Specificity of IS6110-based amplification assays for Mycobacterium tuberculosis complex.

The specificity of IS6110 for the Mycobacterium tuberculosis complex has recently been questioned. We observed no cross-reaction with 27 nontuberculous mycobacteria using strand displacement- and PCR-based amplification of the nucleotide 970 to 1026 and 762 to 865 regions of IS6110. These data support use of selected regions of IS6110 as M. tuberculosis complex-specific targets.     

Specificity of IS6110-based DNA fingerprinting and diagnostic techniques for Mycobacterium tuberculosis complex

Restriction fragment length polymorphism and hybridization of DNA extracted from Mycobacterium tuberculosis, nontuberculous mycobacteria, and nonmycobacterial species with a probe derived from IS6110 confirmed that IS6110 was specific to M. tuberculosis complex. In addition, DNA amplification with IS6110-specific primers yielded a 181-bp fragment only in DNA from M. tuberculosis complex isolates.     

Use of a PCR method based on IS6110 polymorphism for typing Mycobacterium tuberculosis strains from BACTEC cultures.

Two PCR typing methods, based on polymorphism of the insertion sequence IS6110, were compared with Mycobacterium tuberculosis strains by using a single primer complementary to the inverted repeats of IS6110. Total M. tuberculosis DNA either was amplified directly (IS6110-PCR) or was amplified following digestion and ligation (IS6110-inverse-PCR). Both PCR techniques showed a similar degree of discrimination. Because of its simplicity, IS6110-PCR was chosen to confirm that a single M. tuberculosis strain was responsible for an outbreak of tuberculosis in a secondary school. IS6110-PCR was used to study the degree of differentiation in 85 clinical M. tuberculosis isolates from BACTEC 12B broth cultures. Results were consistent with those of the standardized IS6110 restriction fragment length polymorphism (RFLP) analysis method, showing identical PCR types for identical RFLPs, although the degree of discrimination was greater by RFLP analysis. The study concludes that due to its simplicity, IS6110-PCR is a good screening method when quick differentiation between M. tuberculosis strains is needed because BACTEC cultures may be used directly.     

Heminested inverse PCR for IS6110 fingerprinting of Mycobacterium tuberculosis strains.

A heminested inverse PCR (HIP) for the amplification of sequences flanking the Mycobacterium tuberculosis insertion sequence IS6110 has been developed. The method depends upon primers that anneal to IS6110 at sites between its 5' end and the closest BsrFI site. The accuracy of HIP was demonstrated by the amplification of sequences within plasmid constructs carrying one or two copies of the insertion sequence IS986 in different orientations. The identities of the amplicons produced from strains carrying a single copy of IS6110 were verified by nucleotide sequencing. Analyses of 204 M. tuberculosis strains including those involved in outbreaks showed that IS6110 HIP is highly discriminatory and reproducible. HIP fingerprinting of these 204 strains generated 136 distinct types, and its discriminatory power was equivalent to that of standard restriction fragment length polymorphism analysis. The method is therefore of value for the rapid fingerprinting of M. tuberculosis strains for epidemiological purposes.     

Amplified-fragment length polymorphism as a complement to IS6110-based restriction fragment length polymorphism analysis for molecular typing of Mycobacterium tuberculosis

The amplified-fragment length polymorphism (AFLP) technique was applied to clusters of Mycobacterium tuberculosis clinical isolates obtained by using IS6110-based restriction fragment length polymorphism (RFLP). Ten of the RFLP clusters showed identical AFLP patterns also, but the other 13 could be resolved into subclusters by AFLP. Our results suggest that some RFLP clusters may not be due to recent transmission and that AFLP may be a useful complementary technique.     

Performance of an IS6110-based PCR assay and the COBAS AMPLICOR MTB PCR system for detection of Mycobacterium tuberculosis complex DNA in human lymph node samples

We compared the performance of two PCR assays, an IS6110-based in-house protocol and the COBAS AMPLICOR MTB PCR (COBAS MTB) system, for the detection of Mycobacterium tuberculosis complex in 43 human lymph node samples from 40 patients. For the in-house PCR and the COBAS MTB assays, respectively, sensitivities were 87.5% versus 45.5% (P < 0.05), specificities were 100.0% versus 91.3% (P > 0.05), and inhibition rates were 4.8% versus 19.5% (P < 0.05). For the COBAS MTB system, additional N-acetyl-L-cysteine-NaOH pretreatment of the samples changed neither the inhibition rate nor the sensitivity significantly.     

Rapid detection of the Mycobacterium tuberculosis Beijing genotype and its ancient and modern sublineages by IS6110-based inverse PCR

The Mycobacterium tuberculosis Beijing genotype strains appear to be hypervirulent and associated with multidrug-resistant tuberculosis. Therefore, the development of a both rapid and simple method to detect the M. tuberculosis Beijing genotype is of clinical interest per se. Previously, we described a simple and fast approach to detect the Beijing genotype based on IS6110 inverse-PCR typing. Here, we evaluated this method against a large, diverse, and recent collection of strains. The study sample included 866 M. tuberculosis strains representing but not limited to the regions in Russia, Europe, and East Asia where the Beijing genotype is endemic. Based on a spoligotyping method, 408 strains were identified as Beijing genotypes; they were additionally subdivided into ancient and modern sublineages based on the analysis of the NTF locus. All strains were further subjected to the IS6110-based inverse PCR. All of the Beijing genotype strains were found to have identical two-band (ancient sublineage) or three-band (modern sublineage) profiles that were easily recognizable and distinct from the profiles of the non-Beijing strains. Therefore, we suggest using IS6110-based inverse-PCR typing for the correct identification of the Beijing genotype and its major sublineages. The method is fast and inexpensive and does not require additional experiments but instead is implemented in the routine typing method of M. tuberculosis.     

Use of magnetic beads for tissue DNA extraction and IS6110 Mycobacterium tuberculosis PCR.

Polymerase chain reaction (PCR) techniques are used increasingly for the diagnosis of Mycobacterium tuberculosis infection and can be used on the DNA obtained from both frozen and formalin fixed, paraffin wax embedded tissues. However, the extraction of DNA by means of the conventional phenol/chloroform method is time consuming and requires the use of potentially dangerous chemical reagents. This paper describes a method based upon the use of magnetic beads for the extraction of M tuberculosis DNA from both routinely formalin fixed, paraffin wax embedded tissues and frozen tissues. Magnetic bead extracted DNA from brain, lymph node, and lung tissues collected from patients with human immunodeficiency virus and tuberculosis was compared with that extracted using the phenol/chloroform method. The magnetic bead extraction procedure requires less than two hours, including the time necessary to dewax the tissue sections. In all cases, the DNA extracted with both methods was amplified successfully by PCR for the M tuberculosis IS6110 sequence. Magnetic bead DNA extraction can be used on both frozen and archival tissues: the method is reliable, simple, sensitive, and rapid; in addition, it does not use hazardous procedures or specialised laboratory equipment and can be used for routine DNA isolation from various human tissues.     

Use of magnetic beads for tissue DNA extraction and IS6110 Mycobacterium tuberculosis PCR.

Polymerase chain reaction (PCR) techniques are used increasingly for the diagnosis of Mycobacterium tuberculosis infection and can be used on the DNA obtained from both frozen and formalin fixed, paraffin wax embedded tissues. However, the extraction of DNA by means of the conventional phenol/chloroform method is time consuming and requires the use of potentially dangerous chemical reagents. This paper describes a method based upon the use of magnetic beads for the extraction of M tuberculosis DNA from both routinely formalin fixed, paraffin wax embedded tissues and frozen tissues. Magnetic bead extracted DNA from brain, lymph node, and lung tissues collected from patients with human immunodeficiency virus and tuberculosis was compared with that extracted using the phenol/chloroform method. The magnetic bead extraction procedure requires less than two hours, including the time necessary to dewax the tissue sections. In all cases, the DNA extracted with both methods was amplified successfully by PCR for the M tuberculosis IS6110 sequence. Magnetic bead DNA extraction can be used on both frozen and archival tissues: the method is reliable, simple, sensitive, and rapid; in addition, it does not use hazardous procedures or specialised laboratory equipment and can be used for routine DNA isolation from various human tissues.     

Mycobacterial interspersed repetitive unit typing of Mycobacterium tuberculosis compared to IS6110-based restriction fragment length polymorphism analysis for investigation of apparently clustered cases of tuberculosis

An evaluation of the utility of IS6110-based restriction fragment length polymorphism (RFLP) typing compared to a combination of variable number tandem repeat (VNTR) typing and mycobacterial interspersed repetitive unit (MIRU) typing was undertaken. A total of 53 patient isolates of Mycobacterium tuberculosis from four presumed episodes of cross-infection were examined. Genomic DNA was extracted from the isolates by a cetyl trimethylammonium bromide method. The number of copies of tandem repeats of the five loci ETR(A) to ETR(E) and 12 MIRU loci was determined by PCR amplification and agarose gel electrophoresis of the amplicons. VNTR typing identified the major clusters of strains in the three investigations in which they occurred (each representing a different evolutionary clade: 32333, 42235, and 32433). The majority of unrelated isolates (by epidemiology and RFLP typing) were also identified by VNTR typing. The concordance between the RFLP and MIRU typing was complete, with the exception of two isolates with RFLP patterns that differed by one band each from the rest of the major epidemiologically linked groups of isolates in investigation A. All of these isolates had identical MIRU and VNTR types. A further pair of isolates differed in the number of tandem repeat copies at two MIRU alleles but had identical RFLP patterns. The speed of the combined VNTR and MIRU typing approach enabled results for some of the investigations to be supplied in "real time," influencing choices in contact tracing. The ease of comparison of results of MIRU and VNTR typing, which are recorded as single multidigit numbers, was also found to greatly facilitate investigation management and the communication of results to health care professionals.     

Discrimination of single-copy IS6110 DNA fingerprints of Mycobacterium tuberculosis isolates by high-resolution minisatellite-based typing

Seven isoniazid-resistant isolates with mutations in the NADH dehydrogenase (ndh) gene were molecularly typed by IS6110-based restriction fragment length polymorphism analysis. All seven isolates with the R268H mutation had identical 1.4-kb IS6110 fingerprints. High-resolution minisatellite-based typing discriminated five of these isolates; two isolates were identical.     

Rapid discrimination of Mycobacterium tuberculosis complex strains by ligation-mediated PCR fingerprint analysis.

A ligation-mediated PCR (LMPCR) method for the amplification of sequences flanking the IS6110 of the Mycobacterium tuberculosis complex has been developed. The method uses one primer specific for IS6110 and a second specific for a linker ligated to SalI-restricted genomic DNA. LMPCR is a rapid screening method, valuable for the fingerprinting of M. tuberculosis complex strains.     

Epidemiologic usefulness of spoligotyping for secondary typing of Mycobacterium tuberculosis isolates with low copy numbers of IS6110

Restriction fragment length polymorphism (RFLP) analysis of IS6110 is commonly used to DNA fingerprint Mycobacterium tuberculosis. However, low-copy (< or =5) IS6110 M. tuberculosis strains are poorly differentiated, requiring secondary typing. When spoligotyping was used as the secondary method, only 13% of Maryland culture-positive tuberculosis (TB) patients with low-copy IS6110-spoligotyped clustered strains had epidemiologic linkages to another patient, compared to 48% of those with high-copy strains clustered by IS6110 alone (P < 0.01). Spoligotyping did not improve a population-based molecular epidemiologic study of recent TB transmission.     

Phospholipase region of Mycobacterium tuberculosis is a preferential locus for IS6110 transposition

Enzymes with phospholipase C activity in Mycobacterium tuberculosis have been recently described. The three genes encoding these proteins, plcA, plcB, and plcC, are located at position 2351 of the genomic map of M. tuberculosis H37Rv and are arranged in tandem. We have previously described the presence of variations in the restriction fragment length polymorphism patterns of the plcA and plcB genes in M. tuberculosis clinical isolates. In the present work we investigated the origin of this polymorphism by sequence analysis of the phospholipase-encoding regions of 11 polymorphic M. tuberculosis clinical isolates. To do so, a long-PCR assay was used to amplify a 5,131-bp fragment that contains the plcA and plcB genes and part of the plcC gene. In the M. tuberculosis strains studied the production of an amplicon approximately 1,400 bp larger than anticipated was observed. Sequence analysis of the PCR products indicated the presence of a foreign sequence that corresponded to an IS6110 element. We observed insertion elements in the plcA, plcB, and plcC genes. One site in plcB had the highest incidence of transposition (5 out of 11 strains). In two strains the insertion element was found in plcA in the same nucleotide position. In all the cases, IS6110 was transposed in the same direction. The high level of transposition in the phospholipase region can lead to the excision of fragments of genomic DNA by recombination of neighboring IS6110 elements, as demonstrated by finding the deletion, in two strains, of a 2,837-bp fragment that included plcA and most of plcB. This can explain the negative results obtained by some authors when detecting the mtp40 sequence (plcA) by PCR. Given the high polymorphism in this region, the use of the mtp40 sequence as a genetic marker for M. tuberculosis sensu stricto is very restricted.     

Evolution of the IS6110-based restriction fragment length polymorphism pattern during the transmission of Mycobacterium tuberculosis

Interpretation of the molecular epidemiological data of Mycobacterium tuberculosis is dependent on the validity of the assumptions that have been made. It is assumed that the IS6110 banding pattern is sufficiently stable to define epidemiological events representing ongoing transmission. However, molecular epidemiological data also support the observation that the IS6110 banding pattern may change over time. Factors affecting this rate may include the nature and duration of disease in a host and the opportunity to experience different host environments during the transmission cycle. To estimate the rate of IS6110 change occurring during the process of transmission, M. tuberculosis isolates from epidemiologically linked patients were genotypically characterized by restriction fragment length polymorphism (RFLP) analysis. The identification of IS6110 banding pattern changes during ongoing transmission suggested that a rate could be estimated. IS6110 change was significantly associated with strains with >5 IS6110 elements (P = 0.013) and was not observed in low-copy-number isolates. The minimum rate of appearance of variant strains was calculated to be 0.14 variant cases per source-case per year. This data suggest that clustering of isolates based on identical RFLP patterns is expected to underestimate transmission in patients infected with high-copy-number isolates. A model based on the rate of appearance of both variant and invariant strains demonstrates that the genotypically defined population structure may change by 18.6% during the study period of approximately 6.5 years. The implications for the use of RFLP data for epidemiologic study are discussed.     

Novel Hot Spot of IS6110 Insertion in Mycobacterium tuberculosis

We describe a hot spot for the insertion of IS6110 in Mycobacterium tuberculosis located in the area of region of difference 724 (RD724). Because RD724 defines sublineage 724 of M. tuberculosis, caution must be exercised when screening for RD724, as different polymorphisms can be observed in this region.IS6110 is a genomic insertion element containing 1,361 bp that is found only in organisms of the Mycobacterium tuberculosis complex (20). Like other members of the IS3 family, IS6110 contains two partially overlapping reading frames, orfA and orfB, that encode a transposase (6) allowing the insertion of IS6110 at multiple sites. M. tuberculosis has been shown to contain between 0 and 25 copies of this element (12). The number of copies of IS6110 and the molecular weights of the DNA fragments in which the insertions are found provide a genotyping method known as IS6110-based restriction fragment length polymorphism (RFLP) that is widely used to study the transmission dynamics of M. tuberculosis (11, 19). Although IS6110 does not have a known target for insertion, it is believed that there are hot spots of IS6110 insertion in the genome (13). Hot spots are areas of the genome where IS6110 insertions have been identified in more than one isolate. Several hot spots for IS6110 insertion have been described, including the plcD region (23), IS1547 (4), the direct repeat locus (7), and PPE genes (25). The presence of these hot spots supports the contention that IS6110 is not randomly distributed in the genome. This is important, as IS6110 RFLP typing is based on the premises that IS6110 is integrated into the genome randomly and that the discriminatory power of the technique increases in proportion to the number of IS6110 copies. Therefore, ideally, IS6110 bands integrated in hot spots should be removed when calculating similarity indexes among isolates, although in practice, it is difficult to determine which bands are inserted in hot spots (13).Another source of genetic polymorphisms in M. tuberculosis is the insertion and deletion of genomic segments known as large sequence polymorphisms or regions of difference (RDs) (21). Most RDs are considered unique-event polymorphisms and have been used to define the six major lineages and several sublineages of M. tuberculosis (5). RD724 defines sublineage 724, a sublineage of the Euro-American lineage, and is characterized by a deletion (relative to H37Rv) of 1,129 bp (H37RV: 2265112 to 2266241) and by an IS6110 insertion at genomic address 2265111, in reverse orientation relative to the H37Rv sequence (14). M. tuberculosis isolates from this sublineage are common in Uganda (1). Here we report four distinct IS6110 insertion sites in the area where RD724 is located, a hot spot for IS6110 insertion not described previously.As part of the genetic analysis of M. tuberculosis isolates from a clinical trial (Tuberculosis Trials Consortium Study 28, comparing moxifloxacin versus isoniazid during the intensive phase of tuberculosis treatment) (3), we determined the presence of RDs to define the lineages and sublineages of M. tuberculosis (5). Among the 260 isolates screened for RD724, we found 5 with PCR products different in size from that expected for H37Rv and sublineage 724. These isolates are the focus of this study.Briefly, the PCR used to screen for RD724 was prepared with 1 μM forward primer RD724F (CCATGCGATTTGACTTCCGATTGA) and reverse primer RD724R (ATATACCGTGCCGCGACTTGCTCT), 0.4 mM deoxynucleoside triphosphates, 0.65 U of Taq polymerase, 1× buffer, 2.5 mM Mg²⁺, and 1× Qsol. The PCR cycle included 1 min at 96°C; 30 cycles of 40 s at 96°C, 40 s at 62°C, and 2 min at 72°C; and 1 cycle of 10 min at 72°C. The PCR product was run in a 1% agarose gel with a 1-kb ladder.Five isolates had a PCR product of 2,649 bp, larger than that expected for M. tuberculosis H37Rv (1,200 bp) and for isolates from sublineage 724 (1,521 bp) (Fig. ​(Fig.1).1). To determine the exact nature of the genetic polymorphism, we performed sequencing and blast analysis. The sequence reaction was performed using the primers described previously and internal primers RD724ipG (AATGGGAGCCGAGCGTGACTGC) and RD724ipN (AAATCAGCTTTGCCGACGAC) to bridge the polymorphism. Products were sequenced using ABI BigDye v3.1 dye terminator sequencing chemistry and the ABI PRISM 3730xl capillary DNA analyzer (Applied Biosystems) at the UCSF Genomic Core Facility (http://genomics.ucsf.edu/). The sequence data were analyzed using ClustalW (http://www.ebi.ac.uk/Tools/clustalw/index.html), and the blast analysis was performed using TubercuList (http://genolist.pasteur.fr/TubercuList/). We also performed IS6110 RFLP and spoligotyping on the five isolates according to previously described methodology (9, 22).Open in a separate windowFIG. 1.Gel electrophoresis of PCR-amplified gene fragments of the RD724 region. PCR products were run on a 1% agarose gel with ethidium bromide and visualized with UV light. Lanes are flanked by a 1-kb ladder. Lanes: WT, H37RV (wild type, 1,288 bp); PC, positive control with RD724 deleted (1,521 bp); NC, negative control; A1, isolate 369 (polymorphism A, 2,649 bp); A2, isolate 377 (polymorphism A, 2,649 bp); B, isolate 144 (polymorphism B, 2,649 bp); C, isolate 194 (polymorphism C, 2,649 bp); D, isolate 188 (polymorphism D, 2,666 bp).The sequences of all five PCR products did not reveal the deletion (relative to H37Rv) that characterizes RD724 (Fig. ​(Fig.2).2). In all cases, there was an insertion of an IS6110 element in a forward position relative to the H37Rv genome within the boundaries of RD724. In two isolates (no. 369 and 377), all 1,361 bp of the IS6110 element were inserted at genomic address 2265111 (polymorphism A), which is the same site where the IS6110 element in RD724 is inserted. This insertion site was reported previously in reference strain MTB14323 (15). This site corresponds to the intergenic region between Rv2017 (2263998 to 2265038) and Rv2018 (2265280 to 2265999). One isolate (no. 188) had all 1,361 bp of the IS6110 plus 17 bp that correspond to the last 17 bp of the IS6110 element inserted at 2265175 (polymorphism D), also corresponding to the intergenic region between Rv2017 and Rv2018. In one isolate (no. 144), all 1,361 bp of IS6110 were inserted at 2266167 (polymorphism B), and in another isolate (no. 194), all 1,361 bp of IS6110 were inserted at 2266216 (polymorphism C). These two insertion sites are located within Rv2019 (2265989 to 2266405), a gene that codes for a hypothetical protein. The IS6110 RFLP patterns (patterns not shown; number of bands included in Table ​Table1)1) and spoligotypes (Table ​(Table1)1) were different among the five isolates, indicating that none of the five isolates were epidemiologically related. Consequently, there are at least four independent IS6110 insertion sites in the area where RD724 is located.Open in a separate windowFIG. 2.Sites of IS6110 element insertion in the region of the large sequence polymorphism RD724. The schematic shows the sequence of H37RV in the 5′→3′ orientation. The white bar indicates the intergenic region between Rv2017 and Rv2018. The insertion of IS6110 (black triangle) and genomic deletion (under bracket) characterizing RD724 are shown above the bar. Dashed arrows represent primers 724F (Rv2265026 to Rv2265049) and 724R (Rv2266314 to Rv2266291). Four distinct IS6110 insertion sites are present (denoted by white triangles with the letters referring to the different polymorphisms). Strains with polymorphism A have an insertion at 2265111, those with polymorphism D have an insertion at 2265175, those with polymorphism B have an insertion at 2266167, and those with polymorphism C have an insertion at 2266216. The solid arrows below the triangles indicate the direction of the IS6110 element relative to H37Rv. The distance between IS6110 insertion sites in polymorphisms A and D is 64 bp, that in polymorphisms D and B is 992 bp, and that in polymorphisms B and C is 49 bp.

TABLE 1.

Sublineages, IS6110 band numbers,^a and spoligotypes of the isolates with different polymorphisms in the area of RD724

Characterization of a Mycobacterium tuberculosis insertion sequence, IS6110, and its application in diagnosis

An insertion sequence-like element, IS6110, was isolated from a Mycobacterium tuberculosis cosmid library as a repetitive sequence. IS6110 shows similarities with elements of the IS3 family. This insertion sequence was found to be specific to mycobacteria belonging to the M. tuberculosis complex. For detection and identification of M. tuberculosis bacilli in uncultured specimens, oligonucleotides derived from the IS6110 sequence were used as primers and probes in polymerase chain reaction studies. The results obtained were consistent with results of classical identification procedures, bacteriological data, and clinical criteria.     

PCR amplification of the IS6110 insertion element of Mycobacterium tuberculosis in fecal samples from patients with intestinal tuberculosis

PCR amplification of insertion element IS6110 of Mycobacterium tuberculosis in fecal samples was evaluated in the diagnosis of intestinal tuberculosis (ITB). The numbers of samples that tested positive by PCR with SalI digestion were 16/18 untreated-ITB samples, 0/8 treated-ITB samples, 12/14 smear-positive pulmonary tuberculosis samples, and 0/30 control samples. The sensitivity, specificity, positive predictive value, and negative predictive value of fecal PCR were 88.8%, 100%, 100%, and 93.7%, respectively.