Comparing social reciprocity in preserved speech variant and typical Rett syndrome during the early years of life

This study compared early markers of social reciprocity in children with typical Rett syndrome (RTT) and in those with the preserved speech variant (PSV) of RTT. Retrospective video analysis of 10 toddlers with typical RTT and five with PSV investigated participants’ orientation to their name being called between the ages of 5 and 24 months, prior to their diagnosis. From analysis of the recordings two distinct profiles were apparent. Although response rate was higher in girls with typical RTT than PSV at 5 to 8 months this noticeably reversed from 9 to 12 months onwards. By two years of age there was a markedly higher rate and range of responses from girls with PSV. This study contributes to the delineation of different profiles for the variants of RTT.     

Developmental profile of speech-language and communicative functions in an individual with the Preserved Speech Variant of Rett syndrome

Objective: We assessed various aspects of speech-language and communicative functions of an individual with the preserved speech variant of Rett syndrome (RTT) to describe her developmental profile over a period of 11 years.

Methods: For this study, we incorporated the following data resources and methods to assess speech-language and communicative functions during pre-, peri- and post-regressional development: retrospective video analyses, medical history data, parental checklists and diaries, standardized tests on vocabulary and grammar, spontaneous speech samples and picture stories to elicit narrative competences.

Results: Despite achieving speech-language milestones, atypical behaviours were present at all times. We observed a unique developmental speech-language trajectory (including the RTT typical regression) affecting all linguistic and socio-communicative sub-domains in the receptive as well as the expressive modality.

Conclusion: Future research should take into consideration a potentially considerable discordance between formal and functional language use by interpreting communicative acts on a more cautionary note.     

Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation

Background Rett syndrome (RTT), an X‐linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. Methods We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high‐performance liquid chromatography combined with direct sequencing. Results Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8‐year‐old girl with typical clinical features of RTT. The indel was found in a 6‐year‐old girl with a very mild phenotype. Conclusion Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.     

Change over a 16-month period in the psychological well-being of mothers of girls and women with Rett syndrome

Purpose: There is an emerging research literature on the experiences of family members of girls and women with Rett syndrome (RTT), but a lack of longitudinal data. Methods: Fifty mothers whose daughters had RTT were surveyed 16–17 months after an earlier cross-sectional study. Measures completed at both time points focused on maternal positive and negative psychological well-being and their daughters’ behavioral and emotional problems and RTT behavioral phenotype severity. Results: Maternal stress, anxiety, and depression demonstrated at least moderate levels of stability. Maternal positive perceptions were also moderately stable over 16–17 months. Longitudinal analyses suggested that their daughters’ behavioral and emotional problems rather than RTT behavioral phenotype severity predicted later maternal well-being. Conclusion: Mothers with RTT daughters experience chronic stress (persisting over time) but also ongoing positive perceptions. Practitioners should recognize positive perceptions and also consider targeted behavioral parent training to reduce behavior problems in individuals with RTT.     

Choline Ameliorates Disease Phenotypes in Human iPSC Models of Rett Syndrome

Rett syndrome (RTT) is a postnatal neurodevelopmental disorder that primarily affects girls. Mutations in the methyl-CpG-binding protein 2 (MECP2) gene account for approximately 95 % of all RTT cases. To model RTT in vitro, we generated induced pluripotent stem cells (iPSCs) from fibroblasts of two RTT patients with different mutations (MECP2 ^R306C and MECP2 ^1155Δ32) in their MECP2 gene. We found that these iPSCs were capable of differentiating into functional neurons. Compared to control neurons, the RTT iPSC-derived cells had reduced soma size and a decreased amount of synaptic input, evident both as fewer Synapsin 1-positive puncta and a lower frequency of spontaneous excitatory postsynaptic currents. Supplementation of the culture media with choline rescued all of these defects. Choline supplementation may act through changes in the expression of choline acetyltransferase, an important enzyme in cholinergic signaling, and also through alterations in the lipid metabolite profiles of the RTT neurons. Our study elucidates the possible mechanistic pathways for the effect of choline on human RTT cell models, thereby illustrating the potential for using choline as a nutraceutical to treat RTT.     

Tracking development from early speech-language acquisition to reading skills at age 13

Objective: Previous studies have indicated a link between speech-language and literacy development. To add to this body of knowledge, we investigated whether lexical and grammatical skills from toddler to early school age are related to reading competence in adolescence.

Methods: Twenty-three typically developing children were followed from age 1;6 to 13;6 (years;months). Parental checklists and standardized tests were used to assess the development of mental lexicon, grammatical and reading capacities of the children.

Results: Direct assessment of early speech-language functions positively correlated with later reading competence, whereas lexical skills reported by parents were not associated with this capacity. At (pre-) school age, larger vocabulary and better grammatical abilities predicted advanced reading abilities in adolescence.

Conclusion: Our study contributes to the understanding of typical speech-language development and its relation to later reading outcome, extending the body of knowledge on these developmental domains for future early identification of children at risk for reading difficulties.     

A preliminary evaluation of the reliability and validity of a self‐reported communicative functioning item pool

Background: Item banking, an approach to test development based in item response theory (IRT), is beginning to be applied to the measurement of communicative functioning in aphasia. This approach involves calibrating a set of test items responding to a particular latent trait to a common measurement scale. One method for validating such scales is to examine the degree to which obtained item calibration estimates agree with a priori item rankings based on theory or expert opinion.

Aims: The purpose of this study was to evaluate the utility of magnitude estimation (ME) procedures for validating item banks containing self‐reported functional performance items, and to make a preliminary analysis of the validity of a proposed item pool for measuring self‐reported communicative functioning in aphasia.

Methods & Procedures: A total of 14 raters made ME ratings of physical and communicative functioning items. These ratings were evaluated for their intra and inter‐observer reliability and, for subsets of the items, their correspondence with previously published IRT calibration estimates was also evaluated.

Outcomes & Results: Intra‐rater reliability was moderate to high, and inter‐rater reliability was high. Correspondence with IRT calibrations was high for physical items, and moderate for communication items. The distribution of ME ratings for the communication items was negatively skewed.

Conclusions: ME procedures have utility for investigating the validity of functional performance items. The results suggest that communicative functioning may have a more complex latent structure than physical functioning, and that the proposed item pool might benefit from the inclusion of additional items at the lower end of the scale.     

Access and social inclusion in aphasia: Interactional principles and applications

Background: People with aphasia are often excluded from full participation in communicative events and social interactions. Many consider the aphasic language deficit as the cause of social exclusion. However, social exclusion is a complex process that is situated within the wider realm of human social action. While the aphasia literature has provided data on resources and strategies that impact on inclusion and participation, other realms of social science have targeted social action in all its authenticity and complexity, and have focused on how social action is effectively established, negotiated, and sustained. A study of this literature can expand our understanding of issues involved in inclusion, participation, and communicative access of people with aphasia.

Aims: This article will review a selected corpus of social science research that is outside the clinician's typical experience, but that is relevant to the issues of accessibility and social inclusion in aphasia.

Main Contribution: Four interactional principles relevant to the enhancement of social accessibility and social inclusion will be discussed. These four principles concern social constructionism, local negotiation of social action, the collaborative nature of social action, and ways that social dimensions are manifested in social action. Understanding of broad principles of social interaction will improve our ability to enable social participation and inclusion of people with aphasia.

Conclusions: This paper will describe four principles of human social interaction and highlight clinical implications involving various therapeutic strategies and communicative values related to communicative inclusion and social participation.     

Validity and reliability of the Intelligibility in Context Scale: European Portuguese version

The purpose of the study was to evaluate the validity, reliability, sensitivity and specificity of the European-Portuguese version of the Intelligibility in Context Scale (ICS-EP).

Seventy-six children (age: M = 60.6, SD = 8.1 months), 25 having a parent or teacher concern about how they talked and 51 with no concern, were assessed with the phonetic-phonological test (TFF-ALPE) to calculate the following severity measures: percentage of phonemes correct (PPC), percentage of consonants correct (PCC), and percentage of vowels correct (PVC). Parents also filled out a questionnaire about their child’s development (e.g. concern about how the child talks). The ICS was then completed by parents to estimate their children’s intelligibility with different communicative partners.

The results showed that item-level scores were different according to communicative partners. The mean ICS score for the whole sample was 4.5 (SD = 0.6), showing that children were “usually” to “always” intelligible. The ICS had excellent internal consistency (α = 0.96). Children with parental concern about their speech presented significantly lower mean scores (M = 3.91, SD = 0.59) than children without parental concerns (M = 4.78, SD = 0.36). There was a positive correlation between the ICS scores and PPC (r = .655), PCC (r = .654), and PVC (r = .588). A simple linear model was also obtained between the ICS mean score and the severity measures analyzed. High values were obtained for sensitivity (0.80) and specificity (0.84), using a cut-off point of 4.36.

We conclude that the ICS-EP has good psychometric properties, suggesting it to be a valid tool for estimating children’s intelligibility when talking with different communicative partners. Therefore, this version of the ICS can be used as a screening measure for children’s speech intelligibility.     

Neurophysiological responses to music and vibroacoustic stimuli in Rett syndrome

People with Rett syndrome (RTT) have severe communicative difficulties. They have as well an immature brainstem that implies dysfunction of the autonomic nervous system. Music plays an important role in their life, is often used as a motivating tool in a variety of situations and activities, and caregivers are often clear about people with RTTs favourites. The aim of this study was to investigate physiological and emotional responses related to six different musical stimuli in people with RTT. The study included 29 participants with RTT who were referred to the Swedish Rett Center for medical brainstem assessment during the period 2006–2007. 11 children with a typical developmental pattern were used as comparison. A repeated measures design was used, and physiological data were collected from a neurophysiological brainstem assessment. The continuous dependent variables measured were Cardiac Vagal Tone (CVT), Cardiac Sensitivity to Baroreflex (CSB), Mean Arterial Blood Pressure (MAP) and the Coefficient of Variation of Mean Arterial Blood Pressure (MAP-CV). These parameters were used to categorise brainstem responses as parasympathetic (calming) response, sympathetic (activating) response, arousal (alerting) response and unclear response. The results showed that all participants responded to the musical stimuli, but not always in the expected way. It was noticeable that both people with and without RTT responded with an arousal to all musical stimuli to begin with. Even though the initial expressions sometimes changed after some time due to poor control functions of their brainstem, the present results are consistent with the possibility that the RTT participants’ normal responses to music are intact. These findings may explain why music is so important for individuals with RTT throughout life.     

Maternal prenatal stress and postnatal depressive symptoms: discrepancy between mother and teacher reports of toddler psychological problems

Purpose

Maternal prenatal stress and postnatal depression are reported to increase the risk for early offspring psychological problems. We examined whether these two stressors predicted toddler emotional or behavioral problems based on the mother and teacher reports, respectively.

Methods

A longitudinal study within the Odense Child Cohort (OCC). Prenatal stress was assessed (gestation week 28) using Cohen’s Perceived Stress Scale (PSS). Depressive symptoms were assessed (3 months after birth) using the Edinburgh Postnatal Depression Scale (EPDS). Behavioral and emotional problems were assessed by mothers using the preschool version of Child Behaviour Checklist (CBCL) and by teachers using the caregiver–teacher report form (CTR-F).

Results

N = 1302 mother–child dyads were included. CBCL (N = 1302) was collected at 29 months (SD 5.3) and C-TRF (N = 989) at 32.6 months (SD 6.9). N = 70 mothers (5.4%) were at high risk for postnatal depression (EPDS score > 12). Generalized additive models showed that prenatal stress (increase of + 1 on PSS-10 total score) predicted an increase in CBCL (+ 0.011) and C-TRF (+ 0.015) total scores. Postnatal depressive symptoms (increase of + 1 on EPDS total score) only predicted an increase in CBCL total score (+ 0.026).

Conclusion

Prenatal maternal stress was a significant predictor of both mother and teacher reported toddler emotional and behavioral problems, although effect sizes were small. Postnatal depressive symptoms were associated with increased maternal (but not teacher) reporting of toddler problems. Mothers reported more toddler psychological problems than teachers, and the mother–teacher discrepancy was positively correlated to maternal postnatal depressive symptoms.

     

Measuring communicative functioning in community‐dwelling stroke survivors: Conceptual foundation and item development

Background: Studies employing item response theory methods to evaluate communicative functioning assessment items have found that a broad range of communication tasks and activities may fit a unidimensional measurement model, but that additional item content is needed to extend the range of ability effectively measured by the small subset of items that have been evaluated.

Aims: To describe the item identification, evaluation, and development process used to substantiate the content relevance and representativeness of a set of communicative functioning assessment items targeting community‐dwelling stroke survivors.

Methods & Procedures: Electronic and secondary references were searched to identify assessment tools with item content designed to measure communicative functioning in adults with neurogenic communication disorders. Candidate items were evaluated using face‐to‐face interviewer‐assisted survey groups conducted independently with communicatively impaired stroke survivors (n = 59) and their communicative partners (n = 61). Web‐based surveys were employed to evaluate candidate items from the perspective of practising speech‐language pathologists (n = 114).

Outcomes & Results: A total of 673 items were identified from 33 instruments. A total of 426 met the specified concept definition; 211 were determined to be non‐redundant; 166 were identified by key stakeholders as unambiguous, relevant, and moderately to very important to daily functioning.

Conclusions: The item pool developed samples a representative range of communication behaviours, activities, and life situations that are relevant to community‐dwelling stroke survivors. Further research using item response theory methods is required to substantiate the construct dimensionality and range of ability effectively measured by the item pool, and to evaluate dynamic assessment algorithms designed to minimise response burden.     

Processing speed is associated with differences in IQ and cognitive profiles between patients with schizophrenia and their healthy siblings

Background: Processing speed turns out to be the central area of research on cognition in schizophrenia. So far the relationship between this dimension and the IQ level of patients and their healthy siblings has not been investigated.

Aim: To investigate the differences in cognitive speed in patients with schizophrenia and their healthy siblings, and to determine whether cognitive speed as a covariate affects differences in IQ and cognitive profiles between groups.

Methods: Forty-seven inpatients diagnosed with schizophrenia according to DSM-IV (SCH) and their 36 healthy siblings (HSB) were tested with cognitive speed tasks according to Bartzokis et al. method and Wechsler Intelligence Scale. Additional control for the possible impact of antipsychotic drugs and selected demographic variables on the cognitive performance was taken into account.

Results: The siblings scored significantly higher in the cognitive speed task (p?F(10, 770)?=?2.798, p?=?0.002. Similarly, the Performance and Full Scale IQs were significantly different, at p?p?=?0.459.

Conclusions: Significant differences in cognitive speed between patients and their healthy siblings generate the differences in the cognitive profile assessed with Wechsler Intelligence Scale. Some problems of cognitive speed diagnosis and further research on the cognitive schizophrenia endophenotype were discussed.     

Profiling early socio-communicative development in five young girls with the preserved speech variant of Rett syndrome

Rett syndrome (RTT) is a developmental disorder characterized by regression of purposeful hand skills and spoken language, although some affected children retain some ability to speech. We assessed the communicative abilities of five young girls, who were later diagnosed with the preserved speech variant of RTT, during the pre-regression period (aged 12-24 months). Videotapes, obtained by parents during routine family situations and celebrations, were analyzed to identify communicative forms and functions used by these toddlers. Non-verbal communicative forms dominated over verbal-communicative forms for six of the eight identified communication functions. Although the girls used various non-verbal forms to make requests, for example, none of the individuals were observed to make choices or request information. Early peculiarities in the speech-language domain during the first year of life became more prominent and evident during the second year of life as general differences between typical development and atypical development become more obvious in RTT. These findings highlight the importance of assessing socio-communicative forms and functions at early age in children with RTT. The results suggest that speech-language functions did not appear to play a major role in the children's communicative attempts. We conclude that, even among children with the preserved speech variant, socio-communicative deficits are present before regression and persist after this period.     

Blood oxidative stress and metallothionein expression in Rett syndrome: Probing for markers

Objectives: Oxidative stress seems to be involved in Rett syndrome (RTT). The aim of this study was to assess the antioxidant status in RTT children with MECP2 gene mutations with respect to healthy controls, and to explore novel blood antioxidant markers for RTT severity. Methods: In erythrocytes from RTT females aged 2–14 years (n?=?27) and age-matched controls (n?=?27), we measured the levels of malonaldehyde and the activity of two antioxidant enzymes, Cu/Zn-superoxide dismutase and catalase, by spectrophotometric assays. In leukocytes, the expression of metallothioneins, the main non-enzymatic antioxidants, was assessed by real-time RT-PCR. In nine selected RTT children, methylome analysis was also performed. Results: Blood of RTT patients showed increased lipid peroxidation and a dysregulated pattern of MT expression, while enzymatic activities did not change significantly with respect to controls. Moreover, we observed no epigenetic dysregulation in CpG-enriched promoter regions of the analysed genes but significant hypomethylation in the random loci. Conclusions: As the haematic level of MT-1A directly correlates with the phenotype severity, this metallothionein can represent a marker for RTT severity. Moreover, the attempt to link the level of blood oxidative stress with MECP2 mutation and specific clinical features led us to draw some interesting conclusions.     

Detecting autonomic response to pain in Rett syndrome

Objective: To quantify pain response in girls affected by Rett syndrome (RTT) using electrodermal activity (EDA), a measure of skin conductance, reflecting sympathetic activity known to be modulated by physical and environmental stress. Methods: EDA increase, heart rate (HR) increase and Face Legs Activity Cry Consolability (FLACC) values calculated during venipuncture (invasive) and vital signs collection (non-invasive) events were compared with values calculated during a prior baseline and a RTT clinical severity score (CSS). Results: EDA and HR increase were significantly higher than baseline during venipuncture only and not significantly correlated with FLACC or CSS. EDA increase was the most sensitive measure of pain response. Conclusions: These preliminary findings revealed that motor impairment might bias non-verbal pain scales, underscore the importance of using autonomic measures when assessing pain and warrant further investigation into the utility of using EDA to objectively quantify RTT pain response to inform future RTT pain management.     

Trouble and repair during conversations of people with primary progressive aphasia

Background: Primary progressive aphasia (PPA) affects a range of language domains that impact on communication. Little is known about the nature of conversation breakdown in PPA. The identification of trouble in conversation, its repair and the success of repairs has been used effectively to examine conversation breakdown in neurogenic language disorders such as dementia of the Alzheimer type (DAT) and acute onset aphasia. This study investigated trouble and repair in the conversations of people with PPA.

Aims: The first aim of this study is to describe the contributions of individuals with PPA and their conversation partner to conversation. The second aim is to describe the trouble that occurs in dyadic conversations between three individuals with PPA and their communication partner. The third aim is to describe the repair behaviours used by the individuals with PPA and their communication partners.

Methods & Procedures: Dyadic conversations about everyday activities between three individuals with PPA and their partners and three control dyads were video recorded and transcribed. Number of words, number of turns and length of turns were measured and trouble-indicating behaviours (TIBs) and repair behaviours were categorised.

Outcomes & Results: Individuals with PPA had reduced mean length of turn but maintained their share of turn-taking. They demonstrated a variety of TIBs that differed from the noninteractive repairs, which do not require a response from the partner in the conversation and which have been observed in studies of conversation in DAT. Their partners bore the greater burden of highlighting trouble and need for repair using collaborative, interactive, TIBs. Three different conversational profiles were observed in the three PPA dyads, reflecting different patterns of language and cognitive impairment.

Conclusions: Individuals with PPA were active participants in conversation effectively indicating and responding to trouble. Understanding trouble and repair in the conversations of individuals with PPA has the potential to enhance assessment and inform clinical practice.     

Multiple languages,memory, and regression: An examination of Ribot's Law

Background: Low-tech visual scene displays (VSDs) combine contextually rich pictures and written text to support the communication of people with aphasia. VSDs create a shared communication space in which a person with aphasia and a communication partner co-construct messages.

Aims: The researchers examined the effect of low-tech VSDs on the content and quality of communicative interactions between a person with aphasia and unfamiliar communication partners.

Methods &; Procedures: One person with aphasia and nine unfamiliar communication partners engaged in short, one-on-one conversations about a specified topic in one of three conditions: shared-VSDs, non-shared-VSDs, and no-VSDs. Data included discourse analysis scores reflecting the conceptual complexity of utterances, content unit analyses of information communication partners gathered from the interaction, and Likert-scale responses from the person with aphasia about his perception of communicative ease and effectiveness.

Outcomes &; Results: Comparisons made across conditions revealed: (a) the most conversational turns occurred in the shared-VSDs condition; (b) communication partners produced utterances with higher conceptual complexity in the shared-VSDs condition; (c) the person with aphasia conveyed the greatest number of content units in the shared-VSDs condition; and (d) the person with aphasia perceived that information transfer, ease of conversational interaction, and partner understanding were best in the shared-VSDs condition.

Conclusions: These findings suggest that low-tech VSDs have an impact on the manner and extent to which a person with aphasia and a communication partner contribute to conversational interactions involving information transfer.