Centromere positions in chicken and Japanese quail chromosomes: de novo centromere formation versus pericentric inversions

Chicken (Gallus gallus domesticus, GGA) and Japanese quail (Coturnix coturnix japonica, CCO) karyotypes are very similar. They have identical chromosome number (2n?=?78) and show a high degree of synteny. Centromere positions on the majority of orthologous chromosomes are different in these two species. To explore the nature of this divergence, we used high-resolution comparative fluorescent in situ hybridization mapping on giant lampbrush chromosomes (LBCs) from growing oocytes. We applied 41 BAC clones specific for GGA1, 2, 3, 11, 12, 13, 14, and 15 to chicken and quail LBCs. This approach allowed us to rule out a pericentric inversion earlier proposed to explain the difference between GGA1 and CCO1. In addition to a well-established large-scale pericentric inversion that discriminates GGA2 and CCO2, we identified another, smaller one in the large inverted region. For the first time, we described in detail inversions that distinguish GGA3 from CCO3 and GGA11 from CCO11. Despite the newly identified and confirmed inversions, our data suggest that, in chicken and Japanese quail, the difference in centromere positions is not mainly caused by pericentric inversions but is instead due to centromere repositioning events and the formation of new centromeres. We also consider the formation of short arms of quail microchromosomes by heterochromatin accumulation as a third scenario that could explain the discrepancy in centromeric indexes.     

Characterization of the atypical karyotype of the black-winged kite Elanus caeruleus (Falconiformes: Accipitridae) by means of classical and molecular cytogenetic techniques

The karyotype of the black-winged kite (Elanus caeruleus), a small diurnal raptor living in Africa, Asia and southern Europe, was studied with classical (G-, C-, R-banding, and Ag-NOR staining) and molecular cytogenetic methods, including primed in-situ labelling (PRINS) and fluorescence in-situ hybridization (FISH) with telomeric (TTAGGG) and centromeric DNA repeats. The study revealed that the genome size, measured by flow cytometry (3.1pg), is in the normal avian range. However, the black-winged kite karyotype is particularly unusual among birds in having a moderate diploid number of 68 chromosomes, and containing only one pair of dot-shaped microchromosomes. Moreover, the macrochromosomes are medium-sized, with the Z and W gonosomes being clearly the largest in the set. C-banding shows that constitutive heterochromatin is located at the centromeric regions of all chromosomes, and that two pairs of small acrocentrics and the pair of microchromosomes are almost entirely heterochromatic and G-band negative. The distribution pattern of a centromeric repeated DNA sequence, as demonstrated by PRINS, follows that of C-heterochromatin. The localization of telomeric sequences by FISH and PRINS reveals many strong telomeric signals but no extratelomeric signal was observed. The atypical organization of the karyotype of the black-winged kite is considered in the context of the modes of karyotypic evolution in birds.     

Conservation of Centromere Proteins in Vertebrates

The chicken genome comprises 78 chromosomes which include several macrochromosomes and many microchromosomes. Very little information is currently available concerning chicken centromere structure and function and it is unclear if the two types of chromosomes share a common centromere mechanism or whether this mechanism resembles those in other species. Immunofluorescence studies using antibodies to mammalian constitutive centromere proteins CENP-A, CENP-B, and CENP-C and the passenger proteins CENP-E, and CENP-F revealed the presence of each of these proteins at the centromeres of both macro- and microchromsomes. CENP-A, CENP-B, and CENP-E levels showed variability between metaphase centromeres while CENP-C and CENP-F levels were relatively constant. These results suggest a common centromere mechanism for both types of chromosomes as well as indicating a high degree of conservation of individual proteins between widely divergent vertebrate classes and an overall conservation of centromere function throughout vertebrate evolution.     

Replication timing of homologous α-satellite DNA in Roberts syndrome

Roberts syndrome (RS) is associated with a characteristic constitutive heterochromatin anomaly, namely, at metaphase the centromeres and heterochromatic segments appear split. In addition to this cytogenetic phenomenon, known as the RS effect, several other cytological features, especially affecting mitotic chromosome disjunction, are also observed. Applying FISH to interphase nuclei, we investigated the replication patterns of homologous alphoid centromeric DNA of chromosomes 9, 11, 16 and 17 in three patients showing the RS effect and in four normal individuals. A tendency for homologous centromeres to replicate asynchronously was observed in RS patients. This tendency was more evident in chromosomes 9 and 16, with large heterochromatic blocks and particularly subject to RS effect. This asynchrony could reflect a more generalized alteration in repetitive DNA replication timing that, in turn, would prevent the establishment of proper cohesion between sister chromatid heterochromatin, leading to the RS effect.     

Chromosome size-correlated and chromosome size-uncorrelated homogenization of centromeric repetitive sequences in New World quails

Many families of centromeric repetitive DNA sequences isolated from Struthioniformes, Galliformes, Falconiformes, and Passeriformes are localized primarily to microchromosomes. However, it is unclear whether chromosome size-correlated homogenization is a common characteristic of centromeric repetitive sequences in Aves. New World and Old World quails have the typical avian karyotype comprising chromosomes of two distinct sizes, and C-positive heterochromatin is distributed in centromeric regions of most autosomes and the whole W chromosome. We isolated six types of centromeric repetitive sequences from three New World quail species (Colinus virginianus, CVI; Callipepla californica, CCA; and Callipepla squamata, CSQ; Odontophoridae) and one Old World quail species (Alectoris chukar, ACH; Phasianidae), and characterized the sequences by nucleotide sequencing, chromosome in situ hybridization, and filter hybridization. The 385-bp CVI-MspI, 591-bp CCA-BamHI, 582-bp CSQ-BamHI, and 366-bp ACH-Sau3AI fragments exhibited tandem arrays of the monomer unit, and the 224-bp CVI-HaeIII and 135-bp CCA-HaeIII fragments were composed of minisatellite-like and microsatellite-like repeats, respectively. ACH-Sau3AI was a homolog of the chicken nuclear membrane repeat sequence, whose homologs are common in Phasianidae. CVI-MspI, CCA-BamHI, and CSQ-BamHI showed high homology and were specific to the Odontophoridae. CVI-MspI was localized to microchromosomes, whereas CVI-HaeIII, CCA-BamHI, and CSQ-BamHI were mapped to almost all chromosomes. CCA-HaeIII was localized to five pairs of macrochromosomes and most microchromosomes. ACH-Sau3AI was distributed in three pairs of macrochromosomes and all microchromosomes. Centromeric repetitive sequences may be homogenized in chromosome size-correlated and -uncorrelated manners in New World quails, although there may be a mechanism that causes homogenization of centromeric repetitive sequences primarily between microchromosomes, which is commonly observed in phasianid birds.     

A tandem repetitive sequence located in the centromeric region of common wheat (Triticum aestivum) chromosomes

Although TaiI-family sequences are present in the subtelomeric region of Leymus racemosus, it became apparent in the present study that such sequences are also present in the centromeric region of common wheat (Triticum aestivum). These sequences hybridized to all chromosomes with various degrees of signal strength. FISH using TaiI and Ty3/gypsy, a conservative sequence in cereal centromeres, revealed a complicated arrangement of both sequences in all wheat chromosomes at once. Unlike the Arabidopsis centromeres characterized by massive tandem arrays of 180-bp family with flanking paracentromeric retrotransposons in all chromosomes, wheat chromosomes showed various arrangement patterns of TaiI and Ty3/gypsy sequences depending on the chromosome; TaiI-family sequences were scattered in many wheat centromeres as isolated colonies instead of forming uninterrupted solid tandem arrays. This pattern may have resulted from retrotransposon insertion within pre-existing TaiI-tandem arrays or a two-step amplification mechanism of the TaiI family where each TaiI colony was amplified to form arrays independently after the insertion of TaiI-family sequences along the entire centromere. Although sequence analysis of centromeric TaiI repeats in wheat and subtelomeric TaiI repeats in L. racemosus showed variable and conservative regions between the two repeats, they did not show a distinctive difference phylogenically. The widespread presence of tandem repetitive sequences in the eucaryotic centromere suggests a significant role for them in centromeric formation.     

FISH mapping and molecular organization of the major repetitive sequences of tomato

This paper presents a bird’s-eye view of the major repeats and chromatin types of tomato. Using fluorescence in-situ hybridization (FISH) with Cot-1, Cot-10 and Cot-100 DNA as probes we mapped repetitive sequences of different complexity on pachytene complements. Cot-100 was found to cover all heterochromatin regions, and could be used to identify repeat-rich clones in BAC filter hybridization. Next we established the chromosomal locations of the tandem and dispersed repeats with respect to euchromatin, nucleolar organizer regions (NORs), heterochromatin, and centromeres. The tomato genomic repeats TGRII and TGRIII appeared to be major components of the pericentromeres, whereas the newly discovered TGRIV repeat was found mainly in the structural centromeres. The highly methylated NOR of chromosome 2 is rich in [GACA]₄, a microsatellite that also forms part of the pericentromeres, together with [GA]₈, [GATA]₄ and Ty1-copia. Based on the morphology of pachytene chromosomes and the distribution of repeats studied so far, we now propose six different chromatin classes for tomato: (1) euchromatin, (2) chromomeres, (3) distal heterochromatin and interstitial heterochromatic knobs, (4) pericentromere heterochromatin, (5) functional centromere heterochromatin and (6) nucleolar organizer region.     

Karyotypic evolution in squamate reptiles: comparative gene mapping revealed highly conserved linkage homology between the butterfly lizard (Leiolepis reevesii rubritaeniata, Agamidae, Lacertilia) and the Japanese four-striped rat snake (Elaphe quadrivirgata, Colubridae, Serpentes)

The butterfly lizard (Leiolepis reevesii rubritaeniata) has the diploid chromosome number of 2n = 36, comprising two distinctive components, macrochromosomes and microchromosomes. To clarify the conserved linkage homology between lizard and snake chromosomes and to delineate the process of karyotypic evolution in Squamata, we constructed a cytogenetic map of L. reevesii rubritaeniata with 54 functional genes and compared it with that of the Japanese four-striped rat snake (E. quadrivirgata, 2n = 36). Six pairs of the lizard macrochromosomes were homologous to eight pairs of the snake macrochromosomes. The lizard chromosomes 1, 2, 4, and 6 corresponded to the snake chromosomes 1, 2, 3, and Z, respectively. LRE3p and LRE3q showed the homology with EQU5 and EQU4, respectively, and LRE5p and LRE5q corresponded to EQU7 and EQU6, respectively. These results suggest that the genetic linkages have been highly conserved between the two species and that their karyotypic difference might be caused by the telomere-to-telomere fusion events followed by inactivation of one of two centromeres on the derived dicentric chromosomes in the lineage of L. reevesii rubritaeniata or the centric fission events of the bi-armed macrochromosomes and subsequent centromere repositioning in the lineage of E. quadrivirgata. The homology with L. reevesii rubritaeniata microchromosomes were also identified in the distal regions of EQU1p and 1q, indicating the occurrence of telomere-to-telomere fusions of microchromosomes to the p and q arms of EQU1.     

Karyotype evolution in monitor lizards: cross-species chromosome mapping of cDNA reveals highly conserved synteny and gene order in the Toxicofera clade

The water monitor lizard (Varanus salvator macromaculatus (VSA), Platynota) has a chromosome number of 2n?=?40: its karyotype consists of 16 macrochromosomes and 24 microchromosomes. To delineate the process of karyotype evolution in V. salvator macromaculatus, we constructed a cytogenetic map with 86 functional genes and compared it with those of the butterfly lizard (Leiolepis reevesii rubritaeniata (LRE); 2n?=?36) and Japanese four-striped rat snake (Elaphe quadrivirgata (EQU); 2n?=?36), members of the Toxicofera clade. The syntenies and gene orders of macrochromosomes were highly conserved between these species except for several chromosomal rearrangements: eight pairs of VSA macrochromosomes and/or chromosome arms exhibited homology with six pairs of LRE macrochromosomes and eight pairs of EQU macrochromosomes. Furthermore, the genes mapped to microchromosomes of three species were all located on chicken microchromosomes or chromosome 4p. No reciprocal translocations were found in the species, and their karyotypic differences were caused by: low frequencies of interchromosomal rearrangements, such as tandem fusions, or centric fissions/fusions between macrochromosomes and between macro- and microchromosomes; and intrachromosomal rearrangements, such as paracentric inversions or centromere repositioning. The chromosomal rearrangements that occurred in macrochromosomes of the Varanus lineage were also identified through comparative cytogenetic mapping of V. salvator macromaculatus and V. exanthematicus. Morphologic differences in chromosomes 6–8 between the two species could have resulted from pericentric inversion or centromere repositioning.     

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.     

Molecular cytogenetic analysis of heterochromatin in the chromosomes of tilapia, Oreochromis niloticus (Teleostei: Cichlidae)

The structure of the heterochromatic bands in mitotic chromosomes of the important tropical aquaculture species of tilapia, Oreochromis niloticus, was investigated by the combination of the C-banding technique, chromosomal digestion with two restriction endonucleases and fluorescence in situ hybridization (FISH) of two satellite DNAs (SATA and SATB). The tilapia chromosomes presented heterochromatic bands in the centromeres and in the short arms of almost all chromosomes that were differentially digested by the restriction endonucleases HaeIII and EcoRI. FISH of SATA showed that this satellite sequence is distributed in the centromeric region of all chromosomes of tilapia. FISH also revealed an intense hybridization signal for SATB in only one chromosome pair, but less intense signals were also present in several other pairs. The digestion of tilapia chromosomes by HaeIII and EcoRI was positively correlated with the position of SATA and SATB in chromosomes as revealed by FISH. The results obtained may be useful in future molecular and genetic studies of tilapias.     

Rice as a model for centromere and heterochromatin research

Rice (Oryza sativa) has become an important model plant species in numerous research projects involving genome, molecular and evolutionary biology. In this review we describe the reasons why rice provides an excellent model system for centromere and heterochromatin research. In most multicellular eukaryotes, centromeres and heterochromatic domains contain long arrays of repetitive DNA elements that are recalcitrant to DNA sequencing. In contrast, three rice centromeres and the majority of the cytologically defined heterochromatin in the rice genome have been sequenced to high quality, providing an unparalleled resource compared to other model multicellular eukaryotes. Most importantly, active genes have been discovered in the functional domains of several rice centromeres. The centromeric genes and sequence resources provide an unprecedented opportunity to study function and evolution of centromeres and centromere-associated genes.     

Chromosome arrangement and behaviour of two rye homologous telosomes at the onset of meiosis in disomic wheat-5RL addition lines with and without the Ph1 locus

Fluorescence in-situ hybridization (FISH) of total genomic and repetitive DNA on microsporocytes of ditelocentric addition lines of rye 5RL in hexaploid wheat was performed to study the behaviour of the rye homologous chromosome arms in relation to centromere and telomere dynamics at premeiotic interphase and meiotic prophase I. By comparing isogenic lines with and without the Ph1 locus, we established the effect of the Ph1 gene on appearance and behaviour of the rye chromosomes. Ph1 and ph1b lines demonstrated similar premeiotic chromosome arrangement with the two rye homologues occupying separated domains despite the occurrence of centromere association. Our study confirmed that bouquet arrangement of telomeres follows the Rabl configuration. In cells displaying bouquet clustering of telomeres, centromeres of the 5RL telosomes are still at the opposite pole, suggesting anchoring of centromeres at the cytoskeleton. Once the telomeres complete clustering, the rye centromeres migrate to the telomere pole, and the rye chromosomes begin to loosen their structure. While the rye homologues in the wild-type keep separate territories in the nucleus, they become intermingled in the ph1b mutant, possibly because of their lower condensation. In a subsequent stage, the 5RL homologues appear intimately associated mainly at the distal region. Our study suggests that the lower rate of chromosome synapsis in the ph1b mutant results from abnormal chromatin decondensation and organization.     

Identification of human G–group and Y chromosomes. Demonstration of constitutive heterochromatin by modified DNA/RNA hybridization technique

Treatment of standard human chromosomal preparations with NaOH and standard saline–citrate demonstrated constitutive heterochromatin. It is localized near the centromere or within the centromeric region in all except the Y chromosome. The technique was used for identification of G and Y chromosomes. In karyotypes of individuals with trisomy G1 (Down's syndrome) chromosomes number 21 (in the trisomy stage) possessed heterochromatin in different distribution from number 22 chromosomes; the latter having a distinctly dark stained centromere. The centromere, short arms, and proximal portion of the long arms of the Y chromosome were free of constitutive heterochromatin, which was demonstrated occupying the distal portion of the long arms. The extent of heterochromatin of the Y chromosome was identical with the heterochromatin demonstrated by quinacrine fluorochromes and responsible for the fluorescent "Y body."     

A centromere satellite concomitant with extensive karyotypic diversity across the Peromyscus genus defies predictions of molecular drive

A common feature of eukaryotic centromeres is the presence of large tracts of tandemly arranged repeats, known as satellite DNA. However, these centromeric repeats appear to experience rapid evolution under forces such as molecular drive and centromere drive, seemingly without consequence to the integrity of the centromere. Moreover, blocks of heterochromatin within the karyotype, including the centromere, are hotspots for chromosome rearrangements that may drive speciation events by contributing to reproductive isolation. However, the relationship between the evolution of heterochromatic sequences and the karyotypic dynamics of these regions remains largely unknown. Here, we show that a single conserved satellite DNA sequence in the order Rodentia of the genus Peromyscus localizes to recurrent sites of chromosome rearrangements and heterochromatic amplifications. Peromyscine species display several unique features of chromosome evolution compared to other Rodentia, including stable maintenance of a strict chromosome number of 48 among all known species in the absence of any detectable interchromosomal rearrangements. Rather, the diverse karyotypes of Peromyscine species are due to intrachromosomal variation in blocks of repeated DNA content. Despite wide variation in the copy number and location of repeat blocks among different species, we find that a single satellite monomer maintains a conserved sequence and homogenized tandem repeat structure, defying predictions of molecular drive. The conservation of this satellite monomer results in common, abundant, and large blocks of chromatin that are homologous among chromosomes within one species and among diverged species. Thus, such a conserved repeat may have facilitated the retention of polymorphic chromosome variants within individuals and intrachromosomal rearrangements between species—both factors that have previously been hypothesized to contribute towards the extremely wide range of ecological adaptations that this genus exhibits.

     

Evidence for a megareplicon covering megabases of centromeric chromosome segments

We have analysed the replication of the heterochromatic megachromosome that was formedde novo by a large-scale amplification process initiated in the centromeric region of mouse chromosome 7. The megachromosome is organized into amplicons 30 Mb in size, and each amplicon consists of two large inverted repeats delimited by a primary replication initiation site. Our results suggest that these segments represent a higher order replication unit (megareplicon) of the centromeric region of mouse chromosomes. Analysis of the replication of the megareplicons indicates that the pericentric heterochromatin and the centromere of mouse chromosomes begin to replicate early, and that their replication continues through approximately three-quarters of the S-phase. We suggest that a replication-directed mechanism may account for the initiation of large-scale amplification in the centromeric regions of mouse chromosomes, and may also explain the formation of new, stable chromosome segments and chromosomes.accepted for publication by H. C. Macgregor     

Histone modifications associated with both A and B chromosomes of maize

We report the distribution of several histone modifications along the arms and in centromeric regions of somatic chromosomes of maize, including the supernumerary B chromosome. Acetylated H3 and H4 as well as H3K4me2, modifications associated with euchromatin, were enriched in the distal parts of the A chromosomes, but were progressively depleted toward the centromeres of the A chromosomes and were depleted in the heterochromatic portions of the B chromosome. Classical histone modifications associated with heterochromatin, including H3K9me2, H3K27me1 and H3K27me2, were distributed throughout both A and B chromosomes. However, H3K27me2 showed a reduced level on the B chromosome compared with the A chromosomes and was not associated with some classes of constitutive heterochromatin. We monitored the presence of each histone modification in the centromeric regions using a YFP-tagged centromere-specific histone, CENH3. We observed the presence of H3K9me2 and absence of H3K4me2 in the centromeric regions of both A and B chromosomes of maize, which is in contrast to the presence of H3K4me2 and absence of H3K9me2 in animal centromeres. These results show a diversity of epigenetic modifications associated with centromeric chromatin in different eukaryotes.     

Chromosomal study of a lamprey (<Emphasis Type="Italic">Lampetra zanandreai</Emphasis> Vladykov, 1955) (Petromyzonida: Petromyzontiformes): conventional and FISH analysis

Karyotype and other chromosomal characteristics in the Adriatic brook lamprey Lampetra zanandreai, representative of one of the most ancestral group of vertebrates, were examined using conventional (Ag-staining, C-banding as well as CMA₃ and DAPI fluorescence) and molecular (FISH with 18/28S rDNA and EcoRI satDNA as probes) protocols with metaphase chromosomes derived from whole blood cultures. The chromosome complement had a modal diploid chromosome number of 2n = 164, as in other petromyzontid lamprey species. Ag-staining and CMA₃ fluorescence, as well as FISH with 18/28S rDNA probes, detected nucleolar organizer regions (NORs) close to the centromeres of the biarmed chromosomes of pairs 1 and 2, the largest chromosome pairs of the complement. In addition to NORs, CMA₃ fluorescence revealed positive signals in approximately 40 other chromosomes. DAPI stained mostly centromeric regions of many chromosomes as well as conspicuously massive blocks overlapping NOR sites. C-banding evidenced a large amount of constitutive heterochromatin in somatic chromosomes, with approximately 40 C-positive acrocentric elements completely heterochromatic, corresponding with the 40 CMA₃+ chromosomes and positive heterochromatic blocks in pericentromeric regions of chromosome pairs 1 and 2. Polymerase chain reaction (PCR)-based cloning of satellite DNA with primers derived from Petromyzon marinus centromeric sequences was successful for L. zanandreai genomic DNA. The sequence was AT-rich (59%) and characterized by short consensus motifs similar to other centromeric satellite motifs. FISH using satDNA clones as a probe produced a fluorescent signal on a single pair of small chromosomes. This sequence was PCR-amplified also in L. planeri and P. marinus genomic DNA, and the evolution of this repetitive element in the above species was analysed.