Genetic polymorphisms of UGT1A6 in a Japanese population

Thirteen single nucleotide polymorphisms (SNPs), including 6 novel ones, were found in exon 1 and its flanking region of UDP-glucuronosyltransferase (UGT) 1A6 from 195 Japanese subjects. Several novel SNPs were identified, including 269G>A (R90H), 279A>G (S93S), and 308C>A (S103X) in exon 1, and IVS1+109C>T, IVS1+120A>G, and IVS1+142C>T in the intron downstream of exon 1. Among these SNPs, 308C>A confers termination of translation at codon 103, resulting in the production of an immature protein that probably lacks enzymatic activity. The allele frequencies were 0.003 for all the 6 SNPs. In addition, the 3 known nonsynonymous SNPs were detected: 19T>G (S7A), 541A>G (T181A), and 552A>C (R184S) with frequencies of 0.226, 0.218, and 0.226, respectively. High linkage disequilibrium was observed among 19T>G (S7A), 315A>G (L105L), 541A>G (T181A), 552A>C (R184S), and IVS1+130G>T, as reported in Caucasian and African-American populations. Then, 11 haplotypes in UGT1A6 were estimated. The novel nonsynonymous variant, 269A or 308A, was shown to be located on the same DNA strand together with 19G, 315G, 541G, 552C, and IVS1+130T. Our results provide fundamental and useful information for genotyping UGT1A6 in the Japanese, and probably Asian populations.     

Twenty novel genetic variations and haplotype structures of the DCK gene encoding human deoxycytidine kinase (dCK)

Deoxycytidine kinase (dCK) is a rate-limiting enzyme in the activation of nucleoside anticancer drugs, such as gemcitabine and cytarabine (Ara-C), to their active metabolites. In this study, the 5'-flanking region, 7 exons and their flanking introns of DCK were comprehensively screened for genetic variations in 256 Japanese cancer patients administered gemcitabine. Twenty-nine genetic variations, including twenty novel ones, were found: 11 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 1 in the coding exon, 9 in the 3'-UTR, and 7 in the introns. The novel variations included -1110C>T, -757G>A, -639C>T, -465G>A, -402T>C, -224C>A, -199C>G, IVS1+38G>T, IVS2+78_+83delTTTTTC, IVS3-9C>T, IVS4+12T>C, IVS5+39T>C, 1357A>G, 1545A>T, 1572delA, 1736G>A, 1749G>A, 1838T>C, 1889G>A, and 2048A>T. The frequencies were 0.01 for IVS2+78_ +83delTTTTTC, 0.008 for -402T>C, 0.006 for -639C>T and IVS4+12T>C, 0.004 for -757G>A and 1572delA, and 0.002 for the other 14 variations. A known nonsynonymous SNP 364C>T (Pro122Ser) was detected at a 0.061 frequency. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 24 haplotypes were identified or inferred. Our findings suggest considerable ethnic differences in genetic variations of DCK and provide fundamental and useful information for genotyping DCK in the Japanese and probably other Asian populations.     

Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1)

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.     

Genetic variations and haplotypes of UGT1A4 in a Japanese population

Nineteen genetic variations, including 11 novel ones, were found in exon 1 and its flanking region of the UDP-glucuronosyltransferase (UGT) 1A4 gene from 256 Japanese subjects, consisting of 60 healthy volunteers, 88 cancer patients and 108 arrhythmic patients. These variations include -217T>G and -36G>A in the 5'-flanking region, 30G>A (P10P), 127delA (43fsX22; frame-shift from codon 43 resulting in the termination at the 22nd codon, codon 65), 175delG (59fsX6), 271C>T (R91C), 325A>G (R109G), and 357T>C (N119N) in exon 1, and IVS1+1G>T, IVS1+98A>G and IVS1+101G>T in the following intron. Among them, 127delA and 175delG can confer early termination of translation, resulting in an immature protein that probably lacks enzymatic activity. Variation IVS1+1G>T is located at a splice donor site and thus may lead to aberrant splicing. Since we did not find any significant differences in the frequencies of all the variations among the three subject groups, the data were analyzed as one group. The allele frequencies of the novel variations were 0.006 for IVS1+101G>T, 0.004 for 30G>A (P10P) and 357T>C (N119N), and 0.002 for the 8 other variations. In addition, the two known nonsynonymous single nucleotide polymorphisms (SNPs), 31C>T (R11W) and 142T>G (L48V), were found at 0.012 and 0.129 frequencies, respectively. The SNP 70C>A (P24T), mostly linked with 142T>G (L48V) in German Caucasians, was not detected in this study. Sixteen haplotypes were identified or inferred, and some haplotypes were confirmed by cloning and sequencing. It was shown that most of 142T>G (L48V) was linked with -219C>T, -163G>A, 448T>C (L150L), 804G>A (P268P), and IVS1+43C>T, comprising haplotype *3a; haplotype *4a harbors 31C>T (R11W); 127delA (43fsX22) and 142T>G (L48V) were linked (haplotype *5a); 175delG (59fsX6) was linked with 325A>G (R109G) (*6a haplotype); and -219C>T, -163G>A, 142T>G (L48V), 271C>T (R91C), 448T>C (L150L), 804G>A (P268P), and IVS1+43C>T comprised haplotype *7a. Our results provide fundamental and useful information for genotyping UGT1A4 in the Japanese and probably Asian populations.     

Novel genetic variations and haplotypes of hepatocyte nuclear factor 4alpha (HNF4A) found in Japanese type II diabetic patients

Thirty-nine single nucleotide variations, including 16 novel ones, were found in the 5' promoter region, all of the exons and their surrounding introns of HNF4A in 74 Japanese type II diabetic patients. The following novel variations were identified (based on the amino acid numbering of splicing variant 2): -208G>C in the 5' promoter region; 1154C>T (A385V) and 1193T>C (M398T) in the coding exons; 1580G>A, 1852G>T, 2180C>T, 2190G>A, and 2362_2380delAAGAATGGTGTGGGAGAGG in the 3'-untranslated region, and IVS1+231G>A, IVS2-83C>T, IVS3+50C>T, IVS3-54delC, IVS5+173_176delTTAG, IVS5-181_-180delAT, IVS8-106A>G, and IVS9-151A>C in the introns. The allele frequencies were 0.311 for 2362_2380delAAGAATGGTGTGGGAGAGG, 0.054 for 1580G>A, 0.047 for 1852G>T, 0.020 for IVS1+231G>A, 0.014 for IVS9-151A>C, and 0.007 for the other 11 variations. In addition, one known nonsynonymous single nucleotide polymorphism, 416C>T (T139I), was detected at a 0.007 frequency. Based on the linkage disequilibrium profiles, the region analyzed was divided into three blocks. Haplotype analysis determined/inferred 10, 16, and 12 haplotypes for block 1, 2, and 3, respectively. Our results on HNF4A variations and haplotypes would be useful for pharmacogenetic studies in Japanese.     

Obesity reveals an association between blood pressure and the G-protein beta3-subunit gene: a study of female dizygotic twins

The 825C>T polymorphism of the G-protein beta3-subunit gene (GNB3) has been associated with hypertension, although results are not entirely consistent. In a sample of 282 female Caucasian dizygotic twins aged 21-80 years, we aimed to investigate the associations between blood pressure and five single nucleotide polymorphisms (SNPs) including the 825C>T and haplotypes of the GNB3 gene. The polymorphisms (-350A>G, 657A>T, 814G>A, 825C>T and 1429C>T) were genotyped by polymerase chain reaction-restriction enzyme assays. Regular association tests did not show a significant effect on blood pressure for any of the five SNPs. However, strongly significant interactions between the -350A>G, 825C>T and 1429C>T loci and adiposity (both body mass index and waist circumference) were observed for systolic blood pressure (Ps < 0.01) as well as diastolic blood pressure (Ps < 0.05), suggesting increases in adiposity amplify the effects of the SNPs on blood pressure. Haplotype analyses confirmed the effects of the GNB3 gene-obesity interaction on hypertension risk. Additionally, sib-transmission disequilibrium tests (sib-TDTs) showed significant associations with blood pressure for the 825C>T and 1429C>T loci. In summary, the presence of obesity reveals an association between blood pressure and the GNB3 gene in White females. Our data suggest that adiposity is a final pathway through which gene-lifestyle interactions may exert their effects on the development of hypertension. Our results from the combined SNP, haplotype and sib-TDT analyses also support the hypothesis that the 825C>T is a susceptibility locus for hypertension, whereas effects of other loci on blood pressure may result from their strong linkage disequilibrium with the 825C>T locus.     

Twelve novel single nucleotide polymorphisms in ABCB1/MDR1 among Japanese patients with ventricular tachycardia who were administered amiodarone

Twelve novel single nucleotide polymorphisms (SNPs) were found in the gene encoding the ATP-binding cassette transporter, P-glycoprotein, from 60 Japanese individuals who were administered the anti-antiarrythmic drug, amiodarone. The detected SNPs were as follows: 1) SNP, MPJ6_AB1017 (IVS6-109); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 2) SNP, MPJ6_AB1018 (IVS7+14); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 3) SNP, MPJ6_AB1021 (IVS9-44); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 4) SNP, MPJ6_AB1052 (IVS12+17); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 5) SNP, MPJ6_AB1029 (IVS15-69); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 6) SNP, MPJ6_AB1040 (IVS24+16); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 7) SNP, MPJ6_AB1053 (IVS27-189); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 8) SNP, MPJ6_AB1054 (IVS27-172); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 9) SNP, MPJ6_AB1048 (IVS27-167); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 10) SNP, MPJ6_AB1055 (IVS27-152); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 11) SNP, MPJ6_AB1049 (IVS27-119); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 12) SNP, MPJ6_AB1051 (at nucleotide 3751 (exon 28) from the A of the translation initiation codon); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168. Among these SNPs, only MPJ6_AB1051 resulted in an amino acid alteration, V1251I.     

Genetic variations and haplotypes of CYP2C19 in a Japanese population

Forty-eight single nucleotide variations, including 27 novel ones, were found in the 5'- regulatory region, all of the exons and their surrounding introns of CYP2C19 in 253 Japanese subjects (134 diabetic patients and 119 healthy volunteers). Identified novel variations were as follows: -2772G>A, 2767_-2760delGGTGAACA, -2720T>C, -2547delG, -2545G>T, -2545_-2544 delGC, and -2040C>T in the enhancer region; -778C>T, -777G>A, -529G>C, -189C>A, and -185A>G in the promoter region; 151A>G (S51G), 481G>C (A161P), 986G>A (R329H), 1078G>A (D360N), and 1119C>T (D373D) in the exons, and IVS1+128T>A, IVS3+163G>A, IVS4+271A>G, IVS5-49A>G, IVS6-210C>T, IVS6-196T>A, IVS6-32T>A, IVS7+84G>A, IVS7-174C>T, and IVS8+64C>T in the introns. Since we found no significant differences in the variation frequencies between healthy volunteers and diabetic patients, the data for all subjects were treated as one group in further analysis. The allele frequencies were 0.265 for IVS6-196T>A, 0.045 for -2772G>A and -2720T>C, 0.024 for -2040C>T, 0.014 for IVS7-174C>T, 0.010 for -529G>C, 0.006 for IVS1+128T>A and 481G>C (A161P), 0.004 for -2767_-2760delGGTGAACA and IVS6-210C>T, and 0.002 for the other 17 variations. In addition, the two known nonsynonymous single nucleotide polymorphisms, 681G>A (splicing defect, (*)2 allele) and 636G>A (W212X; (*)3 allele) were detected at 0.267 and 0.128 frequencies, respectively. No variation was detected in the known binding sites for constitutive androstane receptor and glucocorticoid receptor. Linkage disequilibrium analysis showed several close linkages of variations throughout the gene. By using the variations, thirty-one haplotypes of CYP2C19 and their frequencies were estimated. Our results would provide fundamental and useful information for genotyping CYP2C19 in the Japanese and probably other Asian populations.     

Fourteen novel genetic variations and haplotype structures of the TYMS gene encoding human thymidylate synthase (TS)

Forty genetic variations including 14 novel ones were found in the human TYMS gene, which encodes thymidylate synthase, in 263 Japanese cancer patients who received 5-fluorouracil (FU)-based chemotherapy. Three novel variations were located within the 28-bp tandem repeat sequence in the 5'-untranslated region (UTR) and were designated 5Rc, 3Rc-ins and 4Rc. Allele frequencies were 0.021 for 5Rc, 0.006 for 3Rc-ins and 0.002 for 4Rc. Other novel variations included -133G>C and -125G>C in the 5'-UTR; IVS1-278G>A, IVS2-68C>T, IVS2-23T>C, IVS4+122_+123insATTG, IVS4-141G>A, IVS5-100A>T and IVS6-111G>A in the introns; and 1244(*302)A>G and 1264(*322)G>A in the 3'-UTR. The allele frequencies were 0.34 for IVS4+122_+123insATTG, 0.042 for -133G>C, 0.011 for IVS4-141G>A, 0.006 for -125G>C, 0.004 for IVS1-278G>A, IVS2-68C>T, 1244(*302)A>G and 1264(*322)G>A, and 0.002 for IVS2-23T>C, IVS5-100A>T and IVS6-111G>A. Using the detected polymorphisms, linkage disequilibrium (LD) analysis was performed, which divided the TYMS gene into three LD blocks. The 28-bp tandem repeat sequence in the 5'-UTR was assigned as Block 2 with a total of 7 alleles. In Blocks 1 and 3, 7 and 19 haplotypes were determined/inferred, respectively. Our findings provide fundamental and useful information for genotyping TYMS in the Japanese and probably other Asian populations.     

Distinct haplotype profiles and strong linkage disequilibrium at the MDR1 multidrug transporter gene locus in three ethnic Asian populations

The MDR1 multidrug transporter plays a key role in determining drug bioavailability, and differences in drug response exist amongst different ethnic groups. Numerous studies have identified an association between the MDR1 single nucleotide polymorphism (SNP) exon 26 3435C>T and differences in MDR1 function. We performed a haplotype analysis of the MDR1 gene in three major ethnic groups (Chinese, Malays and Indians) by examining 10 intragenic SNPs. Four were polymorphic in all three ethnic groups: one occurring in the non-coding region and three occurring in coding exons. All three coding SNPs (exon 12 1236C>T, exon 21 2677G>T/A and exon 26 3435C>T) were present in high frequency in each ethnic group, and the derived haplotype profiles exhibited distinct differences between the groups. Fewer haplotypes were observed in the Malays (n = 6) compared to the Chinese (n = 10) and Indians (n = 9). Three major haplotypes (> 10% frequency) were observed in the Malays and Chinese; of these, two were observed in the Indians. Strong linkage disequilibrium (LD) was detected between the three SNPs in all three ethnic groups. The strongest LD was present in the Chinese, followed by Indians and Malays, with the corresponding LD blocks estimated to be approximately 80 kb, 60 kb and 40 kb, respectively. These data strongly support the hypothesis that strong LD between the neutral SNP exon 26 3435C>T and a nearby unobserved causal SNP underlies the observed associations between the neutral SNP and MDR1 functional differences. Furthermore, strong LD between exon 26 3435T and different unobserved causal SNPs in different study populations may provide a plausible explanation for conflicting reports associating the same exon 26 3435T allele with different MDR1 functional changes.     

Three novel single nucleotide polymorphisms of the human thiopurine S-methyltransferase gene in Japanese individuals

In this study, the entire coding sequence and the exon-intron junctions of the thiopurine S-methyltransferase (TPMT) gene from 200 Japanese individuals were screened for mutation. Three novel single nucleotide polymorphisms (SNPs) were identified-106G>A in exon 3 (Gly36Ser, *20 allele), 967A>G in 3'-untranslated region, and -87C>T in intron 8. The allele frequencies were 0.003 for 106G>A, 0.003 for 967A>G, and 0.010 for IVS8 -87C>T. In addition, the three known SNPs, 474T>C (Ile158Ile), 719A>G (Tyr240Cys, *3C allele), and IVS4 +35C>T were detected at frequencies of 0.299, 0.010, and 0.421, respectively.     

Analyses of single nucleotide polymorphisms and haplotype linkage of the humanABCB1 (MDR1) gene in Korean

Single nucleotide polymorphisms (SNPs) in theMDR1 gene that are responsible for drug efflux can cause toxicity. Therefore, this study determined the SNPs of the KoreanMDR1 gene, and analyzed the haplotypes and a linkage disequilibrium (LD) of the SNPs determined. The frequency of 9 SNPs from theMDR1 gene was determined by PCR-RFLP analyses of 100 to 500 healthy individuals. The frequcies of the SNPs were C3435T (47.7%), G2677T (37.6%), G2677A (4.4%), T1236C (21.7%), T129C (8%), A2956G (2.5%), T307C (1.5%), A41aG (9.2%), C145G (0%), and G4030C (0%). Analyses of the haplotype structure and an estimation of the LD of the combined polymorphisms demonstrated that the frequency of the 1236T-2677G-3435T haplotype is much higher in Koreans (14.1%) than in Chinese and western black Africans and the C3435T SNP in Koreans appears to have LD with T129C in Koreans for the first time. These results provide insight into the genetic variation ofMDR1 in Koreans, and demonstrated the possibility of a new LD in this gene.     

Influence of genomic ancestry on the distribution of SLCO1B1, SLCO1B3 and ABCB1 gene polymorphisms among Brazilians

The frequency distribution of SNPs and haplotypes in the ABCB1, SLCO1B1 and SLCO1B3 genes varies largely among continental populations. This variation can lead to biases in pharmacogenetic studies conducted in admixed populations such as those from Brazil and other Latin American countries. The aim of this study was to evaluate the influence of self-reported colour, geographical origin and genomic ancestry on distributions of the ABCB1, SLCO1B1 and SLCO1B3 polymorphisms and derived haplotypes in admixed Brazilian populations. A total of 1039 healthy adults from the north, north-east, south-east and south of Brazil were recruited for this investigation. The c.388A>G (rs2306283), c.463C>A (rs11045819) and c.521T>C (rs4149056) SNPs in the SLCO1B1 gene and c.334T>G (rs4149117) and c.699G>A (rs7311358) SNPs in the SLCO1B3 gene were determined by Taqman 5'-nuclease assays. The ABCB1 c.1236C>T (rs1128503), c.2677G>T/A (rs2032582) and c.3435C>T (rs1045642) polymorphisms were genotyped using a previously described single-base extension/termination method. The results showed that genotype and haplotype distributions are highly variable among populations of the same self-reported colour and geographical region. However, genomic ancestry showed that these associations are better explained by a continuous variable. The influence of ancestry on the distribution of alleles and haplotype frequencies was more evident in variants with large differences in allele frequencies between European and African populations. Design and interpretation of pharmacogenetic studies using these transporter genes should include genomic controls to avoid spurious conclusions based on improper matching of study cohorts from Brazilian populations and other highly admixed populations.     

Seven novel single nucleotide polymorphisms in the human SLC22A1 gene encoding organic cation transporter 1 (OCT1)

Twenty genetic variations, including seven novel ones, were found in the human SLC22A1 gene, which encodes organic cation transporter 1, from 116 Japanese individuals. The novel variations were as follows: -94C>A in the 5'-untranslated region (A of the translation start codon is numbered +1 in the cDNA sequence; MPJ6_OC1001), 350C>T (MPJ6_OC1004), IVS1-35T>C (MPJ6_OC1006), 561G>A (MPJ6_OC1010), IVS6+75C>G (MPJ6_OC1014), IVS8+108A>G (MPJ6_OC1017), and 1671_1673delATG (MPJ6_OC1020). The frequencies were 0.082 for IVS1-35T>C, 0.022 for IVS6+75C>G, 0.009 for 561G>A, and 0.004 for the other 4 variations. Among them, 350C>T resulted in the amino acid substitution Pro117Leu, which is located in the large extracellular loop between transmembrane domains 1 and 2. Also, we detected the four previously reported nonsynonymous variations, 123C>G (Phe41Leu), 480C>G (Phe160Leu), 1022C>T (Pro341Leu), and 1222A>G (Met408Val) with frequencies of 0.004, 0.086, 0.168, and 0.810, respectively.     

Comparison of two screening methods for in-house genotyping in clinical pharmacology units

Two genetic screening methods, the fluorescence resonance energy transfer (FRET) technique on the LightCycler and the real-time pyrophosphate detection technique on the Pyrosequencer have been compared with regard to their usefulness as screening methods for subject recruitment in clinical studies in pharmacology units. Two SNPs of possible clinical relevance were selected, namely the 118A>G SNP of the OPRM1 gene and the 3435C>T SNP of the ABCB1 gene. Genotypes diagnosed using conventional sequencing served as control. The allelic frequency of the mutated 118G allele of the OPRM1 gene was 12.7% and that of the mutated 3435T allele of the ABCB1 gene was 50.7%. All results obtained with the Pyrosequencer were in accord with those obtained using conventional sequencing. With the LightCycler, an incorrect genotype was assigned to 1 of the 130 DNA samples corresponding to an error rate of 0.8%. Although both methods were found suitable for rapid SNP detection, Pyrosequencing was the preferred method since it provides the nucleotide sequence directly thus facilitating interpretation.