共查询到20条相似文献,搜索用时 15 毫秒
1.
Tougou K Fukuda T Ito T Yamazaki H Fujio Y Azuma J 《Drug metabolism and pharmacokinetics》2007,22(2):125-128
In the present study, we identified three novel single nucleotide polymorphisms (SNPs), 147C>T in exon 2 (silent), 602G>C in exon 3 (Arg201Pro), and 1134C>T in exon 4 (silent), in the gene of bile acid CoA: amino acid N-acyltransferase (BAAT) by resequencing the entire coding region and the exon-intron junctions of 100 Japanese individuals. The allelic frequencies were 0.005 for 147C>T, 0.095 for 602G>C, and 0.015 for 1134C>T. The two known SNPs, 59G>A (Arg20Gln, rs1572983) and UTR1513G>A (rs2229594), were detected at a frequency of 0.500 and 0.425, respectively. In the haplotype analysis for the 59G>A and 602G>C polymorphisms, the allelic frequency of 59G-602G, 59G-602C, 59A-602G and 59A-602C was 0.405, 0.095, 0.500 and 0.000, respectively. On the other hand, the allelic frequency of the nonsynonymous SNP 602G>C was 0.194 in a Caucasian population. 相似文献
2.
Sasaki T Goto E Konno Y Hiratsuka M Mizugaki M 《Drug metabolism and pharmacokinetics》2006,21(4):332-336
In this study, the entire coding sequence and the exon-intron junctions of the thiopurine S-methyltransferase (TPMT) gene from 200 Japanese individuals were screened for mutation. Three novel single nucleotide polymorphisms (SNPs) were identified-106G>A in exon 3 (Gly36Ser, *20 allele), 967A>G in 3'-untranslated region, and -87C>T in intron 8. The allele frequencies were 0.003 for 106G>A, 0.003 for 967A>G, and 0.010 for IVS8 -87C>T. In addition, the three known SNPs, 474T>C (Ile158Ile), 719A>G (Tyr240Cys, *3C allele), and IVS4 +35C>T were detected at frequencies of 0.299, 0.010, and 0.421, respectively. 相似文献
3.
Sortica Vde A Ojopi EB Genro JP Callegari-Jacques S Ribeiro-Dos-Santos A de Moraes MO Romano-Silva MA Pena SD Suarez-Kurtz G Hutz MH 《Basic & clinical pharmacology & toxicology》2012,110(5):460-468
The frequency distribution of SNPs and haplotypes in the ABCB1, SLCO1B1 and SLCO1B3 genes varies largely among continental populations. This variation can lead to biases in pharmacogenetic studies conducted in admixed populations such as those from Brazil and other Latin American countries. The aim of this study was to evaluate the influence of self-reported colour, geographical origin and genomic ancestry on distributions of the ABCB1, SLCO1B1 and SLCO1B3 polymorphisms and derived haplotypes in admixed Brazilian populations. A total of 1039 healthy adults from the north, north-east, south-east and south of Brazil were recruited for this investigation. The c.388A>G (rs2306283), c.463C>A (rs11045819) and c.521T>C (rs4149056) SNPs in the SLCO1B1 gene and c.334T>G (rs4149117) and c.699G>A (rs7311358) SNPs in the SLCO1B3 gene were determined by Taqman 5'-nuclease assays. The ABCB1 c.1236C>T (rs1128503), c.2677G>T/A (rs2032582) and c.3435C>T (rs1045642) polymorphisms were genotyped using a previously described single-base extension/termination method. The results showed that genotype and haplotype distributions are highly variable among populations of the same self-reported colour and geographical region. However, genomic ancestry showed that these associations are better explained by a continuous variable. The influence of ancestry on the distribution of alleles and haplotype frequencies was more evident in variants with large differences in allele frequencies between European and African populations. Design and interpretation of pharmacogenetic studies using these transporter genes should include genomic controls to avoid spurious conclusions based on improper matching of study cohorts from Brazilian populations and other highly admixed populations. 相似文献
4.
Hayashi H Fujimaki C Inoue K Suzuki T Itoh K 《Biological & pharmaceutical bulletin》2007,30(4):839-841
We investigated the genotype distribution and allele frequency of C452T polymorphism of gamma-glutamyl hydrolase (GGH) gene, which causes the decreased enzymatic activity affecting the efficacy of methotrexate (MTX), in a Japanese population. The polymerase chain reaction-restriction fragment length polymorphism assay was applied to determine the genotype of C452T polymorphism in 269 Japanese healthy individuals. The genotype distribution was as follows: C/C, 89.2% (n=240); C/T, 10.4% (n=28); T/T, 0.4% (n=1). The frequency of C and T allele was 0.944 and 0.056, respectively. The obtained genotype distribution was well agreed with those expected by Hardy-Weinberg equilibrium. The genotype distribution and allele frequency in a Japanese population were found to be similar to those of African-Americans but significantly different from Caucasians. Although the frequency of variant T allele in a Japanese population is not so high as compared to Caucasians, determination of C452T polymorphism of GGH may be useful for monitoring of efficacy and side-effects of MTX for treatment of diseases such as rheumatoid arthritis or childhood acute leukemia. To our knowledge, this is the first report about the examination of C452T polymorphism of GGH in a Japanese population. 相似文献
5.
The aim of this study was to investigate the impact of genetic polymorphisms in the metabolic and cellular transport pathway of methotrexate (MTX) on the clinical outcome of MTX monotherapy in Japanese rheumatoid arthritis (RA) patients. Fifty-five patients were treated with MTX monotherapy at a dose of 4-10 mg/week. The total concentration of MTX-polyglutamates (MTX-PGs) was measured at steady-state in red blood cells (RBCs) by high performance liquid chromatography. The genotype at 16 polymorphic sites in 11 genes (ABCB1, ABCG2, ABCC2, RFC1, PCFT, SLCO1B1, MTHFR, GGH, ATIC, MTR, and MTRR) was analyzed. No significant association between the total concentration of MTX-PGs in RBCs and clinical outcome was found. However, patients with the ABCB1 3435TT genotype had a significantly lower mean disease activity score (DAS) 28 than did patients with the ABCB1 3435CC genotype (p = 0.02). Similarly, patients with the ABCB1 2677AA/AT/TT genotypes had a significantly lower mean DAS28 than did patients with the ABCB1 2677GG/GA/GT genotypes (p = 0.04). The patients with the MTHFR 1298AA genotype had a significantly lower mean DAS28 than those with the MTHFR 1298AC/CC genotypes (p = 0.04). In conclusion, the ABCB1 3435C>T, ABCB1 2677G>A/T, and MTHFR 1298A>C polymorphisms influenced the efficacy of MTX monotherapy. 相似文献
6.
Saeki M Saito Y Jinno H Sai K Hachisuka A Kaniwa N Ozawa S Kawamoto M Kamatani N Shirao K Minami H Ohtsu A Yoshida T Saijo N Komamura K Kotake T Morishita H Kamakura S Kitakaze M Tomoike H Sawada J 《Drug metabolism and pharmacokinetics》2005,20(2):144-151
Nineteen genetic variations, including 11 novel ones, were found in exon 1 and its flanking region of the UDP-glucuronosyltransferase (UGT) 1A4 gene from 256 Japanese subjects, consisting of 60 healthy volunteers, 88 cancer patients and 108 arrhythmic patients. These variations include -217T>G and -36G>A in the 5'-flanking region, 30G>A (P10P), 127delA (43fsX22; frame-shift from codon 43 resulting in the termination at the 22nd codon, codon 65), 175delG (59fsX6), 271C>T (R91C), 325A>G (R109G), and 357T>C (N119N) in exon 1, and IVS1+1G>T, IVS1+98A>G and IVS1+101G>T in the following intron. Among them, 127delA and 175delG can confer early termination of translation, resulting in an immature protein that probably lacks enzymatic activity. Variation IVS1+1G>T is located at a splice donor site and thus may lead to aberrant splicing. Since we did not find any significant differences in the frequencies of all the variations among the three subject groups, the data were analyzed as one group. The allele frequencies of the novel variations were 0.006 for IVS1+101G>T, 0.004 for 30G>A (P10P) and 357T>C (N119N), and 0.002 for the 8 other variations. In addition, the two known nonsynonymous single nucleotide polymorphisms (SNPs), 31C>T (R11W) and 142T>G (L48V), were found at 0.012 and 0.129 frequencies, respectively. The SNP 70C>A (P24T), mostly linked with 142T>G (L48V) in German Caucasians, was not detected in this study. Sixteen haplotypes were identified or inferred, and some haplotypes were confirmed by cloning and sequencing. It was shown that most of 142T>G (L48V) was linked with -219C>T, -163G>A, 448T>C (L150L), 804G>A (P268P), and IVS1+43C>T, comprising haplotype *3a; haplotype *4a harbors 31C>T (R11W); 127delA (43fsX22) and 142T>G (L48V) were linked (haplotype *5a); 175delG (59fsX6) was linked with 325A>G (R109G) (*6a haplotype); and -219C>T, -163G>A, 142T>G (L48V), 271C>T (R91C), 448T>C (L150L), 804G>A (P268P), and IVS1+43C>T comprised haplotype *7a. Our results provide fundamental and useful information for genotyping UGT1A4 in the Japanese and probably Asian populations. 相似文献
7.
Saito Y Yamamoto N Katori N Maekawa K Fukushima-Uesaka H Sugimoto D Kurose K Sai K Kaniwa N Sawada J Kunitoh H Ohe Y Yoshida T Matsumura Y Saijo N Okuda H Tamura T 《Drug metabolism and pharmacokinetics》2011,26(1):107-116
Cytochrome P450 oxidoreductase (POR) transfers electrons from NADPH to all microsomal cytochrome P450 (CYP) enzymes and is necessary for microsomal CYP activities. In this study, to find genetic variations and to elucidate the haplotype structures of POR, we comprehensively screened the genetic variations in the 5'-flanking region, all the exons and their flanking introns of POR for 235 Japanese subjects. Seventy-five genetic variations including 26 novel ones were found: 7 were in the 5'-flanking region, 2 in the 5'-untranslated region (5'-UTR, non-coding exon 1), 16 in the coding exons (10 nonsynonymous and 6 synonymous), 45 in the introns, 4 in the 3'-UTR and 1 in the 3'-flanking region. Of these, 4 novel nonsynonymous variations, 86C>T (T29M), 1648C>T (R550W), 1708C>T (R570C) and 1975G>A (A659T), were detected with allele frequencies of 0.002. We also detected known nonsynonymous SNPs 683C>T (P228L), 1237G>A (G413S), 1453G>A (A485T), 1508C>T (A503V), 1510G>A (G504R) and 1738G>C (E580Q) with frequencies of 0.002, 0.009, 0.002, 0.434, 0.002 and 0.002, respectively. Based on the linkage disequilibrium (LD) profiles, the analyzed region could be divided into two LD blocks. For Blocks 1 and 2, 14 and 46 haplotypes were inferred, respectively, and 2 and 6 common haplotypes found in more than 0.03 frequencies accounted for more than 81% of the inferred haplotypes. This study provides fundamental and useful information for the pharmacogenetic studies of drugs metabolized by CYPs in the Japanese population. 相似文献
8.
Genetic polymorphisms of UGT1A6 in a Japanese population 总被引:1,自引:0,他引:1
Saeki M Saito Y Jinno H Sai K Kaniwa N Ozawa S Komamura K Kotake T Morishita H Kamakura S Kitakaze M Tomoike H Shirao K Minami H Ohtsu A Yoshida T Saijo N Kamatani N Sawada J 《Drug metabolism and pharmacokinetics》2005,20(1):85-90
Thirteen single nucleotide polymorphisms (SNPs), including 6 novel ones, were found in exon 1 and its flanking region of UDP-glucuronosyltransferase (UGT) 1A6 from 195 Japanese subjects. Several novel SNPs were identified, including 269G>A (R90H), 279A>G (S93S), and 308C>A (S103X) in exon 1, and IVS1+109C>T, IVS1+120A>G, and IVS1+142C>T in the intron downstream of exon 1. Among these SNPs, 308C>A confers termination of translation at codon 103, resulting in the production of an immature protein that probably lacks enzymatic activity. The allele frequencies were 0.003 for all the 6 SNPs. In addition, the 3 known nonsynonymous SNPs were detected: 19T>G (S7A), 541A>G (T181A), and 552A>C (R184S) with frequencies of 0.226, 0.218, and 0.226, respectively. High linkage disequilibrium was observed among 19T>G (S7A), 315A>G (L105L), 541A>G (T181A), 552A>C (R184S), and IVS1+130G>T, as reported in Caucasian and African-American populations. Then, 11 haplotypes in UGT1A6 were estimated. The novel nonsynonymous variant, 269A or 308A, was shown to be located on the same DNA strand together with 19G, 315G, 541G, 552C, and IVS1+130T. Our results provide fundamental and useful information for genotyping UGT1A6 in the Japanese, and probably Asian populations. 相似文献
9.
Hanzawa Y Sasaki T Hiratsuka M Ishikawa M Mizugaki M 《Drug metabolism and pharmacokinetics》2007,22(2):136-140
We analyzed all nine exons and exon-intron junctions of the CYP2S1 gene in 200 Japanese individuals and identified the following three novel single nucleotide polymorphisms (SNPs): 4612G>A (Glu147Glu) in exon 3, 5478C>T (Leu230Leu) and 5479T>G (Leu230Arg, CYP2S1*5A) in exon 5. The allele frequencies were 0.013 for 4612G>A, 0.058 for 5478C>T, and 0.003 for 5479T>G. In addition, a known SNP 1324C>G (Pro74Pro) was detected at a frequency of 0.300. 相似文献
10.
Su Guan Min Huang Eli Chan Xiao Chen Wei Duan Shu-Feng Zhou 《European journal of pharmaceutical sciences》2006,29(1):14-21
Cytochrome P450 (CYP2B6) is an important enzyme that metabolizes more than eight compounds and about 3.0% of therapeutic drugs. The genetic polymorphisms of CYP2B6 have earlier been studied in Caucasian, Japanese and Korean, but the data are lacking for Han Chinese. The aim of this study was to investigate the frequencies of allelic variants of CYP2B6 in healthy Han Chinese and compare with those in other ethnic groups reported in the literature. Polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method was used to test the five common non-synonymous single nucleotide polymorphisms (SNPs) of CYP2B6 gene, namely, 64C>T, 516G>T, 777C>A, 785A>G and 1459C>T in unrelated healthy Han Chinese (n=193). The study demonstrated that the frequencies of 64C>T, 516G>T, 777C>A, 785A>G and 1459C>T SNPs in Han Chinese were 0.03, 0.21, 0, 0.28 and 0.003, respectively. The frequencies of all five SNPs tested in female were higher than those in male, but the statistical difference was insignificant (P>0.05). Compared to the data reported in the literature, the frequencies of common CYP2B6 allelic variants in Chinese are similar to those of other Asian populations including Japanese and Korean, but markedly different from those in Caucasians. These results indicate the presence of marked ethnic difference in CYP2B6 SNP frequencies between Chinese and Caucasian. Further studies are required to explore the impact of these SNPs of CYP2B6 gene on the clinical response (efficacy and toxicity) to drugs that are substrates for CYP2B6 in patients. 相似文献
11.
Pawlik A Dziedziejko V Kurzawski M Safranow K Kotrych D Bohatyrewicz A 《Pharmacological reports : PR》2012,64(1):185-190
Rheumatoid arthritis (RA) is a complex autoimmune disease with clinical prevalence in women. Moreover, women have poorer response to treatment than men. Possible reasons for gender differences in response to treatment could be explained on the basis of sex hormones and their receptors. The optimal strategy in treatment of RA is to use effective disease modifying antirheumatic drugs (DMARDs) such as methotrexate (MTX). The aim of the present study was to examine the association between polymorphisms in the ESR1 and ESR2 genes and the response to treatment of RA patients with methotrexate. The study was carried out on 156 women diagnosed with active rheumatoid arthritis, treated with MTX. Good responders were defined as patients who were receiving MTX and had a DAS28 of ≤ 2.4 after 6 months of therapy (patients with remission of disease symptoms). Poor-responders were defined as patients who were receiving MTX and had a DAS28 of > 2.4. There were no statistically significant associations of ESR1 and ESR2 gene polymorphisms with response to treatment. The results of the present study suggest that the polymorphisms rs9340799:A>G and rs2234693:T>C in ESR1 gene and rs4986938:G>A and 1256049:G>A in ESR2 gene are not associated with response to RA treatment with MTX. 相似文献
12.
Fukushima-Uesaka H Saito Y Maekawa K Ozawa S Hasegawa R Kajio H Kuzuya N Yasuda K Kawamoto M Kamatani N Suzuki K Yanagawa T Tohkin M Sawada J 《Drug metabolism and pharmacokinetics》2005,20(4):300-307
Forty-eight single nucleotide variations, including 27 novel ones, were found in the 5'- regulatory region, all of the exons and their surrounding introns of CYP2C19 in 253 Japanese subjects (134 diabetic patients and 119 healthy volunteers). Identified novel variations were as follows: -2772G>A, 2767_-2760delGGTGAACA, -2720T>C, -2547delG, -2545G>T, -2545_-2544 delGC, and -2040C>T in the enhancer region; -778C>T, -777G>A, -529G>C, -189C>A, and -185A>G in the promoter region; 151A>G (S51G), 481G>C (A161P), 986G>A (R329H), 1078G>A (D360N), and 1119C>T (D373D) in the exons, and IVS1+128T>A, IVS3+163G>A, IVS4+271A>G, IVS5-49A>G, IVS6-210C>T, IVS6-196T>A, IVS6-32T>A, IVS7+84G>A, IVS7-174C>T, and IVS8+64C>T in the introns. Since we found no significant differences in the variation frequencies between healthy volunteers and diabetic patients, the data for all subjects were treated as one group in further analysis. The allele frequencies were 0.265 for IVS6-196T>A, 0.045 for -2772G>A and -2720T>C, 0.024 for -2040C>T, 0.014 for IVS7-174C>T, 0.010 for -529G>C, 0.006 for IVS1+128T>A and 481G>C (A161P), 0.004 for -2767_-2760delGGTGAACA and IVS6-210C>T, and 0.002 for the other 17 variations. In addition, the two known nonsynonymous single nucleotide polymorphisms, 681G>A (splicing defect, (*)2 allele) and 636G>A (W212X; (*)3 allele) were detected at 0.267 and 0.128 frequencies, respectively. No variation was detected in the known binding sites for constitutive androstane receptor and glucocorticoid receptor. Linkage disequilibrium analysis showed several close linkages of variations throughout the gene. By using the variations, thirty-one haplotypes of CYP2C19 and their frequencies were estimated. Our results would provide fundamental and useful information for genotyping CYP2C19 in the Japanese and probably other Asian populations. 相似文献
13.
Cheng Q Wu B Kager L Panetta JC Zheng J Pui CH Relling MV Evans WE 《Pharmacogenetics》2004,14(8):557-567
We found a significant inverse relationship between gamma-glutamyl hydrolase (GGH) activity and the accumulation of long-chain methotrexate polyglutamates (MTXPG4-7) in non-hyperdiploid B-lineage acute lymphoblastic leukaemia (ALL) cells after uniform treatment with high-dose methotrexate (HDMTX) (1 g/m i.v.). To identify genetic polymorphisms that alter the function of human GGH, we sequenced the GGH exons of genomic DNA from children with ALL, who had a 7.8-fold range of GGH activity in their ALL cells at diagnosis. A single nucleotide polymorphism (452C>T, T127I) was found among patients with low GGH activity, but not found in patients with high GGH activity. Computational modelling indicated that the T127I substitution alters the molecular surface conformation at the catalytic cleft-tail on GGH, which is predicted to alter binding affinity with long chain but not short-chain methotrexate polyglutamates. Enzyme kinetic analysis of heterologously expressed GGH revealed a significantly higher Km (2.7-fold) and lower catalytic efficiency (Vmax/Km reduced 67%) of the T127I variant compared to wild-type GGH using long-chain MTXPG5 as substrate, but not a significant change with short-chain MTXPG2. The 452C>T single nucleotide polymorphism (SNP) was also associated with lower GGH activity in hyperdiploid B-lineage and T lineage ALL cells. Caucasians [10.0%; 95% confidence interval (CI) 6.7-13.3%; n = 155] were found to have a significantly higher frequency of the Ile allele than African-Americans (4.4%; 95% CI 1.2-7.5%; n = 80) (P = 0.033). These studies demonstrate a substrate specific functional SNP (452C>T) in the human GGH gene that is associated with lower catalytic activity and higher accumulation of long-chain MTX-PG in leukaemia cells of patients treated with HDMTX. 相似文献
14.
Hart SN Li Y Nakamoto K Wesselman C Zhong XB 《Drug metabolism and pharmacokinetics》2007,22(4):322-326
Cytochrome P450 oxidoreductase (POR) is the single flavoprotein which donates electrons to the microsomal cytochrome P450 enzymes for oxidation of their substrates. In this study, we sequenced all 15 exons and the surrounding intronic sequences of POR in 100 human liver samples to identify novel and confirm known genetic polymorphisms in POR. Thirty-four single nucleotide polymorphisms (SNPs) were identified including 9 in the coding exons (5 synonymous and 4 nonsynonymous), 20 in the intronic regions, and 5 in the 3'-UTR. Of these, 9 were novel SNPs, including three nonsynonymous SNPs, SNH313003 (817733G>C; K49N), SNH313020 (848661C>A; L420M), and SNH313029 (849577T>C; L577P) with minor allele frequencies of 0.005, 0.045, and 0.020, respectively. We also confirmed a previously reported non-synonymous SNP rs1057868 (A503V) as well as five synonymous SNPs (G5G, T29T, P129P, S485S, and S572S) all with allele frequencies similar to those previously reported. Structurally, these polymorphisms occur in different regions: SNH313003 (K49N) in the amino-terminal tail, SNH313020 (L420M) in the connecting domain, SNH313029 (L577P) in the NADPH-binding domain, and rs1057868 (A503V) in the FAD binding domain. 相似文献
15.
Kim SR Saito Y Maekawa K Sugiyama E Kaniwa N Ueno H Okusaka T Morizane C Yamamoto N Ikeda M Yoshida T Minami H Furuse J Ishii H Saijo N Kamatani N Ozawa S Sawada J 《Drug metabolism and pharmacokinetics》2006,21(3):248-256
Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations. 相似文献
16.
Fukushima-Uesaka H Saito Y Maekawa K Saeki M Kamatani N Kajio H Kuzuya N Yasuda K Sawada J 《Drug metabolism and pharmacokinetics》2006,21(4):337-346
Thirty-nine single nucleotide variations, including 16 novel ones, were found in the 5' promoter region, all of the exons and their surrounding introns of HNF4A in 74 Japanese type II diabetic patients. The following novel variations were identified (based on the amino acid numbering of splicing variant 2): -208G>C in the 5' promoter region; 1154C>T (A385V) and 1193T>C (M398T) in the coding exons; 1580G>A, 1852G>T, 2180C>T, 2190G>A, and 2362_2380delAAGAATGGTGTGGGAGAGG in the 3'-untranslated region, and IVS1+231G>A, IVS2-83C>T, IVS3+50C>T, IVS3-54delC, IVS5+173_176delTTAG, IVS5-181_-180delAT, IVS8-106A>G, and IVS9-151A>C in the introns. The allele frequencies were 0.311 for 2362_2380delAAGAATGGTGTGGGAGAGG, 0.054 for 1580G>A, 0.047 for 1852G>T, 0.020 for IVS1+231G>A, 0.014 for IVS9-151A>C, and 0.007 for the other 11 variations. In addition, one known nonsynonymous single nucleotide polymorphism, 416C>T (T139I), was detected at a 0.007 frequency. Based on the linkage disequilibrium profiles, the region analyzed was divided into three blocks. Haplotype analysis determined/inferred 10, 16, and 12 haplotypes for block 1, 2, and 3, respectively. Our results on HNF4A variations and haplotypes would be useful for pharmacogenetic studies in Japanese. 相似文献
17.
Haenisch S May K Wegner D Caliebe A Cascorbi I Siegmund W 《Pharmacogenetics and genomics》2008,18(4):357-365
OBJECTIVES: To evaluate whether ABCC2 gene polymorphisms are associated with expression and/or function of the efflux pump. METHODS: We investigated the allele frequency of ABCC2 -24C>T, -23G>A, c.1249G>A, c.1446C>G, c.1457C>T, c.2302C>T, c.2366C>T, c.3542G>T, c.3561G>A, c.3563T>A, c.3972C>T, c.4348G>A, and 4544G>A in 374 nonrelated German healthy volunteers and determined the impact on duodenal mRNA and protein content of ABCC2. For functional analysis, the disposition of intravenously (30 mg) and orally administered talinolol (100 mg) was measured among 31 individuals. Moreover, the effects of rifampicin-type induction (600 mg, 8 days) of duodenal ABCC2 were quantified in 22 participants with regard to genetic polymorphisms. RESULTS: The allele frequencies were 18.3% (-24T), 21.1% (1249A), 1.4% (1446G), 0.1% (3542T), 4.5% (3563A), 34.2% (3972T), and 4.4% (4544A); carriers of -23G>A, 1457C>T, 2302C>T, 2366C>T, 3561G>A, and 4348G>A were not identified. The -24T allele was in strong linkage with 3972T, and 3563A with 4544A, whereas 1249A was weakly linked with other variant alleles. None of the single nucleotide polymorphisms investigated influenced significantly intestinal ABCC2 mRNA and protein content. The variant ABCC2 1249G>A (V417I), however, was associated with lower oral bioavailability (P=0.001), and increased residual clearance of intravenous talinolol (P=0.021). Intestinal ABCC2 mRNA and protein expression were upregulated by rifampicin treatment, a genetic influence could be detected in only four cases heterozygote for 3563T>A or 4544G>A. CONCLUSION: The 1249G>A (V417I) polymorphism is obviously associated with higher activity of the intestinal transporter. 相似文献
18.
19.
Fourteen novel single nucleotide polymorphisms in the SLC22A2 gene encoding human organic cation transporter (OCT2) 总被引:2,自引:0,他引:2
Fukushima-Uesaka H Maekawa K Ozawa S Komamura K Ueno K Shibakawa M Kamakura S Kitakaze M Tomoike H Saito Y Sawada J 《Drug metabolism and pharmacokinetics》2004,19(3):239-244
Thirty-three genetic variations including fourteen novel ones were found in the SLC22A2 gene from 116 Japanese individuals. The novel variations were as follows: 596C>T (MPJ6_OC2003), 602C>T (MPJ6_OC2004), IVS5+20A>G (MPJ6_OC2010), IVS5-84_-83insG (MPJ6_OC2013), IVS6+30T>C (MPJ6_OC2014), IVS6+146G>T (MPJ6_OC2016), IVS6+179G>T (MPJ6_OC2017), IVS6-16delT (MPJ6_OC2018), 1920G>A (MPJ6_OC2022), 2153G>A (MPJ6_OC2026), 2157C>T (MPJ6_OC2028), 2306T>C (MPJ6_OC2031), 2342+5T>C (the last nucleotide number of mRNA+the position in the 3'-flanking region; MPJ6_OC2032) and 2342+127T>C (MPJ6_OC2033). Six variations were located in the exons, four of which were in the 3'-untranslated region (3'-UTR) of exon 11; six were in the introns; and two were in the 3'-flanking region. The frequencies were 0.802 for IVS5-84_-83insG, 0.013 for 602C>T, 0.009 for 596C>T, and 0.004 for the other 11 variations. Among them, 596C>T and 602C>T resulted in amino acid substitutions (Thr199Ile and Thr201Met, respectively). 相似文献