. A pattern recognition algorithm based on cluster analysis of the ratios of hybridization signals from specific and control oligoprobes was used to identify the specific MV genotype. Following the initial validation, the method was used for rapid genotyping of two panels of coded samples. The results of this study showed good sensitivity (90.7%), specificity (100%), and genotype agreement (91.8%) for the new method compared to the results of genotyping conducted using phylogenetic analysis of viral sequences of the C terminus of the N gene. In addition, the microarray demonstrated the ability to identify potential new genotypes of MV based on the similarity of their hybridization patterns with those of known MV genotypes.     

Multiplex PCR and oligonucleotide microarray for detection of single-nucleotide polymorphisms associated with Plasmodium falciparum drug resistance

Drug resistance in Plasmodium falciparum is a serious public health threat in the countries where this organism is endemic. Since resistance has been associated with specific single-nucleotide polymorphisms (SNPs) in parasite genes, molecular markers are becoming useful surrogates for monitoring the emergence and dispersion of drug resistance. In this study, a multiplex PCR (mPCR) and oligonucleotide microarray method was developed for the detection of these SNPs in genes encoding chloroquine resistance transporter (Pfcrt), multidrug resistance 1 (Pfmdr1), dihydrofolate reductase (Pfdhfr), dihydropteroate synthetase (Pfdhps), and ATPase 6 (PfATPase6) of P. falciparum. The results show that DNA microarray technology, combined with mPCR, is a promising and time-saving tool that supports conventional detection methods, allowing sensitive, accurate, simultaneous analysis of the SNPs associated with drug resistance in P. falciparum.     

Mapping of genomic segments of influenza B virus strains by an oligonucleotide microarray method

Similar to other segmented RNA viruses, influenza viruses can exchange genome segments and form a wide variety of reassortant strains upon coreplication within a host cell. Therefore, the mapping of genome segments of influenza viruses is essential for understanding their phenotypes. In this work, we have developed an oligonucleotide microarray hybridization method for simultaneous genotyping of all genomic segments of two highly homologous strains of influenza B virus. A few strain-specific oligonucleotide probes matching each of the eight segments of the viral genomes of the B/Beijing/184/93 and B/Shangdong/7/97 strains were hybridized with PCR-amplified fluorescently labeled single-stranded DNA. Even though there were a few mismatches among the genomes of the studied virus strains, microarray hybridization showed highly significant and reproducible discrimination ability and allowed us to determine the origins of individual genomic segments in a series of reassortant strains prepared as vaccine candidates. Additionally, we were able to detect the presence of at least 5% of mixed genotypes in virus stocks even when conventional sequencing methods failed, for example, for the NS segment. Thus, the proposed microarray method can be used for (i) rapid and reliable genome mapping of highly homologous influenza B viruses and (ii) extensive monitoring of influenza B virus reassortants and the mixed genotypes. The array can be expanded by adding new oligoprobes and using more quantitative assays to determine the origin of individual genomic segments in series of reassortant strains prepared as vaccine candidates or in mixed virus populations.     

Direct detection of Kitasatospora species with a chaperone oligonucleotide microarray method lacking PCR amplification

Identification of members of the genus Kitasatospora from soil samples has been introduced to evaluate occurrence of potential natural compound producers in different habitats. The microarray hybridization usually involves PCR amplification of the target DNA. Since PCR might lead to biased amplification, a diagnostic Kitasatospora microarray technique was improved by a protocol lacking PCR amplification prior to hybridization. The described advanced hybridization method used chaperone oligonucleotides for direct co-hybridization with genomic DNA on an oligonuclotide microarray with optical readout. ((c) 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim).     

Simultaneous detection of four human pathogenic microsporidian species from clinical samples by oligonucleotide microarray

Microsporidian species have been rapidly emerging as human enteric pathogens in immunocompromised and immunocompetent individuals in recent years. Routine diagnostic techniques for microsporidia in clinical laboratories are laborious and insensitive and tend to underestimate their presence. In most instances, they are unable to differentiate species of spores due to their small sizes and similar morphologies. In this study, we report the development of another protozoan oligonucleotide microarray assay for the simultaneous detection and identification to the species level of four major microsporidian species: Enterocytozoon bieneusi, Encephalitozoon cuniculi, Encephalitozoon hellem, and Encephalitozoon intestinalis. The 18S small-subunit rRNA gene was chosen as the amplification target, labeled with fluorescence dye, and hybridized to a series of species-specific oligonucleotide probes immobilized on a microchip. The specificity and sensitivity of the microarray were clearly demonstrated by the unique hybridization profiles exhibited by each species of microsporidian tested and its ability to detect as few as 10 spores. In order to assess the applicability of this microarray in a clinical setting, we conducted microarray assays of 20 fecal samples from AIDS patients. Twelve of these samples were positive for the presence of microsporidia and could be confidently identified; 11 of them were positive for more than one species. Our results suggested that this microarray-based approach represents an attractive diagnostic tool for high-throughput detection and identification of microsporidian species in clinical and epidemiological investigations.     

A DNA oligonucleotide microarray for detecting human astrovirus serotypes

Human astroviruses have been shown in numerous studies to be an important cause of gastroenteritis in young children worldwide. The present communication addresses their characterization by use of oligonucleotide microarray hybridization. The system developed consists of an RT-PCR using primers of low degeneracy capable of detecting all eight serotypes of human astroviruses. RT-PCR products are then hybridized against a microarray consisting of short oligonucleotide probes 17-18 nucleotides in length. Cy3-labeled ssDNA targets are generated using a Cy3-labeled primer in the RT-PCR. The non-labeled strand is enzymatically digested, and the labeled target is rescued by column purification. This method of generating labeled target uses equimolar concentrations of the amplifying primers and does not compromise assay sensitivity for initial detection of the virus. Hybridization can be performed without the need for additional amplification. Although the amplicon spans a relatively conserved region of the astrovirus genome, the use of short probes enables type distinction despite such limited diversity. Probes differing by as little as a single nucleotide can be used to distinguish isolates. The microarray developed was capable of distinguishing representatives of the eight known serotypes of human astroviruses.     

Diagnostic oligonucleotide microarray fingerprinting of Bacillus isolates

A genome-independent microarray and new statistical techniques were used to genotype Bacillus strains and quantitatively compare DNA fingerprints with the known taxonomy of the genus. A synthetic DNA standard was used to understand process level variability and lead to recommended standard operating procedures for microbial forensics and clinical diagnostics.     

Enhanced detection of clinically relevant genomic imbalances using a targeted plus whole genome oligonucleotide microarray

PurposeArray comparative genomic hybridization is rapidly becoming an integral part of cytogenetic diagnostics. We report the design, validation, and clinical utility of an oligonucleotide array which combines genome-wide coverage with targeted enhancement at known clinically relevant regions.MethodsProbes were placed every 75 kb across the entire euchromatic genome to establish a chromosomal “backbone” with a resolution of ∼500 kb, which is increased to ∼50 kb in targeted regions.ResultsFor validation, 30 samples showed 100% concordance with previous G-banding and/or fluorescence in situ hybridization results. Prospective array analysis of 211 clinical samples identified 33 (15.6%) cases with clinically significant abnormalities. Of these, 23 (10.9%) were detected by the “targeted” coverage and 10 (4.7%) by the genome-wide coverage (average size of 3.7 Mb). All abnormalities were verified by fluorescence in situ hybridization, using commercially available or homebrew probes using the 32K bacterial artificial chromosome set. Four (1.9%) cases had previously reported imbalances of uncertain clinical significance. Five (2.4%) cases required parental studies for interpretation and all were benign familial variants.ConclusionsOur results highlight the enhanced diagnostic utility of a genome-wide plus targeted array design, as the use of only a targeted array would have failed to detect 4.7% of the clinically relevant imbalances.     

Model for vaccinia virus DNA replication

Replicating vaccinia DNA molecules synthesized in vivo and in vitro, when examined in the electron microscope, were found to contain dsDNA loops which formed at one end of the molecules. A progressive increase in the size of the loop in individual molecules indicated that chain elongation was occurring. These results suggest that DNA replication was initiated at, and elongation proceeded from, one end of the viral DNA molecules. Based on these observations and previously published biochemical experiments, a model for vaccinia virus DNA replication is proposed.