Analyses of the genomes of prototype pichinde arenavirus and a virulent derivative of Pichinde Munchique: evidence for sequence conservation at the 3' termini of their viral RNA species

Sequence analyses of 3′-[³²P]pCp end-labeled large (L) and small (S) viral RNA species of prototype Pichinde (PIC) arenavirus and a virulent derivative of Pichinde Munchique (MUC) virus have shown that the two viral RNA species of each virus have similar 3′-terminal RNA sequences. The 3′-terminal sequence of the first 19 nucleotides of the S RNA of either virus is: 5′ … GCCUAGGAUCCACUGUGCG_OH3′. By comparison, the sequence of the first 19 nucleotides of the L RNA species of either virus is identical, except for a position 6 G residue (from the 3′ end), and a position 8 U residue. The first UAC triplet on S RNA occurs at nucleotide position 84 from the 3′ end; for the L RNA it occurs at nucleotide position 31. Whether these UAC triplets represent the initiation points of translation on viral complementary mRNA species remains to be determined.     

Nucleotide sequence conservation at the 3' termini of the virion RNA species of New World and Old World arenaviruses

The 3?terminal nucleotide sequences have been determined for the L and S genomic RNA species of Tacaribe virus (a New World arenavirus) and LCM-ARM virus (an Old World arenavirus). These data have been compared to the previously determined corresponding sequences of Pichinde Munchique virus (D. Auperin, K. Dimock, P. Cash, W. E. Rawls, and D. H. L. Bishop, Virology 116, 363–367,1982). The 3′-terminal 19-nucleotide sequence of the S RNA species of all three arenaviruses is: 5′…GCCUAG-GAUCCACUGUGCG_OH³′. The 3′-nucleotide sequences of the L RNA species of Pichinde Munchique virus and Tacaribe virus are identical to the corresponding S RNA sequences except for single base substitutions at positions 6 and 8. The 3'-terminal nucleotide sequence of the LCM-ARM L RNA species differs from the S RNA nucleotide sequence by four base substitutions (positions 6, 8, 9, and 17).     

Terminal sequences of the genome and replicatioe-form RNA of the flavivirus west nile virus: absence of poly(A) and possible role in RNA replication

The structures of the infectious 42 S genome RNA of the flavivirus West Nile (WN) virus and of the replicative-form (RF) RNA containing 42 S RNA of positive and negative polarity have been investigated. The RF RNA has been labeled in vitro at the 3′ and 5′ termini and the terminal sequences have been determined by the mobility shift method. The results obtained indicate that both RNA molecules are exact complements of each other and that the 3′ terminus of the 42 S plus-strand RNA component of the RF RNA does not contain a poly(A) sequence but terminates with a heteropolymeric AACACAGGAUCU_OH sequence. The 3′ terminus of the 42 S minus-strand RNA has the sequence CUCACACAGGCGAACUACU_OH. Comparison of these sequences shows that both molecules contain the 3′-terminal dinucleotide CUOH and the heptanucleotide ACACAGG which is separated from the 3′-terminal dinucleotide by two and seven nucleotides in 42 S plus- and minus-strand RNA, respectively. The 42 S viral genome RNA also does not contain a 3′-terminal poly(A) sequence but terminates with the 3′-terminal sequence identified in the 42 S plus-strand RNA of the RF. Analysis of the nucleotides adjacent to the cap at the 5′ terminus of the viral genome RNA together with the 3′-terminal sequence analysis indicates that the nucleotide sequence of the viral genome RNA is identical to that of the 42 S plus-strand RNA component of the virus-specific RF RNA.     

Terminal structure involving a single-stranded stretch in the double-stranded RNA from Penicillium chrysogenum virus.

The terminal structure of double-stranded RNA extracted from Penicillium chrysogenum was studied by ³H-labeling with borohydride reduction for the cis-diol in the terminal nucleoside and by ³²P-labeling with polynucleotide kinase for the 5′-terminal. Three RNA segments of different molecular weights were equally labeled. The terminal structure was the same for these three RNA segments. The nucleotide sequences near the 3′-terminal were —G-U for one strand and —Y-A for the other. The [³²P]phosphate was incorporated into only one strand. The labeled 5′-terminus has the sequence A-G-Y—. The 5′-terminus of the other strand seemed to be blocked by something like the confronting nucleotide m⁷G^5′ppp^5′N(m)- found in the mRNA strand of other double-stranded RNA viruses, since a ³H-labeled, unidentified nucleotide was observed besides the 3′-terminal nucleoside derivatives. As the ³²P-labeled 5′-terminal A-G-Y- is not complementary to either of the two 3′-terminal sequences, the secondary structure was examined by treatment with Aspergillus nuclease S₁, which selectively splits single-stranded parts in polynucleotides. The ³²P-labeled 5′-nucleotide was released, whereas the ³H-labeled nucleosides were not released. The nucleotides near the 5′-terminus of the unblocked strand carrying the sequence A-G-Y- must be in a single-stranded stretch, while both the 3′-termini are paired with a complementary strand.     

Molecular characterization of <Emphasis Type="Italic">Plum pox virus</Emphasis> Rec isolates from Russia suggests a new insight into evolution of the strain

Field isolates of Plum pox virus (PPV), belonging to the strain Rec, have been found for the first time in Russia. Full-size genomes of the isolates K28 and Kisl-1pl from myrobalan and plum, respectively, were sequenced on the 454 platform. Analysis of all known PPV-Rec complete genomes using the Recombination Detection Program (RDP4) revealed yet another recombination event in the 5′-terminal region. This event was detected by seven algorithms, implemented in the RDP4, with statistically significant P values and supported by a phylogenetic analysis with the bootstrap value of 87%. A putative PPV-M-derived segment, encompassing the C-terminus of the P1 gene and approximately two-thirds of the HcPro gene, is bordered by breakpoints at positions 760–940 and 1838–1964, depending on the recombinant isolate. The predicted 5′-distal breakpoint for the isolate Valjevka is located at position 2804. The Dideron (strain D) and SK68 (strain M) isolates were inferred as major and minor parents, respectively. Finding of another recombination event suggests more complex evolutionary history of PPV-Rec than previously assumed. Perhaps the first recombination event led to the formation of a PPV-D variant harboring the PPV-M-derived fragment within the 5′-proximal part of the genome. Subsequent recombination of its descendant with PPV-M in the 3′-proximal genomic region resulted in the emergence of the evolutionary successful strain Rec.     

Multiple sites of recombination within the RNA genome of foot-and-mouth disease virus

Recombinant foot-and-mouth disease viruses were isolated from cells infected with a mixture of temperature-sensitive (ts) mutants belonging to different subtype strains. In order to select for recombination events in many different regions of the genome, crosses were performed between various pairs of mutants, with ts mutations in different regions of the genome. ts+ progeny were analysed by electrofocusing virus-induced proteins and RNase T1 fingerprinting of their RNA. All but 5 out of 43 independent isolates, from nine crosses, proved to have recombinant RNA genomes. Maps of these genomes, based on a knowledge of the locations of the unique oligonucleotides, were constructed. Most could be interpreted as being the products of single genetic cross-overs, although three recombinants were formed by two cross-overs each. Cross-overs in at least twelve distinct regions of the genome were identified. This evidence of a large number of recombination sites suggests that RNA recombination in picornaviruses is a general, as opposed to a site-specific, phenomenon.     

The sequences at the termini of four genes of the three reovirus serotypes

As judged by the ability of their genomes to hybridize, reovirus serotypes 1 and 3 are related to the extent of about 70%, but serotype 2 is related to serotypes 1 and 3 only to the extent of about 10%. By contrast, the antigenic determinants of most reovirus proteins are group specific, that is, they have been highly conserved during evolution. The exception is protein al, the type-specific antigen; and the Sl genes of the three reovirus serotypes, which code for protein σ1, are known to have quite dissimilar sequences at their 5′- and 3′-termini. We have now sequenced stretches about 70 nucleotides long at the ends of the Ll, M3, and S2 genes of the Lang (serotype 1), D5/Jones (serotype 2), and Dearing (serotype 3) strains of reovirus, and found that these regions are extraordinarily similar. For example, although the serotype 1 and 2 M3 genes are no more than 10% related as judged by ability to hybridize with each other, 61 of their first 66 5′-terminal residues are the same, and four of the changes are in third codon positions. Thus, like the sequences that code for the antigenic determinants, the sequences of the terminal regions of the reovirus genes, except those of gene S1, have been highly conserved during evolution.     

Recombinants between attenuated and virulent strains of poliovirus type 1: derivation and characterization of recombinants with centrally located crossover points

Recombinants with a centrally located crossover point were selected from crosses between poliovirus type 1 strains and intertypic (type 3/type 1) recombinants. Two such recombinants were characterized in some detail. In one of them (v1/a1-6), the 5' half of the genome was derived from a virulent type 1 strain, while the 3' half came from an attenuated type 1 strain. The genome of the other recombinant (a1/v1-7) had the reverse organization, with the 5' and 3' halves being derived from the type 1 attenuated and virulent strains, respectively. As deduced from the RNase T1 oligonucleotide maps, the a1/v1-7 genome also had a relatively short centrally located insert of the poliovirus type 3 origin. Both recombinants exhibited ts phenotypes. The RNA phenotypes of the recombinants corresponded to that of the parent donating the 3' half of the genome, v1/a1-6 and a1/v1-7 expressing RNA- and RNA +/- characters, respectively. Despite being a ts RNA- virus, v1/a1-6 proved to be neurovirulent when injected intracerebrally into Cercopithecus aethiops monkeys, although it exhibited a somewhat diminished level of pathogenicity as compared to its virulent type 1 parent. Recombinant a1/v1-7 behaved as an attenuated strain. These data supported our previous conclusion drawn from the experiments with intertypic poliovirus recombinants that the attenuated phenotype of poliovirus depends largely on the structure of the 5' half of its genome, although mutations of the 3' half may alleviate the virulence of the virus to a degree.     

Construction and properties of intertypic poliovirus recombinants: first approximation mapping of the major determinants of neurovirulence

An attempt was made to map, in a general way, the region of the poliovirus genome that is responsible for the neurovirulent and attenuated phenotypes of different virus strains. A set of four recombinants was investigated, one described previously (E. A. Tolskaya, L. I. Romanova, M. S. Kolesnikova, and V. I. Agol, 1983, Virology 124, 121-132) and three obtained in the present work with the following genetic structure: a 5' end-adjacent segment of the genome derived from either a virulent strain (452/62 3D), or from an attenuated strain (Leon-2) of poliovirus type 3, the remaining RNA sequences being derived from either a virulent strain (Mgr), or an attenuated strain (LSc-gr3) of poliovirus type 1. The crossover points in the recombinant genomes were centrally located, somewhere between the gene(s) that determines antigenic specificity of the virus and the locus that determines resistance of virus multiplication to low doses of guanidine. The recombinant nature of the newly selected clones was definitively established by mapping RNase T1 oligonucleotides of their genome. The recombinants were characterized with respect to their ability to produce infectious progeny and synthesize viral RNA at an elevated temperature. Neurovirulence of the recombinants was assayed by intracerebral inoculation of monkeys. Irrespective of the origin of the 3' end-adjacent segment of the genome, the recombinants that inherited the 5' end-adjacent segment from the neurovirulent parent were neurovirulent, whereas the recombinants with the 5' end-adjacent segment derived from the attenuated parent were not. The results suggest that the major determinants of neurovirulence of these recombinants (and by inference, of their parental viruses) reside in the 5' end-adjacent segment of poliovirus genome, known to code for capsid proteins.     

Terminal sequences of Sindbis virus-specific nucleic acids: Identity in molecules synthesized in vertebrate and insect cells and characteristic properties of the replicative form RNA

The terminal sequences of the virus-specific nucleic acids synthesized in BHK vertebrate cells and in Aedes albopictus insect cells infected with the alphavirus Sindbis virus have been analyzed. The 26 S and 42 S plus-strand RNA molecules have the 5′-terminal sequences m⁷GpppAUAG and m⁷GpppAUAGGCGGCGUAGUACACAC, respectively. A 22 S replicative form (RF) RNA which contains an infectious 42 S plus-strand genome RNA molecule and a complementary 42 S negative-strand RNA accumulates in infected cells. The 5′-terminal sequence of the 42 S plus-strand RNA component of the RF is identical to that of the single-stranded plus-strand 42 S RNA molecule except for the absence of a 5′-terminal cap in the constituent of the RF RNA. The identification of a poly(U) sequence at the 5′-terminus of the 42 S minus strand RNA in our experiments is in accordance with earlier results obtained in other laboratories (Sawicki and Gomatos, 1976; Frey and Strauss, 1978). Analogous to our data concerning the structure of the RF RNA of the alphavirus Semliki Forest virus (Wengler et al., 1979) the 3′-terminus of the 42 S minus strand RNA component of the Sindbis virus-specific RF RNA is complementary to the 5′-terminus of the 42 S plus strand RNA molecule but in addition contains a 3′-terminal extra unpaired guanosine residue. The 3′-terminal sequence of the 42 S minus strand is strongly conserved between the two alphaviruses, Sindbis virus and Semliki Forest virus. The terminal sequences of the RF RNA synthesized in BHK and Aedes albopictus cells are identical. Analyses of the capped oligonucleotides derived from virus-specific single-stranded 42 S plus-strand RNA and from 26 S RNA strongly indicate that no base sequence differences exists between the corresponding molecules synthesized in either vertebrate or insect cells. Possible implications of these findings concerning the structure of alphavirus RF RNA and the synthesis of alphavirus-specific nucleic acids are discussed.     

The extreme 5'-terminal sequences of sindbis virus 26 and 42 S RNA.

The messenger RNA species specified by Sindbis virus in infected cells, 26 and 42 S RNA, have been characterized with regard to their extreme 5′-terminal sequences. (Methyl-³H)-Labeled m⁷G in “caps” was used to detect cap-containing, and hence 5′-terminal, oligonucleotides after digestion with ribonuclease A, or ribonuclease T₁, plus phosphatase. Digests were fractionated by DEAE column chromatography, by cellulose acetate electrophoresis, and by DEAE paper electrophoresis. The latter two systems were also applied sequentially to ³²P-labeled samples to generate oligonucleotide fingerprints. The cap-containing oligonucleotide from T₁-plus-phosphatase digests of 26 S RNA was isolated and shown to be m⁷ GpppApUpG. The homologous oligonucleotide from such a digest of 42 S RNA behaved as if it were one pyrimidine residue larger, whereas cap-containing oligonucleotides from ribonuclease A-plus-phosphatase digests of the two RNA species had identical chromatographic and electrophoretic properties. We infer from these and earlier findings that Sindbis virus-specified 42 S RNA terminates in m⁷GpppApUpYpG. These results support the idea that 26 S RNA and 42 S RNA arise from two distinct and different initiation sites.     

Identity of the 3'-terminal sequences in ten genome segments of silkworm cytoplasmic polyhedrosis virus

The double-stranded RNA genome of cytoplasmic polyhedrosis virus consists of ten different segments. The RNA was oxidized and then reduced with [³H]sodium borohydride to label the ribose moieties of 3′-terminal nucleosides. The labeled genome segments were separated from each other by polyacrylamide gel electrophoresis, and their 3′-termini were analysed by alkaline digestion and column chromatography. It was concluded that all ten genome segments have the identical 3′-terminal structure, carrying cytosine in one RNA chain and uracil in another chain:

In the course of experiments, some radioactive non-nucleosidic materials were found to be associated with every ³H-labeled RNA segment. These materials were released from RNA by dilute alkaline solution, and not adsorbed on charcoal.     

Neurovirulence of influenza virus in mice I. Neurovirulence of recombinants between virulent and avirulent virus strains

The neurovirulence of influenza A/WSN (HONI) virus in mice was studied using recombinants between neurovirulent WSN and nonneurovirulent A/Hong Kong (HK, H3N2) viruses. Parental derivation of genes in recombinants were analyzed by the electrophoresis of viral RNA in urea-polyacrylamide gel. The neurovirulence was tested by intracerebral inoculation of recombinants into mice. It was found that five large genes, P₃, P₁, P₂, HA, and NP, were not essential for the virulence, because recombinants having these five genes derived from HK parent were virulent. Recombinants in which any of three remaining WSN genes, NA, M, and NS, was replaced with the one from HK parent, failed to kill mice. Therefore, these three genes were responsible for the difference of neurovirulence between the two virus strains. However, when tested in mice immunosuppressed by the administration of cyclophosphamide, recombinants containing either M or NS protein from HK parent were virulent, but viruses containing HK neuraminidase were still avirulent. Viruses containing HK neuraminidase appeared incapable of multiplying in the mouse brain, while those containing either M or NS protein derived from HK virus multiplied to a limited extent. It was suggested that WSN neuraminidase was the principal determining factor of the neurovirulence of WSN virus, without which no virus multiplication occurred, while M and probably NS proteins of WSN virus played a role of helper or accessory virulence factor(s), enabling the efficient virus replication.     

Multiple recombination sites at the 5'-end of murine coronavirus RNA

Mouse hepatitis virus (MHV), a murine coronavirus, contains a nonsegmented RNA genome. We have previously shown that MHV could undergo RNA-RNA recombination in crosses between temperature-sensitive mutants and wild-type viruses at a very high frequency (S. Makino, J.G. Keck, S.A. Stohlman, and M.M.C. Lai (1986) J. Virol. 57, 729-737). To better define the mechanism of RNA recombination, we have performed additional crosses involving different sets of MHV strains. Three or possibly four classes of recombinants were isolated. Recombinants in the first class, which are similar to the ones previously reported, contain a single crossover in either gene A or B, which are the 5'-most genes. The second class of recombinants contain double crossovers in gene A. The third class of recombinants have crossovers within the leader sequence located at the 5'-end of the genome. The crossover sites of the third class have been located between 35 and 60 nucleotides from the 5'-end of the leader RNA. One of these recombinants has double crossovers within the short region comprising the leader sequences. Finally, we describe one recombinant which may contain a triple crossover. The presence of so many recombination sites within the 5'-end of the genome of murine coronaviruses confirms that RNA recombination is a frequent event during MHV replication and is consistent with our proposed model of "copy-choice" recombination in which RNA replication occurs in a discontinuous and nonprocessive manner.