Comparison of automated and nonautomated systems for identification of Burkholderia pseudomallei

The identification of Burkholderia pseudomallei, the causative agent of melioidosis, is usually not difficult in laboratories in areas where it is endemic. With the increase in international travel and the threat of bioterrorism, it has become more likely that laboratories in areas where it is not endemic could encounter this organism. The increase in the use of and dependence upon automated identification systems makes accurate identification of uncommonly encountered organisms such as B. pseudomallei critically important. This study compares the manual API 20NE and 20E identification systems with the automated Vitek 1 and 2 systems. A total of 103 B. pseudomallei isolates were tested and correctly identified in 98%, 99%, 99%, and 19% of cases, respectively. The failure of the Vitek 2 to correctly identify B. pseudomallei was largely due to differences in the biochemical reactions achieved compared to expected values in the database. It is suggested that this deficiency in the Vitek 2 may be due to the large number of uncertain results reported for these isolates. These results reduce the discriminating ability of the instrument to distinguish between uncommonly encountered isolates such as those of B. pseudomallei.     

Comparison of Ashdown's medium, Burkholderia cepacia medium, and Burkholderia pseudomallei selective agar for clinical isolation of Burkholderia pseudomallei

Ashdown's medium, Burkholderia pseudomallei selective agar (BPSA), and a commercial Burkholderia cepacia medium were compared for their abilities to grow B. pseudomallei from 155 clinical specimens that proved positive for this organism. The sensitivity of each was equivalent; the selectivity of BPSA was lower than that of Ashdown's or B. cepacia medium.     

Distinguishing species of the Burkholderia cepacia complex and Burkholderia gladioli by automated ribotyping

Several species belonging to the genus Burkholderia are clinically relevant, opportunistic pathogens that inhabit major environmental reservoirs. Consequently, the availability of means for adequate identification and epidemiological characterization of individual environmental or clinical isolates is mandatory. In the present communication we describe the use of the Riboprinter microbial characterization system (Qualicon, Warwick, United Kingdom) for automated ribotyping of 104 strains of Burkholderia species from diverse sources, including several publicly accessible collections. The main outcome of this analysis was that all strains were typeable and that strains of Burkholderia gladioli and of each species of the B. cepacia complex, including B. multivorans, B. stabilis, and B. vietnamiensis, were effectively discriminated. Furthermore, different ribotypes were discerned within each species. Ribotyping results were in general agreement with strain classification based on restriction fragment analysis of 16S ribosomal amplicons, but the resolution of ribotyping was much higher. This enabled automated molecular typing below the species level. Cluster analysis of the patterns obtained by ribotyping (riboprints) showed that within B. gladioli, B. multivorans, and B. cepacia genomovar VI, the different riboprints identified always clustered together. Riboprints of B. cepacia genomovars I and III, B. stabilis, and B. vietnamiensis did not show distinct clustering but rather exhibited the formation of loose assemblages within which several smaller, genomovar-specific clusters were delineated. Therefore, ribotyping proved useful for genomovar identification. Analysis of serial isolates from individual patients demonstrated that infection with a single ribotype had occurred, despite minor genetic differences that were detected by pulsed-field gel electrophoresis of DNA macrorestriction fragments. The automated approach allows very rapid and reliable identification and epidemiological characterization of strains and generates an easily manageable database suited for expansion with information on additional bacterial isolates.     

Use of a real-time PCR TaqMan assay for rapid identification and differentiation of Burkholderia pseudomallei and Burkholderia mallei

A TaqMan allelic-discrimination assay designed around a synonymous single-nucleotide polymorphism was used to genotype Burkholderia pseudomallei and Burkholderia mallei isolates. The assay rapidly identifies and discriminates between these two highly pathogenic bacteria and does not cross-react with genetic near neighbors, such as Burkholderia thailandensis and Burkholderia cepacia.     

Comparison of diagnostic laboratory methods for identification of Burkholderia pseudomallei

Limited experience and a lack of validated diagnostic reagents make Burkholderia pseudomallei, the cause of melioidosis, difficult to recognize in the diagnostic microbiology laboratory. We compared three methods of confirming the identity of presumptive B. pseudomallei strains using a collection of Burkholderia species drawn from diverse geographic, clinical, and environmental sources. The 95 isolates studied included 71 B. pseudomallei and 3 B. thailandensis isolates. The API 20NE method identified only 37% of the B. pseudomallei isolates. The agglutinating antibody test identified 82% at first the attempt and 90% including results of a repeat test with previously negative isolates. Gas-liquid chromatography analysis of bacterial fatty acid methyl esters (GLC-FAME) identified 98% of the B. pseudomallei isolates. The agglutination test produced four false positive results, one B. cepacia, one B. multivorans, and two B. thailandensis. API produced three false positive results, one positive B. cepacia and two positive B. thailandensis. GLC-FAME analysis was positive for one B. cepacia isolate. On the basis of these results, the most robust B. pseudomallei discovery pathway combines the previously recommended isolate screening tests (Gram stain, oxidase test, gentamicin and polymyxin susceptibility) with monoclonal antibody agglutination on primary culture, followed by a repeat after 24 h incubation on agglutination-negative isolates and GLC-FAME analysis. Incorporation of PCR-based identification within this schema may improve percentages of recognition further but requires more detailed evaluation.     

Comparison of one-tube multiplex PCR, automated ribotyping and intergenic spacer (ITS) sequencing for rapid identification of Acinetobacter baumannii

Acinetobacter baumannii has emerged as a serious cause of nosocomial infections. Rapid identification of this pathogen is required so that appropriate therapy can be given and outbreaks controlled. This study evaluated a multiplex PCR and an automated ribotyping system for the rapid identification of Acinetobacter baumannii. In total, 22 different reference strains and 138 clinical isolates of Acinetobacter spp., identified by 16S-23S rRNA intergenic spacer (ITS) sequence analysis, were evaluated. All A. baumannii isolates (82 clinical isolates and one reference strain) were identified by the multiplex PCR method (specificity 100%). The sensitivity and specificity of the ribotyping system for identification of A. baumannii were 85.5% (71/83) and 93.5% (72/77), respectively. An additional 100 clinical isolates belonging to the Acinetobacter calcoaceticus-A. baumannii complex were used to compare these two methods for identification of A. baumannii, and this comparison revealed a level of disagreement of 14% (14 isolates). The accuracy of the multiplex PCR was 100%, which was confirmed by sequence analysis of the ITS and recA gene of these isolates. Thus, the multiplex PCR method dramatically increased the efficiency and speed of A. baumannii identification.     

Strategies toward vaccines against Burkholderia mallei and Burkholderia pseudomallei

Burkholderia mallei and Burkholderia pseudomallei are Gram-negative, rod-shaped bacteria, and are the causative agents of the diseases glanders and melioidosis, respectively. These bacteria have been recognized as important pathogens for over 100 years, yet a relative dearth of available information exists regarding their virulence determinants and immunopathology. Infection with either of these bacteria presents with nonspecific symptoms and can be either acute or chronic, impeding rapid diagnosis. The lack of a vaccine for either bacterium also makes them potential candidates for bioweaponization. Together with their high rate of infectivity via aerosols and resistance to many common antibiotics, both bacteria have been classified as category B priority pathogens by the US NIH and US CDC, which has spurred a dramatic increase in interest in these microorganisms. Attempts have been made to develop vaccines for these infections, which would not only benefit military personnel, a group most likely to be targeted in an intentional release, but also individuals who may come in contact with glanders-infected animals or live in areas where melioidosis is endemic. This review highlights some recent attempts of vaccine development for these infections and the strategies used to improve the efficacy of vaccine approaches.     

Detection of Burkholderia pseudomallei DNA in patients with septicemic melioidosis.

Septicemic melioidosis is the most severe form of melioidosis, which is caused by Burkholderia pseudomallei. It is endemic in Southeast Asia and is the leading cause of death from community-acquired septicemia in northeast Thailand. A major factor that contributes to the high mortality is the delay in isolation and identification of the causative organism. More than half of the patients die within the first 2 days after hospital admission, before bacterial cultures become positive. The present study was undertaken to develop a rapid diagnostic method for identification of this organism. A nested PCR system that amplified a part of 16S rRNA gene that was highly specific to B. pseudomallei was developed. This system was able to detect as few as two bacteria present in the PCR. DNAs from all 30 clinical isolates of B. pseudomallei and none of the other bacteria tested were amplified. The described PCR system has been employed for the detection of the organism in clinical specimens, including buffy coat and pus from internal organs. The detection of B. pseudomallei in buffy coat specimens by PCR was shown to be comparable to the detection of bacteria from blood cultures in septicemic melioidosis cases.     

Comparison of Routine Bench and Molecular Diagnostic Methods in Identification of Burkholderia pseudomallei

This study compared the identification of Burkholderia pseudomallei with that of related organisms. Bench tests and latex agglutination were compared with molecular identification. Using bench tests and latex agglutination alone, 100% (30/30) of B. pseudomallei isolates were correctly identified. Amoxicillin-clavulanate susceptibility testing was also a good and simple discriminatory test.Melioidosis is an infectious disease caused by Burkholderia pseudomallei, which is endemic in Southeast Asia and northern Australia. Cases occur mainly during periods of heavy rain (13). It is a clinically diverse infection affecting many organ systems and commonly presents as a fulminant septicemia (3, 4).There has been controversy as to the optimal identification system for B. pseudomallei (2, 9, 10, 11, 12, 19). The reliability of the API 20NE and the Vitek 1 systems (bioMérieux, Marcy L''Etoile, France) has been questioned and molecular confirmation suggested (14). The reliability of presumptive tests (oxidase, Gram staining, resistance to gentamicin and polymyxin) in the identification of this organism has previously been described as 100% accurate (6). It should be noted that neither system will distinguish related species such as Burkholderia thailandensis from B. pseudomallei.The commonest misidentification of B. pseudomallei when using identification systems is with Burkholderia cepacia, Pseudomonas aeruginosa, Pseudomonas fluorescens, and Chromobacterium spp. (1). A recent study compared the API 20NE system and a latex agglutination assay and found that the API 20NE system identified 99% of B. pseudomallei isolates correctly. It did not however distinguish between B. thailandensis and B. pseudomallei. The addition of the latex agglutination test correctly identified 99.5% of isolates and was negative for 98% of the B. thailandensis isolates and other oxidase-positive gram-negative bacilli (1). Molecular identification of the organism has been described, using a number of genomic targets (14, 17, 18).A previous study compared basic bench diagnostic presumptive tests with B. pseudomallei slide agglutination using a monoclonal antibody, API 20NE (bioMérieux, Marcy L''Etoile, France), cellular fatty acid analysis, and molecular detection (10). This showed that the PCR alone had a sensitivity and specificity of 100%. API 20NE performed poorly in this study, with a sensitivity of 37% and a specificity of 92% (10). The agglutination test used had a sensitivity of 94% and a specificity of 83%. Although fatty acid analysis had a sensitivity of 98% and a specificity of 83%, it was acknowledged that this technology was not widely available. Interestingly, the presumptive tests (oxidase, Gram staining, resistance to gentamicin and polymyxin) did not distinguish between B. pseudomallei, B. cepacia, and B. thailandensis. The aim of this study was to compare the diagnostic efficacies of standard presumptive identification methods (oxidase, gentamicin resistance, and amoxicillin-clavulanate susceptibility), including a specific latex agglutination assay, with specific molecular detection in the identification of B. pseudomallei to determine whether low-cost nonmolecular techniques may still be useful in resource-poor areas for the diagnosis of melioidosis.Of the total of 43 bacterial isolates used, 30 were B. pseudomallei, three were B. cepacia, five were B. thailandensis, one was Chromobacterium violaceum (nonpigmented), and four were P. aeruginosa. All isolates were clinical isolates except for the B. thailandensis isolates, which were of environmental origin. Burkholderia mallei, a closely related species, was not used as a comparator because it is not misidentified as B. pseudomallei or vice versa with identification systems. It is also susceptible to gentamicin. All B. pseudomallei isolates investigated were from North Queensland. The identity of all isolates was confirmed using the Vitek 1 and API 20NE systems, and the isolates were stored at −70°C. These isolates had been validated in a previous study (12). The sequenced B. pseudomallei K96243 isolate was used as a control for real-time PCR. All isolates were subcultured onto Columbia horse blood agar (bioMérieux, Australia), incubated in air at 37°C for 24 h, and checked for purity. Single colonies were inoculated into Mueller-Hinton broth (bioMérieux, Australia) and incubated at 37°C for 24 h. Mueller-Hinton agar (bioMérieux, Australia) was used for susceptibility testing. All isolates were coded to ensure that the operator performing the identification was unaware of the identity of the isolate. Oxidase tests were performed by a standard oxidase reagent-impregnated strip method with appropriate controls. Susceptibility testing was carried out using a standard method with discs containing 20/10 μg amoxicillin-clavulanate and 10 μg gentamicin (5). The plates were incubated in air at 37°C for 24 h. As there are no CLSI zone diameter standards for B. pseudomallei, the standards for P. aeruginosa and Enterobacteriaceae were used. Zones of inhibition to gentamicin of ≥15 mm and to amoxicillin-clavulanate of ≥18 mm were considered susceptible (5). The latex reagent and the techniques used have been reported in detail in a previous study (1). PCR amplification was performed as previously described, with similar primers and probes (17), using Rotor-Gene 3000 (Corbett Life Science, Australia) with minor modifications. Bovine serum albumin was not added to the master mix. ImmoMix Taq (Bioline) was used with deoxynucleoside triphosphate (200 μM) at a final MgCl₂ concentration of 2.5 mM.The following primers and probes were used: primer BPSS1187/BURPS1710b_A0179 (B. pseudomallei-unique sequence) (forward, ATCGAATCAGGGCGTTCAAG; reverse, CATTCGGTGACGACACGACC) and probe 6-carboxyfluorescein-CGCCGCAAGACGCCATCGTTCAT-6-carboxytetramethylrhodamine. The probe is labeled with a reporter dye, 6-carboxyfluorescein, and a quencher dye, 6-carboxytetramethylrhodamine.A total of 33 isolates were presumptively identified as B. pseudomallei on the basis of a positive oxidase test, resistance to gentamicin, and susceptibility to amoxicillin-clavulanate. These included four of the five B. thailandensis isolates and 29 of the 30 B. pseudomallei isolates (Table ​(Table1).1). One of the B. thailandensis isolates was not presumptively identified as B. pseudomallei as expected, due to a reduced zone of inhibition to amoxicillin-clavulanate. One of the B. pseudomallei isolates failed to be presumptively identified as B. pseudomallei, as it had a zone of inhibition to gentamicin of 22 mm. Nevertheless, it was confirmed with both latex agglutination and quantitative real-time PCR. B. pseudomallei is intrinsically resistant to gentamicin, although rare isolates which are susceptible to gentamicin have been described (16). When presumptive identification was compared with definitive identification (Table ​(Table1),1), presumptive identification had a sensitivity of 97%, a specificity of 69%, a positive predictive value of 88%, and a negative predictive value of 90% (P < 0.0001; Fisher''s exact test). If B. thailandensis isolates were excluded, presumptive identification would have a specificity of 100% and a sensitivity of 97%.

TABLE 1.

Isolates presumptively and definitively identified as B. pseudomallei

Intracellular survival of Burkholderia pseudomallei.

Burkholderia pseudomallei is the causative agent of melioidosis, a disease being increasingly recognized as an important cause of morbidity and mortality in many regions of the world. Several features of melioidosis suggest that B. pseudomallei is a facultative intracellular pathogen. This study was designed to assess the ability of B. pseudomallei to invade and survive in eukaryotic cells. We have shown that B. pseudomallei has the capacity to invade cultured cell lines, including HeLa, CHO, A549, and Vero cells. We have demonstrated intracellular survival of B. pseudomallei in professional phagocytic cells, including rat alveolar macrophages. B pseudomallei was localized inside vacuoles in human monocyte-like U937 cells, a histiocytic lymphoma cell line with phagocytic properties. Additionally, electron microscopic visualization of B. pseudomallei-infected HeLa cells and polymorphonuclear leukocytes confirmed the presence of intracellular bacteria within membrane-bound vacuoles. B. pseudomallei was found to be resistant to the cationic peptide protamine and to purified human defensin HNP-1.     

Molecular Procedure for Rapid Detection of Burkholderia mallei and Burkholderia pseudomallei

A PCR procedure for the discrimination of Burkholderia mallei and Burkholderia pseudomallei was developed. It is based on the nucleotide difference T 2143 C (T versus C at position 2143) between B. mallei and B. pseudomallei detected in the 23S rDNA sequences. In comparison with conventional methods the procedure allows more rapid identification at reduced risk for infection of laboratory personnel.     

Structural and Biological Diversity of Lipopolysaccharides from Burkholderia pseudomallei and Burkholderia thailandensis

Burkholderia pseudomallei, the etiological agent of melioidosis, is a facultative intracellular pathogen. As B. pseudomallei is a gram-negative bacterium, its outer membrane contains lipopolysaccharide (LPS) molecules, which have been shown to have low-level immunological activities in vitro. In this study, the biological activities of B. pseudomallei LPS were compared to those of Burkholderia thailandensis LPS, and it was found that both murine and human macrophages produced levels of tumor necrosis factor alpha, interleukin-6 (IL-6), and IL-10 in response to B. pseudomallei LPS that were lower than those in response to B. thailandensis LPS in vitro. In order to elucidate the molecular mechanisms underlying the low-level immunological activities of B. pseudomallei LPS, its lipid A moiety was characterized using mass spectrometry. The major lipid A species identified in B. pseudomallei consists of a biphosphorylated disaccharide backbone, which is modified with 4-amino-4-deoxy-arabinose (Ara4N) at both phosphates and penta-acylated with fatty acids (FA) C_14:0(3-OH), C_16:0(3-OH), and either C_14:0 or C_14:0(2-OH). In contrast, the major lipid A species identified in B. thailandensis was a mixture of tetra- and penta-acylated structures with differing amounts of Ara4N and FA C_14:0(3-OH). Lipid A species acylated with FA C_14:0(2-OH) were unique to B. pseudomallei and not found in B. thailandensis. Our data thus indicate that B. pseudomallei synthesizes lipid A species with long-chain FA C_14:0(2-OH) and Ara4N-modified phosphate groups, allowing it to evade innate immune recognition.Burkholderia pseudomallei is the etiological agent of melioidosis, a bacterial disease endemic in certain tropical regions, especially in Southeast Asia and northern Australia (9, 11, 12, 13), but with an expanding geographical distribution (10, 23, 43). Infection results in a spectrum of clinical syndromes, ranging from chronic abscesses to acute septicemia (28). Despite the availability of intensive treatment with appropriate antibiotics (57), the fatality rates in countries in which the disease is endemic remain high and recurrence of infection is common (27). In Singapore, the mortality rates average 23.7% (33), although this rate can be as high as 46.5% (30, 34).Lipopolysaccharide (LPS) is an outer membrane molecule of gram-negative bacteria and is the most common bacterial component that is implicated in initiating sepsis (3). Structurally, LPS is composed of an outer O-antigen-specific polysaccharide and an inner core oligosaccharide that is covalently linked to a lipophilic moiety termed lipid A. Lipid A has been described as being responsible for the endotoxic activity associated with LPS (32, 42). Recognition of LPS by the innate immune system triggers the production of proinflammatory cytokines by host cells, which aids in the clearance of the pathogen (56). However, overstimulation of host cells by LPS can lead to sepsis (29). Sepsis is a major cause of death in patients with melioidosis, which accounts for almost 20% of all community-acquired septicemias in northeastern Thailand (7). The LPS of B. pseudomallei has been implicated in its pathogenesis, as high concentrations of antibodies to LPS are associated with improved survival in severe melioidosis (8, 21). The use of LPSs as subunit vaccines was protective in a murine model of experimental melioidosis (38).Despite its apparent role in sepsis, the LPS of B. pseudomallei has been shown to have low-level macrophage-activating activity in vitro, which was attributed to a delay in nitric oxide and tumor necrosis factor alpha (TNF-α) production (31, 51, 52), thus enabling the pathogen to evade macrophage killing. As lipid A is the endotoxic center of LPS (32), elucidation of the primary structure of lipid A may shed light on the molecular basis of the low-level immunological activities associated with B. pseudomallei LPS (31, 44, 51). In this report, the ability of LPS from B. pseudomallei to activate macrophages was compared to this ability of LPS from Burkholderia thailandensis, a close relative of B. pseudomallei that rarely causes disease in humans (16, 47). In addition, by using a combination of chemical and mass-spectrometric methods, the structures of lipid A from the two pathogens were compared. Collectively, our results provide insight into the mechanisms of B. pseudomallei virulence.     

Cloning and characterisation of malE in Burkholderia pseudomallei

No recombinant protein is available for serodiagnosis or skin test in the diagnosis of melioidosis. This report describes the cloning of the malE gene, which encodes an immunogenic protein of Burkholderia pseudomallei. Bi-directional DNA sequencing of malE revealed that the gene contained a single open reading frame encoding 416 amino acid residues with a predicted molecular mass of 44.4 kDa. BLAST analysis showed that the putative protein encoded by malE is homologous to the maltose-binding protein (MBP) of other bacteria. It has 48% and 63% amino acid identity and similarity with the MBP of Brucella abortus, and malE complementation assay showed that it partially complemented the function of the MBP of Escherichia coli. Several highly conserved regions among the MBP of B. pseudomallei, Br. abortus, Salmonella enterica serotype Typhimurium, E. coli and Enterobacter aerogenes were observed. These regions represent signatures A, B, C, D and F identified in the MBP of E. coli. Further sequence analysis revealed that the first 24 amino acid residues of the MBP of B. pseudomallei probably represent the N-terminal signal peptide of the protein. Similar to the signal peptide of the MBP of E. coli, Ent. aerogenes and S. Typhimurium, the MBP of B. pseudomallei contains two basic residues in the first eight amino acids, followed by a hydrophobic core, with the last three amino acids in the signal peptide being Ala-Gln-Ala, conforming to the consensus sequence Ala-X-Ala at positions -3 to -1 relative to the site of proteolytic cleavage for recognition by signal peptidase I. Further studies on serodiagnosis of melioidosis with recombinant MBP should be performed.     

Flagella are virulence determinants of Burkholderia pseudomallei

Burkholderia pseudomallei, a facultatively intracellular pathogen, is a flagellated and motile gram-negative bacterium and is the causative agent of melioidosis in humans. Flagella are commonly recognized as important virulence determinants expressed by bacterial pathogens since the motility phenotype imparted by these organelles often correlates with the ability of an organism to cause disease. We used a virulent isolate of B. pseudomallei, KHW, to construct an isogenic deletion mutant with a mutation in the flagellin gene (fliC) by gene replacement transposon mutagenesis. The KHWDeltafliCKm mutant was aflagellate and nonmotile in semisolid agar. The isogenic KHWDeltafliCKm mutant was not impaired in terms of the ability to invade and replicate in cultured human lung cells compared with the wild type. It was also equally virulent in slow-killing assays involving Caenorhabditis elegans, but it was avirulent during intranasal infection of BALB/c mice. Very few bacteria, if any, were isolated from the lungs and spleens of KHWDeltafliCKm-infected mice. In contrast, the bacterial loads in the lungs and spleens were similar in mice infected with KHW and in mice infected with the complemented mutant, KHWDeltafliCKm/pUCP28TfliC. Unlike the Syrian hamster or diabetic rat models of infection, the B. pseudomallei flagellin was also a virulence factor during intraperitoneal infection of BALB/c mice. In this study, all animals infected with KHWDeltafliCKm remained healthy and did not succumb to disease regardless of the route of infection. The flagellum is therefore an important and necessary virulence determinant of B. pseudomallei during intranasal and intraperitoneal infection of mice.     

Comparison of biotyping, ribotyping, and pulsed-field gel electrophoresis for investigation of a common-source outbreak of Burkholderia pickettii bacteremia.

Over a 3-month period, six immunocompromised patients developed one or more episodes of Burkholderia pickettii bacteremia and/or catheter infection. Vials of a commercially available, "sterile" saline for injection which had been used for flushing the patients' indwelling intravenous devices were implicated as the common source of the organisms. No further cases were diagnosed once the use of this saline was discontinued. Twenty-six isolates, including 9 outbreak-related strains from case patients and contaminated saline as well as 17 control strains, were tested comparatively by biotyping, ribotyping with EcoRI and HindIII, and pulsed-field gel electrophoresis (PFGE) with SpeI. Macrorestriction analysis revealed nine PFGE groups and was more discriminating than ribotyping (seven ribotypes) and biotyping (two biovars). Among the outbreak-related isolates, one B. pickettii type was found by the three typing methods. Furthermore, PFGE was useful for subdividing ribotypes and for distinguishing isolates involved in the outbreak from all epidemiologically unrelated strains.     

Functional Characterization of Burkholderia pseudomallei Trimeric Autotransporters

Burkholderia pseudomallei is a tier 1 select agent and the causative agent of melioidosis, a severe and often fatal disease with symptoms ranging from acute pneumonia and septic shock to a chronic infection characterized by abscess formation in the lungs, liver, and spleen. Autotransporters (ATs) are exoproteins belonging to the type V secretion system family, with many playing roles in pathogenesis. The genome of B. pseudomallei strain 1026b encodes nine putative trimeric AT proteins, of which only four have been described. Using a bioinformatic approach, we annotated putative domains within each trimeric AT protein, excluding the well-studied BimA protein, and found short repeated sequences unique to Burkholderia species, as well as an unexpectedly large proportion of ATs with extended signal peptide regions (ESPRs). To characterize the role of trimeric ATs in pathogenesis, we constructed disruption or deletion mutations in each of eight AT-encoding genes and evaluated the resulting strains for adherence to, invasion of, and plaque formation in A549 cells. The majority of the ATs (and/or the proteins encoded downstream) contributed to adherence to and efficient invasion of A549 cells. Using a BALB/c mouse model of infection, we determined the contributions of each AT to bacterial burdens in the lungs, liver, and spleen. At 48 h postinoculation, only one strain, Bp340::pDbpaC, demonstrated a defect in dissemination and/or survival in the liver, indicating that BpaC is required for wild-type virulence in this model.     

Exploitation of host cells by Burkholderia pseudomallei

Intracellular bacterial pathogens have evolved mechanisms to enter and exit eukaryotic cells using the power of actin polymerisation and to subvert the activity of cellular enzymes and signal transduction pathways. The proteins deployed by bacteria to subvert cellular processes often mimic eukaryotic proteins in their structure or function. Studies on the exploitation of host cells by the facultative intracellular pathogen Burkholderia pseudomallei are providing novel insights into the pathogenesis of melioidosis, a serious invasive disease of animals and humans that is endemic in tropical and subtropical areas. B. pseudomallei can invade epithelial cells, survive and proliferate inside phagocytes, escape from endocytic vesicles, form actin-based membrane protrusions and induce host cell fusion. Here we review current understanding of the molecular mechanisms underlying these processes.