Coexistence of Multiple Multilocus Variable-Number Tandem-Repeat Analysis Subtypes of Clostridium difficile PCR Ribotype 027 Strains within Fecal Specimens

We investigated whether multilocus variable-number tandem-repeat analysis (MLVA) typing could identify different subtypes of Clostridium difficile ribotype 027 within the same feces specimen. Five of 39 specimens yielded at least one isolate with an MLVA profile different (more than five summed tandem repeat differences) from that of other isolates in the same specimen, thereby potentially obscuring epidemiological links between C. difficile infection cases.The incidence and severity of Clostridium difficile infection (CDI) have increased in recent years, possibly due to the emergence and spread of epidemic strain PCR ribotype 027 (also known as pulsed-field electrophoresis type NAP1) (9, 10, 12). Ribotype 027 is highly prevalent in the United Kingdom (2), making PCR ribotyping alone insufficient for investigating potential cases of cross infection or differentiating between epidemic outbreaks. Multilocus variable-number tandem-repeat analysis (MLVA) is a more discriminatory typing technique for C. difficile (11, 14) and has been used for several studies (1, 4-7), but as yet, no data on the subtyping of multiple isolates from the same specimen have been published.We investigated whether MLVA typing could identify different subtypes of ribotype 027 within the same specimen and considered the impact this may have on the utility of MLVA as a typing method for outbreak situations.(This work was presented in part as poster 525 at the European Congress of Clinical Microbiology and Infectious Diseases, 16 May 2009.)Thirty-nine feces samples (preselected by infection control teams on the basis of severity, clusters, or high CDI rates) submitted for PCR ribotyping and yielding a type 027 C. difficile isolate were arbitrarily selected. C. difficile was cultured from specimens using alcohol shock and inoculation onto cycloserine-cefoxitin-fructose agar. Five isolated colonies of C. difficile were picked from each culture and were all confirmed as C. difficile type 027 by PCR ribotyping (13), giving 195 study isolates.Six variable-number tandem-repeat (VNTR) loci (A6Cd, B7Cd, C6Cd, E7Cd, G8Cd, and CDR60) from published MLVA schemes (11, 14) were amplified by PCR from all isolates. Loci F3Cd and H9Cd (14) were not used, as they are invariant within PCR ribotype 027 isolates (6, 8, 14). Loci CDR5 and CD59 (11) were not used, as they were found to be variant by only one tandem repeat or invariant in diverse 027 isolates (data not shown). Primers were used as previously described (14), except for the G8Cd reverse primer (5′ AATCTAATAATCCAGTAATTTAAATT 3′), which was redesigned to improve the yield of G8Cd, and CDR60 primers (CDR60-Forward, 5′-AGTTTGTAGGGAAGTGTGTAAATAGAT-3′; CDR60-Reverse, 5′-CGCATTAAATTTCACTCCTCAT-3′), which were redesigned to minimize the PCR product size. Five-microliter volumes of DNA extracts were added to 20 μl of PCR mixture, giving (final concentrations) 0.2 μM each primer, 2.5 mM MgCl₂, 0.2 mM each deoxynucleoside triphosphate, 1× GeneAmp PCR Gold buffer, and 0.5 U of AmpliTaq Gold DNA polymerase (Applied Biosystems). Reaction mixtures underwent activation at 95°C for 5 min, followed by 35 cycles of 95°C for 1 min, 56°C for 1 min, and 72°C for 1 min with a final elongation at 72°C for 5 min. PCR products were electrophoresed on 3% MetaPhor agarose (Lonza) gels in 0.5× Tris-borate-EDTA buffer at 150 V for 5 h against a 20-bp molecular size standard (Sigma-Aldrich Company Ltd.). Gels were stained with ethidium bromide and photographed under UV light. PCR product sizes were determined using BioNumerics software (Applied Maths) by comparison with a standard curve generated from the 20-bp ladder. VNTR numbers were calculated from PCR product sizes. Tandem-repeat numbers from each VNTR locus were concatenated for each isolate to form MLVA profiles, which were compared using BioNumerics software (Applied Maths).The accuracy of determining VNTR numbers using the agarose gel method described was validated by sequencing 35 different VNTR PCR products using an ABI 3700 capillary sequencer to determine exact repeat numbers and then comparing them with numbers determined by the agarose gel method. A range of PCR product sizes from each locus including PCR products differing in size by one 6-bp repeat were included. The agarose gel method was accurate for 28 of 35 sequenced products with an error of plus or minus one repeat in the remaining seven. The impact of any such error was minimized by ensuring that PCR products from the same locus for isolates from the same specimen were electrophoresed in adjacent lanes of the gel, making the smallest 6-bp differences clearly visible. Thus, any error was unlikely to affect the calculated differences between isolates. Accurate size determination methods such as sequencing would be required for larger-scale comparisons.Studies using C. difficile MLVA (1, 4, 5, 7) have utilized the Manhattan coefficient to calculate a summed tandem-repeat difference (STRD) from all loci and associate MLVA types with the smallest STRDs. It has been suggested that C. difficile isolates with an STRD of two or fewer should be considered “clonal” (1, 4, 7, 14). We applied this method to compare MLVA profiles within each study specimen. Thirty-four specimens (87%) were found to contain isolates which were indistinguishable or had an STRD of no more than two from another isolate from the same specimen. Five specimens (13%) contained at least one isolate which had an STRD of five or more from the next most closely related isolate (Fig. ​(Fig.11).Open in a separate windowFIG. 1.MLVA profiles and minimum spanning trees for specimens yielding C. difficile PCR ribotype 027 isolates at least one of which had an STRD of five or more from the next most closely related isolate. For minimum spanning trees, circles represent unique MLVA profiles in the tree and are scaled by member count. Thick solid lines represent an STRD of one, thin solid lines represent an STRD of two, thick dashed lines represent an STRD of three, and thinner dashed lines represent an STRD of four or more. STRDs of more than four are indicated by numerals between the circles. Gray shading indicates complexes with a maximum neighbor distance of two tandem repeats and a minimum of two MLVA types.It is a disadvantage of the Manhattan coefficient that if several repeats at a locus are deleted or duplicated simultaneously, the resulting STRD is large and similarities are obscured.For this reason, we made alternative comparisons of isolate MLVA profiles within each specimen using the categorical coefficient which associates MLVA types with the smallest number of VNTR locus variants. This revealed that 5 (13%) out of 39 specimens contained isolates differing from each other at three out of six loci (Table ​(Table1).1). Two specimens (1 and 3) contain isolates that differ by both analyses.

TABLE 1.

MLVA profiles of specimens containing C. difficile PCR ribotype 027 isolates differing from each other at three out of six VNTR loci

Evaluation of a New Automated Homogeneous PCR Assay,GenomEra C. difficile,for Rapid Detection of Toxigenic Clostridium difficile in Fecal Specimens

We evaluated a new automated homogeneous PCR assay to detect toxigenic Clostridium difficile, the GenomEra C. difficile assay (Abacus Diagnostica, Finland), with 310 diarrheal stool specimens and with a collection of 33 known clostridial and nonclostridial isolates. Results were compared with toxigenic culture results, with discrepancies being resolved by the GeneXpert C. difficile PCR assay (Cepheid). Among the 80 toxigenic culture-positive or GeneXpert C. difficile assay-positive fecal specimens, 79 were also positive with the GenomEra C. difficile assay. Additionally, one specimen was positive with the GenomEra assay but negative with the confirmatory methods. Thus, the sensitivity and specificity were 98.8% and 99.6%, respectively. With the culture collection, no false-positive or -negative results were observed. The analytical sensitivity of the GenomEra C. difficile assay was approximately 5 CFU per PCR test. The short hands-on (<5 min for 1 to 4 samples) and total turnaround (<1 h) times, together with the high positive and negative predictive values (98.8% and 99.6%, respectively), make the GenomEra C. difficile assay an excellent option for toxigenic C. difficile detection in fecal specimens.     

Quantitative cell-adhesion assay for Clostridium difficile cytotoxin

A quantitative assay for Clostridium difficile cytotoxin has been developed, based on the observation that suspended fibroblasts exposed to cytotoxin fail to adhere to plastic. A dye-binding technique was used to quantitate adherent cells, in order to obviate microscopy. Adherent BHK cells were fixed with glutaraldehyde and cell protein was stained with Coomassie blue R-250. Cell-bound dye was eluted and estimated spectrophotometrically. The amount of eluted dye was proportional to the number of adherent cells and cell staining was time dependent. Cytotoxin was purified by gel-permeation and ion-exchange chromatography and migrated as a single band on SDS-PAGE. After exposure of suspended BHK cells to purified cytotoxin, their adhesion to plastic was inhibited in a manner which depended on concentration of cytotoxin and on time and temperature of exposure. This study provides the basis for a C. difficile cytotoxin assay that is quantitative, rapid and reproducible and may have wider applicability in the study of other toxins or agents that inhibit cell adhesion.     

Rapid Molecular Characterization of Clostridium difficile and Assessment of Populations of C. difficile in Stool Specimens

Our laboratory has developed testing methods that use real-time PCR and pyrosequencing analysis to enable the rapid identification of potential hypervirulent Clostridium difficile strains. We describe a real-time PCR assay that detects four C. difficile genes encoding toxins A (tcdA) and B (tcdB) and the binary toxin genes (cdtA and cdtB), as well as a pyrosequencing assay that detects common deletions in the tcdC gene in less than 4 h. A subset of historical and recent C. difficile isolates (n = 31) was also analyzed by pulsed-field gel electrophoresis to determine the circulating North American pulsed-field (NAP) types that have been isolated in New York State. Thirteen different NAP types were found among the 31 isolates tested, 13 of which were NAP type 1 strains. To further assess the best approach to utilizing our conventional and molecular methods, we studied the populations of C. difficile in patient stool specimens (n = 23). Our results indicated that 13% of individual stool specimens had heterogeneous populations of C. difficile when we compared the molecular characterization results for multiple bacterial isolates (n = 10). Direct molecular analysis of stool specimens gave results that correlated well with the results obtained with cultured stool specimens; the direct molecular analysis was rapid, informative, and less costly than the testing of multiple patient stool isolates.Clostridium difficile is one of the leading causes of infectious antibiotic-associated diarrhea and pseudomembranous colitis worldwide (2, 16). This is illustrated by the increased incidence and severity of C. difficile infection, suggesting the emergence of a new hypervirulent strain (5, 13-15, 17, 25, 32).While TcdB, a cytotoxin, is the known established virulence factor of C. difficile, toxin A (TcdA), a cytotoxic enterotoxin, works synergistically with TcdB, causing damage to the intestinal mucosa in cases of C. difficile infection (17). The genes that encode these toxins are located on the pathogenicity locus of C. difficile (4, 10, 24). Additionally, several deletions in the tcdC gene, a putative negative regulator of the expression of the toxin A (tcdA) and the toxin B (tcdB) genes, have been identified, and these deletions result in higher levels of cytotoxin expression (11). Furthermore, research has shown that some C. difficile strains produce another toxin, known as the binary toxin (19, 22, 28). The genes that encode this toxin, cdtA and cdtB, together produce an actin-specific ADP-ribosyltransferase that induces damage to the actin skeleton, leading to cytopathic effects in cell lines (1). It has been suggested that the binary toxin genes and deletions in the tcdC gene are potential virulence factors in the recent emerging hypervirulent strain (22, 29).The “gold standard” for the detection of C. difficile toxin production is a cytotoxin assay with stool specimens or isolates from anaerobic culture. The cytotoxin assay is difficult to perform and time-consuming, and it is often less sensitive than molecular assays (20, 23, 26). Enzyme immunoassays (EIAs) are used most often, and recent reports suggest that manufacturers have improved the performance of EIA kits since their introduction; however, the disadvantages of EIAs include the lower levels of sensitivity and specificity compared to those of the gold standard methods. More importantly, culture is not specific for the identification of toxigenic strains. The laboratory at the Wadsworth Center has developed a multiplex real-time PCR assay and a tcdC gene pyrosequencing assay that rapidly identify potential virulence factors of C. difficile strains and that can be used to directly test patient stool specimens for C. difficile.(Part of this report was presented at the 107th American Society for Microbiology General Meeting in 2007 [Toronto, Canada].)     

Fecal microbiota transplantation for Clostridium difficile infection in Taiwan: Establishment and implementation

Clostridium difficile infection (CDI) remains a major public health issue, and fecal microbiota transplantation (FMT) has become one of the standard therapies for recurrent or refractory CDI. When compared to medical therapies, such as metronidazole or vancomycin, FMT has a high rate of treatment response with acceptable safety and efficiency. Following promulgation of the amendments in September 2018 in Taiwan, FMT has been indicated for recurrent or refractory CDI. The Taiwan Microbiota Consortium contributed to the Taiwan FMT Expert Consensus, which established basic norms and stipulated essential principles, including the indications for transplantation, eligible locations and personnel, donor screening policies, fecal sample handling, and post-FMT follow-up. However, establishing an eligible FMT team in a qualified hospital remains a clinical challenge, and the requirement for facilities and well-screened donors impedes the implementation of FMT. In this review, we aim to provide domestic FMT teams with explicit instructions to facilitate realization and increase the practice of FMT. Based on the Taiwan FMT Expert Consensus and current regulations, we performed a literature review and integrated the experiences of Taiwanese multidisciplinary experts into this article. The content intends to offer clinicians up-to-date evidence and highlight the essential points of FMT.     

Evaluation of Two Rapid Assays for Detection of Clostridium difficile Toxin A in Stool Specimens

Rapid laboratory diagnosis of Clostridium difficile-associated diarrhea (CDAD) is highly desirable in the setting of hospital cost containment. We tested 654 stool specimens to compare the performance of two assays for rapid detection of toxin A, the Immunocard Toxin A test (Meridian Diagnostics, Inc.) and the Culturette Brand Toxin CD enzyme immunoassay (EIA) (Becton Dickinson Microbiology Systems), with a cytotoxin assay (Cytotoxi Test; Advanced Clinical Diagnostics) and culture on cycloserine-cefoxitin-fructose agar followed by determination of the production of toxins A and B. A chart review was performed for patients whose stool specimens provided positive results on one to three of the assays. With the "gold standard" of all four assays positive or chart review evidence of CDAD, 97 (14.8%) stool specimens were positive by one or more assays and 557 (85.2%) were negative by all methods. Total agreement for all assays was 90.5% (592 of 654). The sensitivity, specificity, positive predictive value, and negative predictive value for toxigenic culture were 94.7, 98.6, 87.1, and 99.5%, respectively, for toxigenic culture; 87.7, 98.6, 86.2, and 98.8%, respectively, for the cytotoxin assay; 71.9, 99.3, 91.1, and 97.3%, respectively, for the Immunocard; and 68.4, 99.1, 88.6, and 96.9%, respectively, for the Culturette EIA. While easy to perform and highly specific, these rapid assays do not appear to be sufficient for accurate diagnosis of CDAD.     

Evaluation of the Fully Automated BD MAX Cdiff and Xpert C. difficile Assays for Direct Detection of Clostridium difficile in Stool Specimens

We evaluated the fully automated molecular BD MAX Cdiff assay (BD Diagnostics) and the Xpert C. difficile test (Cepheid) for rapid detection of Clostridium difficile infection. Culture was done on chromogenic agar followed by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometry identification and toxin detection. Repeat testing was required for 1.8% and 6.0% of the BD MAX and Xpert tests, respectively. Sensitivities, specificities, positive predictive values (PPV), and negative predictive values (NPV) were 90.5%, 97.9%, 89.3%, and 98.1%, respectively, for BD MAX and 97.3%, 97.9%, 90.0%, and 99.5%, respectively, for Xpert.     

Clostridium difficile infection

Clostridium difficile is an anaerobic species consisting of bacilli with large, oval, subterminal spores, normally found in intestines. It uses two toxins, which produce cytopathic changes in the intestinal mucosae, causing diarrhea. Patients can present a spectrum of disease that varies from uncomplicated antibiotic-associated diarrhea to life threatening antibiotic-associated pseudomembranous colitis. C. difficile is the only species. There are no defined sterotypes. Toxigenic and nontoxigenic strains exist. The former produce varying amounts of toxin A (enterotoxin) and toxin B (Cytotoxin). Broad spectrum antiboiotic therapy eliminates much competing normal flora, permitting intestinal overgrowth of toxigenic C. difficile. There are no defined host defenses. Metronidazole and vancomycin should be used therapeutically, however, relapses can occur. Supportive therepy may be needed.     

Evaluation of the Qiagen artus C. difficile QS-RGQ Kit for Detection of Clostridium difficile Toxins A and B in Clinical Stool Specimens

We compared the Qiagen artus C. difficile QS-RGQ kit, a new nucleic acid amplification test for the detection of Clostridium difficile toxins in stool specimens, with the Cepheid Xpert C. difficile test. The sensitivity, specificity, positive predictive value, and negative predictive value for the Qiagen artus C. difficile QS-RGQ test were 100%, 89.5%, 60.9%, and 100%, and those for the Cepheid Xpert C. difficile test were 100%, 90%, 62.2%, and 100%, respectively.     

Multicenter Clinical Evaluation of the Portrait Toxigenic C. difficile Assay for Detection of Toxigenic Clostridium difficile Strains in Clinical Stool Specimens

We compared the Portrait Toxigenic C. difficile Assay, a new semiautomated sample-to-result molecular test, to a toxigenic bacterial culture/cell cytotoxin neutralization assay (TBC/CCNA) for the detection of toxigenic Clostridium difficile in 549 stool specimens. Stool specimens were also tested by one of three alternative FDA-cleared molecular tests for toxigenic C. difficile (Xpert C. difficile, Illumigene C. difficile, or GeneOhm Cdiff). The sensitivities and specificities of the molecular tests compared to TBC/CCNA were as follows: 98.2% and 92.8% for the Portrait assay, 100% and 91.7% for the Xpert assay, 93.3% and 95.1% for the Illumigene assay, and 97.4% and 98.5% for the GeneOhm assay, respectively. The majority of Portrait false-positive results (20/31; 64.5%) were also positive for C. difficile by an alternative molecular test, suggesting an increased sensitivity compared to the culture-based “gold standard” method. The Portrait test detected an assay input of 30 CFU in 100% of spiked samples and detected an input of 10 CFU in 96.7% of samples tested.     

Clostridium difficile infections in China

Clostridium difficile (C. difficile) infection has become one of the major hospital-associated infections in Western countries in the last two decades. However, there is limited information on the status of C. difficile infection in Chinese healthcare settings. Given the large and increasing elderly population and the well-recognized problem of over-prescribing of broad spectrum antibiotics in China, it is critical to understand the epidemiology and potential risk factors that may contribute to C. difficile infection in China. A literature review of available published studies, including those in Chinese language-based journals, was conducted. A review of the currently available literature suggested the presence of C. difficile infections in China, but also suggested that these infections were not particularly endemic. This finding should lead to better designed and greatly expanded studies to provide a more reliable epidemiologically-based conclusion on the actual status of C. difficile infection in China, including the identification of any associated risk factors. Such information is ultimately valuable to develop appropriate strategies to prevent C. difficile infection and the vast negative impact of such infections in China and other developing countries.     

Clostridium difficile and One Health

BackgroundFor over four decades, Clostridium difficile has been a significant enteric pathogen of humans. It is associated with the use of antimicrobials that generally disrupt the microbiota of the gastrointestinal tract. Previously, it was thought that C. difficile was primarily a hospital-acquired infection; however, with the emergence of community-associated cases, and whole-genome sequencing suggesting the majority of the hospital C. difficile infection (CDI) cases are genetically distinct from one another, there is compelling evidence that sources/reservoirs of C. difficile outside hospitals play a significant role in the transmission of CDI.ObjectivesTo review the ‘One Health’ aspects of CDI, focusing on how community sources/reservoirs might be acting as a conduit in the transfer of C. difficile between animals and humans. The importance of a One Health approach in managing CDI is discussed.SourcesA literature search was performed on PubMed and Web of Science for relevant papers published from 1 January 2000 to 10 July 2019.ContentWe present evidence that demonstrates transmission of C. difficile in hospitals from asymptomatic carriers to symptomatic CDI patients. The source of colonization is most probably community reservoirs, such as foods and the environment, where toxigenic C. difficile strains have frequently been isolated. With high-resolution genomic sequencing, the transmission of C. difficile between animals and humans can be demonstrated, despite a clear epidemiological link often being absent. The ways in which C. difficile from animals and humans can disseminate through foods and the environment are discussed, and an interconnected transmission pathway for C. difficile involving food animals, humans and the environment is presented.ImplicationsClostridium difficile is a well-established pathogen of both humans and animals that contaminates foods and the environment. To manage CDI, a One Health approach with the collaboration of clinicians, veterinarians, environmentalists and policy-makers is paramount.     

Typing of Clostridium difficile

Clostridium difficile is primarily recognised as a nosocomially acquired pathogen manifesting in gastrointestinal disease subsequent to the patient receiving broad-spectrum antibiotics. Infection can be sporadic, but outbreaks commonly occur within a ward or hospital as a result of cross-infection. Since the 1980s, the epidemiology of C. difficile disease has been studied by the application of many different typing or fingerprinting methods; these, and the lessons learned, are reviewed herein.     

Clostridium difficile in haematological malignancy.

Twenty patients with haematological malignancies who developed Clostridium difficile bowel infection or colonisation are described. All isolates of C difficile were toxigenic in vitro and faecal cytotoxin (toxin B) was detected in 20/26 episodes. Ten of 20 episodes with detectable faecal cytotoxin were associated with typical antibiotic associated diarrhoea. In the other 10 episodes (nine patients), there was a severe unusual illness which was associated with detection of C difficile. The unusual features of the illness were pronounced jaundice (total bilirubin greater than or equal to 44 mumol/l), abdominal pain and distension, and initial constipation followed either by diarrhoea or by large bowel stasis. Four of these patients died within seven days. Bacteraemia was often a presenting feature in neutropenic patients subsequently shown to have C difficile. This was not the case in non-neutropenic patients. Bacteraemia was commonly polymicrobial and in two cases C difficile was isolated from blood culture. The clinical implications of recognition of this atypical C difficile associated syndrome are discussed.     

Clostridium difficile mixed infection and reinfection

Isolates from consecutive Clostridium difficile infection (CDI) fecal samples underwent multilocus sequence typing. Potential reinfections with different genotypes were identified in 88/560 (16%) sample pairs taken 1 to 1,414 days (median, 24; interquartile range [IQR], 1 to 52 days) apart; odds of reinfection increased by 58% for every doubling of time between samples. Of 109 sample pairs taken on the same day, 3 (3%) had different genotypes. Considering samples 0 to 7 days apart as the same CDI, 7% of cases had mixed infections with >1 genotype.     

Fecal lactoferrin, interleukin-1beta, and interleukin-8 are elevated in patients with severe Clostridium difficile colitis.

Twenty-two patients with Clostridium difficile colitis as determined by positive enzyme immunoassay for toxin A were evaluated for fecal inflammatory markers and their relationship to the severity of illness. Fourteen of 22 specimens were positive for fecal lactoferrin (FLF), with titers from 1:50 to 1:800. Nine of 10 stools tested had ratios of interleukin-1beta (IL-1beta) to IL-1 receptor antagonist (IL-1ra) of >0.01. Seventeen of 22 specimens also had elevated IL-8 concentrations, and 12 of 14 had elevated IL-1beta concentrations. A review of the 18 available patient records revealed that fecal IL-8 concentrations, IL-1beta/IL-1ra ratios, and FLF titers were significantly higher in patients with moderate to severe disease than in patients with mild disease. These findings suggest that the proinflammatory effects of C. difficile may directly influence clinical characteristics of human disease.