Antifolate screening using yeast expressing Plasmodium vivax dihydrofolate reductase and in vitro drug susceptibility assay for Plasmodium falciparum

The presence of homologous point mutations in the dhfr gene in Plasmodium vivax and Plasmodium falciparum is associated with resistance to antifolate drugs. The spread of antifolate resistance encouraged research for novel antifolate drugs active against both wild-type and dhfr-mutant strains of malaria parasites. Because P. vivax cannot be easily maintained in culture, we transformed a Saccharomyces cerevisiae DHFR-deleted mutant to express wild-type P. vivax dhfr gene and its mutant forms. Twenty-five dicyclic and tricyclic 2,4-diaminopyrimidine derivatives were screened. Six quinazoline compounds showed selective inhibition of yeast transformants expressing P. vivax dhfr genes. The 50% inhibitory concentration (IC(50)) of these six compounds was determined against field isolates of P. falciparum. Our results suggest that a close relationship between the yeast assay based on expression of P. vivax dhfr genes and the in vitro test using P. falciparum parasites in culture is a promising initial step for drug screening.     

Repetitive sequences upstream of the pfg27/25 gene determine polymorphism in laboratory and natural lines of Plasmodium falciparum

The structure of the genomic region located upstream of the gametocyte-specific gene pfg27/25 of Plasmodium falciparum was analysed in laboratory lines and field isolates of the parasite. The gene is located in a subtelomeric region of chromosome 13 in parasite clones 3D7 and HB3. Analysis of laboratory lines and field isolates of P. falciparum indicated that polymorphism upstream of pfg27/25 is mainly due to the structure of a repetitive DNA region located at about half a kilobase from the pfg27/25 coding sequence. Different types of repetitive sequences are present in this region, whose copy number is variable in different parasite lines. In addition a GC-rich sequence element contained in this region, which is proposed to be the startpoint of pfg27/25 mRNA, presents either a direct or a reverse orientation in different parasite lines. Genomic deletions upstream of the pfg27/25 gene are also described in two laboratory lines of the parasite, which eliminate two newly identified malaria genes. orf P and orf Gap, from the genome of these parasites. One of them, orf Gap, deleted from the reference parasite clone 3D7, is abundantly expressed as mature mRNA in asexual parasites. PCR analysis on 64 field isolates of P. falciparum indicated that orf P and orf Gap sequences are present in all tested samples of naturally propagating parasites.     

The 3D7var5.2 (var COMMON) type var gene family is commonly expressed in non-placental Plasmodium falciparum malaria

Relapse variants in chronic Plasmodium falciparum infections are antigenically distinct from the parental parasites. The variable antigen PfEMP1 expressed at the surface of the infected erythrocyte (IE) is encoded by the var gene family with approximately 60 copies per haploid genome. Placental isolates commonly express DBLgamma containing subtypes of var genes with homology to either 3D7var5.2 (var(COMMON)) or FCR3var(CSA). Here we report that var(COMMON) related genes are constitutively transcribed in approximately 60% of malaria infected children in Gabon. var(COMMON) is conserved in field isolates over at least 2.1kb. In 3D7 parasites var(COMMON) is present on chromosome 5 (var5.2) and constitutively transcribed in the opposite direction to most other var genes. It lacks a regulatory intron, an acidic terminal segment and ends in telomeric repeat sequences. var(COMMON) encodes a large, hypothetical PfEMP1 of a structure similar to previous placenta-binding PfEMP1s but it is not present at the IE-surface. IE of a 3D7 clone (3D7S8) transcribe var(COMMON) but express a PfEMP1 distinct from var(COMMON) at the surface and adhere to placental tissues through var(COMMON) independent novel mechanisms. Our report suggests that expression of var(COMMON) type genes is not restricted to placental malaria.     

Metabolic control analysis of glycolysis in trypanosomes as an approach to improve selectivity and effectiveness of drugs

The determinant of chloroquine resistance (CQR) in a Plasmodium falciparum cross was previously mapped by linkage analysis to a 36 kb segment of chromosome 7. Candidate genes within this segment have been previously shown to include two genes, cg2 and cg1, that have complex polymorphisms linked to the CQR phenotype. Using DNA transfection and allelic exchange, we have replaced these polymorphisms in CQR parasites with cg2 and cg1 sequences from chloroquine sensitive parasites. Drug assays of the allelically-modified lines show no change in the degree of CQR, providing evidence against the hypothesis that these polymorphisms are important to the CQR phenotype. Similarly, no change was found in the degree to which verapamil or other chloroquine sensitizers reverse CQR in the transformants. These results and the high though not complete degree of association of CQR with cg2 and cg1 polymorphisms in field isolates suggest involvement of another nearby gene in the P. falciparum CQR mechanism.     

Reporter gene expression in cell culture stages and oocysts of <Emphasis Type="Italic">Eimeria nieschulzi</Emphasis> (Coccidia,Apicomplexa)

The rat parasite Eimeria nieschulzi is a suitable model for transfection studies and was used as an additional model organism for the genus Eimeria. We describe the transfection of this apicomplexan parasites and the cultivation of transformed stages in cell culture and in vivo. The beta-galactosidase or yellow fluorescent protein was expressed in all parasitic stages up to the second merozoite generation in vitro under control of the heterologous promoter region of Eimeria tenella mic1 gene previously described for E. tenella transfection. Pyrimethamine resistant E. nieschulzi parasites were obtained in vitro after transfection with a plasmid encoding the Toxoplasma gondii dhfr/ts-m2m3 gene. Co-transfection experiments with an YFP-plasmid resulted in pyrimethamine resistant and fluorescent parasitic stages. Infection of rats with transfected E. nieschulzi sporozoites directed to expression of beta-galactosidase or YFP in oocysts. Co-transfection with YFP/DHFR-TS allowed selection of resistant parasites in vivo. Excreted transgenic oocysts showed arrangement of YFP expression which lead to questions about meiotic recombination frequency and mechanisms.     

Gene targeting in the rodent malaria parasite Plasmodium yoelii

It is anticipated that the sequencing of Plasmodium falciparum genome will soon be completed. Rodent models of malaria infection and stable transformation systems provide powerful means of using this information to study gene function in vivo. To date, gene targeting has only been developed for one rodent malaria species, Plasmodium berghei. Another rodent species, Plasmodium yoelii, however, is favored to study the mechanisms of protective immunity to the pre-erythrocytic stages of infection and vaccine development. In addition, it offers the opportunity to investigate unique aspects of pathogenesis of blood stage infection. Here, we report on the stable transfection and gene targeting of P. yoelii. Purified late blood stage schizonts were used as targets for electroporation with a plasmid that contains a pyrimethamine-resistant form of the P. berghei dihydrofolate reductase-thymidylate synthase (Pbdhfr-ts) fused to green fluorescent protein (gfp) gene. After drug selection, fluorescent parasites contained intact, non-rearranged plasmids that remain stable under drug-pressure. In addition, we used another dhfr-ts/gfp based plasmid to disrupt the P. yoelii trap (thrombospondin-related anonymous protein) locus by site-specific integration. The phenotype of P. yoelii TRAP knockout was identical to that previously reported for the P. berghei TRAP knockout. In the absence of TRAP, the erythrocytic cycle, gametocyte and oocyst development of the mutant parasites were indistinguishable from wild type (WT). Although the sporozoites appeared morphologically normal, they failed to glide and to invade the salivary glands of mosquitoes.     

Novel alleles of the Plasmodium falciparum dhfr highly resistant to pyrimethamine and chlorcycloguanil, but not WR99210

We have expressed dhfr alleles of Plasmodium falciparum in the budding yeast, Saccharomyces cerevisiae, and used this yeast model to identify single amino acid substitutions that confer high level pyrimethamine resistance on the background of the triple mutant dhfr (I51+R59+N108). Mutations in three clusters were identified: codons 50-57, 187-193, and 213-214. Several mutations previously identified in field samples were also isolated, including codons 50 and 164. The I164L mutation is of particular interest, because the quadruple mutant genotype (N51I+C59R+S108N+I164L) encodes an enzyme that is no longer inhibited by pyrimethamine, rendering sulfadoxine/pyrimethamine (SP; Fansidar) clinically ineffective. Thirty-six novel alleles were tested to determine their sensitivity to chlorcycloguanil and WR99210, two DHFR inhibitors that are in clinical and pre-clinical development, respectively. Chlorcycloguanil is effective against parasites that carry the triple mutant allele, but in vitro analysis has suggested that chlorcycloguanil will be clinically ineffective against parasites that carry the quadruple mutant allele of dhfr. In our screen, 23 of 36 novel strains were as resistant to chlorcycloguanil as the quadruple mutant, and one strain was 10-fold more resistant. WR99210 is still effective in the nM range against parasites that carry the quadruple mutant allele. In the preliminary screen, 31 of 36 novel alleles were as sensitive to WR99210 as the quadruple mutant. Detailed analysis of the remaining five showed that four of the five had IC(50) values in the same range as the quadruple mutant, and one, N51I+C59R+S108N+E192G, had an IC(50) value about fivefold higher. This result suggests that WR99210 and related compounds will be clinically effective against quadruple mutants currently found in Southeast Asia and South America and against most novel alleles that could be selected on the background of the triple mutant genotype now prevalent in East Africa.     

3' UTR signals necessary for expression of the Plasmodium gallinaceum ookinete protein, Pgs28, share similarities with those of yeast and plants

During metazoan development, 3' UTR signals mediate the time and place of gene expression. For protozoan Plasmodium parasites, the formation of ookinetes from gametes in the mosquito midgut is an analogous developmental process. Previous studies of the 3' UTR signals necessary for expression of Pgs28, the major surface protein of Plasmodium gallinaceum ookinetes, suggested that a 3' UTR T-rich region and DNA sequences containing an ATTAAA eukaryotic polyadenylation consensus motif were necessary for its expression. During metazoan development, U-rich elements may function in conjunction with eukaryotic polyadenylation consensus signals to mediate developmental protein expression. To define whether the putative Plasmodium elements were mediators of Pgs28 expression mutations of these nucleotide sequences were made in plasmid constructs. The effect of the mutations on Pgs28 expression was tested by the transient gene transfection of sexual stage P. gallinaceum parasites. These studies reveal that two different mutations of the ATTAAA motif, which alter gene expression in higher eukaryotes and yeast, do not alter the expression of Pgs28. However, the U-rich element, adjacent nucleotides UUUACAAAAUUGUUUUAACU and downstream nucleotides UAUAUAAAA are able to mediate expression to varying degrees. The organization and overlapping function of these elements appears to more closely resemble that of yeasts or plants than those of metazoans.     

Linkage group selection: rapid gene discovery in malaria parasites

The identification of parasite genes controlling phenotypes such as drug resistance, virulence, immunogenicity, and transmission is vital to malaria research. Classical genetic methods have achieved these goals only rarely and with difficulty. We describe here a novel genetic method, Linkage Group Selection (LGS), which achieves rapid de novo location of genes encoding selectable phenotypes of malaria parasites. A phenotype-specific selection pressure is applied to the uncloned progeny of a genetic cross between two malaria parasites that differ in the relevant phenotype. Selected and unselected progeny are analyzed using genome-wide quantitative genetic markers. Markers of the "sensitive" parent, which are reduced after selection, are sequenced and located in genomic databases. They are expected to be closely linked to gene(s) determining the phenotype under selection. We have validated LGS with the rodent malaria parasite Plasmodium chabaudi chabaudi using a phenotype, pyrimethamine resistance, whose controlling gene, that encoding dihydrofolate reductase (dhfr), is known. We show that molecular markers closely linked to dhfr, and only those linked to this gene, were reduced or removed by pyrimethamine treatment in accordance with the expectations of LGS.     

The selectable marker human dihydrofolate reductase enables sequential genetic manipulation of the Plasmodium berghei genome

Genetic transformation of malaria parasites has been limited by the number of selectable markers available. For the rodent malaria parasite, Plasmodium berghei, only a single selection marker has been at hand, utilising the dihydrofolate reductase-thymidylate synthase gene from either P. berghei or Toxoplasma gondii to confer resistance to the anti-malarial drug pyrimethamine. Here we report the use of the human dihydrofolate reductase (hDHFR) gene as a new selectable marker, which confers resistance to the antifolate inhibitor WR99210 upon both pyrimethamine sensitive and resistant isolates of P. berghei. Transfection with circular constructs containing the hDHFR gene resulted in the generation of highly resistant parasites containing multiple copies of episomally-maintained plasmids. These parasites showed around a 1000-fold increase in resistance to WR99210 compared to the parental parasites. We were also able to generate and select transgenic parasites harbouring only a single copy of hDHFR targeted into their genome, despite the fact that these parasites showed only a fivefold increase in resistance to WR99210 compared to the parental parasites. Importantly, and for the first time with malaria parasites, the hDHFR gene could be used in conjunction with the existing pyrimethamine selectable markers. This was demonstrated by reintroducing the circumsporozoite (CS) gene into transgenic CS-knockout mutant parasites that contained the P. berghei DHFR-TS selectable marker. The development of hDHFR as a second selectable marker will greatly expand the use of transformation technology in Plasmodium, enabling more extensive genetic manipulation and thus facilitating more comprehensive studies on the biology of the malaria parasite.     

Expression of an immediate early polypeptide and activation of a viral origin of DNA replication in cells containing a fragment of herpes simplex virus DNA

A thymidine kinase cotransformation procedure has been used to introduce the sequences encoding the herpes simplex virus type 1 (HSV-1) immediate early protein, Vmw175, into permissive cells either in the presence or the absence of the adjacent origin of viral DNA replication. Cells transformed by either origin-plus or origin-minus DNA were capable of expressing functional Vmw175 as indicated by their ability to complement the growth at the nonpermissive temperature of an HSV-1 mutant, ts K, containing a temperature-sensitive lesion in the Vmw175 gene. A proportion of the virus yield from cells transformed with the origin-plus, but not the origin-minus, plasmid exhibited a ts+ phenotype. The generation of ts+ virus correlated with an amplification of input plasmid DNA sequences which occurred following superinfection, suggesting that recombination between the ts mutant and the amplified viral DNA sequences had taken place. Encapsidation of the amplified DNA sequences was also detected, suggesting that in addition to a functional origin of replication and Vmw175 gene the transformed cells also retain the viral DNA packaging signals.     

Pyrosequencing, a high-throughput method for detecting single nucleotide polymorphisms in the dihydrofolate reductase and dihydropteroate synthetase genes of Plasmodium falciparum

A pyrosequencing protocol was developed as a rapid and reliable method to identify the mutations of the dhfr and dhps genes of Plasmodium falciparum that are associated with antifolate resistance. The accuracy and specificity of this method were tested using six laboratory-cultured P. falciparum isolates harboring known single nucleotide polymorphisms (SNPs) in the genes dhfr (codons 50, 51, 59, 108, and 164) and dhps (codons 436, 437, 540, 581, and 613). The lowest threshold for detection of all the SNPs tested by pyrosequencing was the equivalent of two to four parasite genomes. Also, this method was highly specific for P. falciparum, as it did not amplify any DNA products from the other species of human malaria parasites. We also mixed wild-type and mutant-type parasite DNAs in various proportions to determine how pyrosequencing, restriction fragment length polymorphism (RFLP), and direct conventional sequencing (for dhfr) compared with each other in detecting different SNPs in the mixture. In general, pyrosequencing and RFLP showed comparable sensitivities in detecting most of the SNPs in dhfr except for the 164L mutation, which required at least twice the amount of DNA for pyroseqencing as for RFLP. For detecting SNPs in dhps, pyrosequencing was slightly more sensitive than RFLP and direct sequencing. Overall, pyrosequencing was faster and less expensive than either RFLP or direct sequencing. Thus, pyrosequencing is a practical alternative method that can be used in a high-throughput format for molecular surveillance of antimalarial-drug resistance.     

Complementation of Plasmodium berghei TRAP knockout parasites using human dihydrofolate reductase gene as a selectable marker

Previously we have used the Plasmodium dihydrofolate reductase thymidylate synthase (DHFR-TS) selectable marker to generate Plasmodium berghei TRAP null mutant parasites. These TRAP null mutants do not glide and they showed a great reduction in their ability to infect mosquito salivary glands and the hepatocytes of the vertebrate host. Thus far, complementation of these knockout parasites was not possible due to the lack of additional selectable markers. Recently, a new selectable marker, based on the human dihydrofolate reductase (hDHFR) gene, has been developed which confers resistance to the antifolate drug WR99210. This drug has been found to be highly active against pyrimethamine-sensitive and -resistant strains of P. berghei. In this study, we have used the hDHFR gene as a second selectable marker for the complementation of P. berghei TRAP null mutant parasites. Restoration of the TRAP null mutant parasites to the wild-type phenotype was achieved in this study via autonomously replicating episomes bearing a wild-type copy of the TRAP gene. This is the first report of complementation of a mutant phenotype in malaria parasites.     

An amino acid substitution in the Babesia bovis dihydrofolate reductase-thymidylate synthase gene is correlated to cross-resistance against pyrimethamine and WR99210

The genomic locus and cDNA encoding Babesia bovis dihydrofolate reductase-thymidylate synthase (DHFR-TS) were cloned and sequenced. A single dhfr-ts gene, composed of four exons, encodes a 511 aa protein that is most closely related to Plasmodium falciparum DHFR-TS. The genomic locus is characterized by the presence of four other genes of which at least three are expressed during the erythrocytic cycle. Three of the genes were highly conserved in closely related Theileria species and for two of the genes and dhfr-ts, gene synteny was observed between B. bovis and Theileria parva, B. bovis in vitro cultures displaying approximately 10-20-fold decreased sensitivity towards the antimalarial drugs WR99210 and pyrimethamine were selected repeatedly after prolonged growth in presence of drugs. Five cultures examined in detail were shown to encode a DHFR-TS carrying amino acid substitution S125F. Three-dimensional-modelling, using the P. falciparum DHFR structure as a template, suggests that substitution S125F protrudes into the binding site of NADPH. The S125F mutant could be isolated by growth under pyrimethamine or WR99210 pressure conferring cross-resistance to both drugs. Although opposing selection for pyrimethamine or WR99210 resistance was reported recently using P. falciparum or P. vivax strains carrying wildtype dhfr, the results obtained here are reminiscent of a quadruple mutant of P. falciparum dhfr displaying strong resistance to pyrimethamine and 10-fold enhanced resistance against WR99210. Wildtype B. bovis DHFR carries three mutations present in this mutant possibly explaining the low sensitivity to pyrimethamine and the ease by which moderately WR99210 resistant mutants could be isolated.     

Expansion of experimental genetics approaches for Plasmodium berghei with versatile transfection vectors

Experimental reverse genetic approaches have proven powerful in the study of the biology of the malaria parasite. The murine malaria model parasite Plasmodium berghei is the genetically most amendable Plasmodium species and allows full access to the entire life cycle in vivo. Here, we describe a next-generation, highly versatile transfection vector set that facilitates advancing experimental genetic strategies towards a genome-wide scale. Through 36 consecutive cloning and 17 subcloning steps an optimized vector set was generated from the standard transfection plasmid. These targeting vectors, collectively referred to as the Berghei Adaptable Transfection (pBAT) plasmids, contain key elements that permit recycling of the drug-selectable cassette, robust green fluorescent labelling of recombinant parasites, carboxy-terminal tagging of target proteins with a red fluorescent-epitope tag fusion, and expression of heterologous genes. The vectors were further optimized for small size, versatile restriction endonuclease recognition sites and potential exchange of individual vector elements. We show that stable integration into a transgene expression site, an intergenic locus at a synteny breakpoint on P. berghei chromosome 6, is phenotypically silent and generated a bright green fluorescent parasite line for imaging applications. We provide an example, P. berghei actin 2, for targeted gene deletion and illustrate that the positive selection marker can be recycled, thereby permitting multiple rounds of genetic manipulations. We propose that the vectors described herein will greatly facilitate functional assignment to predicted and orphan Plasmodium gene models by multiple experimental genetics approaches.     

Chromosomal rearrangements involving telomeric DNA sequences in Balb/3T3 cells transfected with the Ha-ras oncogene.

Chromosomal instability involving telomeric DNA sequences was studied in mouse Balb/3T3 fibroblasts transfected with a mutated human c-Ha-ras-1 gene (B61 cells) and spontaneously immortalized normal parental cells (A31 cells), using fluorescence in situ hybridization (FISH). FISH analysis with a telomeric probe revealed high frequencies of chromosome alterations involving telomeric regions, mainly stable and unstable Robertsonian fusion-like configurations (RLC) (0.25 and 1.95/cell in A31 and B61 cells, respectively) and chromosome ends lacking telomeric signals in one (LTS') or both chromatids (LTS") (5.9 and 17.5/cell for A31 and B61 cells, respectively). Interstitial telomeric sequences (ITS) were also detected at both non-telomeric sites and in the centromeres of RLC. The frequencies of RLCs with ITS located in the centromeres were 3-fold higher in B61 compared with A31 cells. We demonstrated a high level of chromosome instability involving telomeric DNA sequences in ras-transfected cells overexpressing ras mRNA, which could be a consequence of rapid cell cycle progression associated with a deficient telomere capping mechanism.     

A high-coverage artificial chromosome library for the genome-wide screening of drug-resistance genes in malaria parasites

The global spread of drug-resistant parasites is a serious problem for the treatment of malaria. Although identifying drug-resistance genes is crucial for the efforts against resistant parasites, an effective approach has not yet been developed. Here, we report a robust method for identifying resistance genes from parasites by using a Plasmodium artificial chromosome (PAC). Large genomic DNA fragments (10-50 kb) from the drug-resistant rodent malaria parasite Plasmodium berghei were ligated into the PAC and directly introduced into the drug-sensitive (i.e., wild-type) parasite by electroporation, resulting in a PAC library that encompassed the whole genomic sequence of the parasite. Subsequently, the transformed parasites that acquired resistance were selected by screening with the drug, and the resistance gene in the PAC was successfully identified. Furthermore, the drug-resistance gene was identified from a PAC library that was made from the pyrimethamine-resistant parasite Plasmodium chabaudi, further demonstrating the utility of our method. This method will promote the identification of resistance genes and contribute to the global fight against drug-resistant parasites.