The human granulocyte-macrophage colony-stimulating factor gene is autonomously regulated in vivo by an inducible tissue-specific enhancer

The granulocyte-macrophage colony-stimulating factor (GM-CSF) gene is part of a cytokine gene cluster and is directly linked to a conserved upstream inducible enhancer. Here we examined the in vitro and in vivo functions of the human GM-CSF enhancer and found that it was required for the correctly regulated expression of the GM-CSF gene. An inducible DNase I-hypersensitive site appeared within the enhancer in cell types such as T cells, myeloid cells, and endothelial cells that express GM-CSF, but not in nonexpressing cells. In a panel of transfected cells the human GM-CSF enhancer was activated in a tissue-specific manner in parallel with the endogenous gene. The in vivo function of the enhancer was examined in a transgenic mouse model that also addressed the issue of whether the GM-CSF locus was correctly regulated in isolation from other segments of the cytokine gene cluster. After correction for copy number the mean level of human GM-CSF expression in splenocytes from 11 lines of transgenic mice containing a 10.5-kb human GM-CSF transgene was indistinguishable from mouse GM-CSF expression (99% +/- 56% SD). In contrast, a 9.8-kb transgene lacking just the enhancer had a significantly reduced (P = 0.004) and more variable level of activity (29% +/- 89% SD). From these studies we conclude that the GM-CSF enhancer is required for the correct copy number-dependent expression of the human GM-CSF gene and that the GM-CSF gene is regulated independently from DNA elements associated with the closely linked IL-3 gene or other members of the cytokine gene cluster.     

T-cell-specific expression of interleukin 2: evidence for a negative regulatory site.

To understand the basis for T-cell-specific induction of interleukin 2 (IL-2), we have analyzed nuclear factors from the Jurkat T-lymphoid leukemia cell, which can be induced to secrete IL-2. We have used an electrophoretic mobility shift assay to examine binding of proteins to the upstream regulatory region, before and after activation with mitogens. We find two types of binding sites. One resembles an inducible enhancer element, but the protein that recognizes it is found in non-T cells and is unlikely to determine T-cell-specific expression of IL-2. A second site negatively regulates expression in resting T cells. A complex that binds to a DNA fragment containing this site is modified only when IL-2 is expressed, and it lies near a specific inducible DNase hypersensitive region. We suggest that negative regulation at this site, mediated by its associated protein(s), may contribute to the cell-specific expression of IL-2.     

Differential regulation of colony-stimulating factors and interleukin 2 production by cyclosporin A.

Stimulation of T lymphocytes with mitogens or antigens is followed by proliferation and lymphokine production. Although cyclosporin A (CsA), an immunosuppressive drug, has been shown to inhibit the production of certain lymphokines, including interleukin 2 (IL-2), interleukin 3 (IL-3), and gamma-interferon, its effect on the production of granulocyte/macrophage colony-stimulating factor (GM-CSF) has not been evaluated. In the current study, concanavalin A (Con A)-stimulated murine spleen cells secreted GM-CSF, IL-3, and IL-2, and in the presence of CsA (0.1-1.0 micrograms/ml), IL-2 and IL-3 activities were inhibited. In contrast, significant activity was detected when the CsA-treated culture supernatants were assayed on a cell line that is dependent on GM-CSF and/or IL-3. Similar CsA-resistant activity was observed when the EL-4 thymoma cells were stimulated with a phorbol ester [phorbol 12-myristate 13-acetate (PMA)] in the presence of CsA. The activity resistant to CsA was identified as GM-CSF by the ability of specific antibodies against murine recombinant GM-CSF to neutralize its activity. These findings indicate that GM-CSF, in contrast to IL-2 and IL-3, was not inhibited by CsA. In additional experiments, transfer blot of poly(A)+ RNA isolated from PMA-induced EL-4 cells in the presence or the absence of CsA was hybridized with GM-CSF and IL-2 cDNA probes. Expression of the GM-CSF gene in EL-4 cells was detected independent of CsA, whereas CsA inhibited the expression of the IL-2 gene. The present data show that production of IL-2 and IL-3, but not that of GM-CSF, is inhibited by CsA and suggest a differential control mechanism for lymphokine synthesis in T lymphocytes.     

The Tpl-2 protooncoprotein activates the nuclear factor of activated T cells and induces interleukin 2 expression in T cell lines

Tpl-2 expression is induced within 30–60 min after ConA stimulation of rat splenocytes, suggesting that it may contribute to the induction of IL-2 during T cell activation. Herein we show that wild-type and carboxyl-terminally truncated (activated) Tpl-2 activate the nuclear factor of activated T cells (NFAT) and induce interleukin 2 (IL-2) expression in EL4 cells. In Jurkat cells the truncated Tpl-2 activates NFAT and induces IL-2, whereas wild-type Tpl-2 activates NFAT only when cotransfected with NFAT expression constructs, suggesting that Tpl-2 may induce NFAT activation signals. Experiments in NIH 3T3 cells revealed that the NFATp isoform, but not the NFATc or NFATx isoform, undergoes nuclear translocation when coexpressed with wild-type Tpl-2 and confirmed this hypothesis. Activation of NFAT by anti-CD3 stimulation but not by phorbol 12-myristate 13-acetate and ionomycin in Jurkat cells was inhibited by the kinase-dead Tpl-2K167M, suggesting that Tpl-2 contributes to the transduction of NFAT activation signals originating in the T cell receptor. The Tpl-2-mediated induction of IL-2 was not observed in T cell lymphoma lines other than EL4 and Jurkat, as well as in normal T cells. NFAT activation by Tpl-2, however, was observed in several cell lines including some of nonhematopoietic origin. The activation of NFAT by Tpl-2 in different cell types defines a molecular mechanism that may contribute to its oncogenic potential.     

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.     

Effect of deletion of 5''HS3 or 5''HS2 of the human beta-globin locus control region on the developmental regulation of globin gene expression in beta-globin locus yeast artificial chromosome transgenic mice.

To analyze the function of the 5' DNase I hypersensitive sites (HSs) of the locus control region (LCR) on beta-like globin gene expression, a 2.3-kb deletion of 5'HS3 or a 1.9-kb deletion of 5'HS2 was recombined into a beta-globin locus yeast artificial chromosome, and transgenic mice were produced. Deletion of 5'HS3 resulted in a significant decrease of epsilon-globin gene expression and an increase of gamma-globin gene expression in embryonic cells. Deletion of 5'HS2 resulted in only a small decrease in expression of epsilon-, gamma-, and beta-globin mRNA at all stages of development. Neither deletion affected the temporal pattern of globin gene switching. These results suggest that the LCR contains functionally redundant elements and that LCR complex formation does not require the presence of all DNase I hypersensitive sites. The phenotype of the 5'HS3 deletion suggests that individual HSs may influence the interaction of the LCR with specific globin gene promoters during the course of ontogeny.     

Effect of cyclosporin A on T cell clones from severe aplastic anemia: differential sensitivity of TNF and GM-CSF production.

In this study we have analyzed the activity of Cyclosporin A (CsA) on the "in vitro" production of TNF and IL-3/GM-CSF as a preliminary basis for explaining the successful use of CsA in aplastic patients. Thus, 73 T cell clones, obtained by a limiting dilution technique from the peripheral blood and bone marrow of 3 patients with severe aplastic anemia (SAA), were studied for TNF and IL-3/GM-CSF production as induced by stimulation with 1% PHA plus 1 ng/ml TPA. Lymphokines obtained in this manner were then tested by biological assays. Twelve out of the initial 73 T cell clones were selected for the production of a large quantity of IL-3/GM-CSF and/or TNF. With these clones we studied the ability of CsA to inhibit TNF and IL-3/GM-CSF production, which was stimulated with specific monoclonal antibodies directed against the CD2 and CD3 surface antigens. TNF and IL-3/GM-CSF production displayed a different sensitivity to CsA inhibition. In fact, at 400 ng/ml CsA a residual production of IL-3/GM-CSF was present in all clones tested (CD3: 21.8% and CD2: 14.4% of the maximal IL-3/GM-CSF activity), while secretion of TNF was virtually abrogated at 100 ng/ml. Moreover, the mean ID50 for TNF production was significantly lower than that of IL-3/GM-CSF (CD2: p = 0.028, CD3: p = 0.01). Using specific anti-IL-3 and anti-GM-CSF monoclonal antibodies, we showed that only GM-CSF, and not IL-3, was resistant to CsA inhibition. In conclusion, these results may represent a possible explanation of the successful use of CsA in the treatment of some patients with SAA.     

An erythroid-specific chromatin opening element reorganizes beta-globin promoter chromatin structure and augments gene expression.

In erythroid tissues the chromatin structure of the beta-globin gene locus is extensively remodeled. Changes include the formation of DNase I hypersensitive sites (HSs) over the promoters of actively expressed genes. To test the hypothesis that such "opening" of promoter chromatin structure is important for beta-globin gene expression, we placed a 101-bp erythroid-specific hypersensitive-site forming element (HSFE) from the core of LCR HS4 immediately upstream of a minimal beta-globin gene promoter. We then studied the effects of this element alone and in combination with other cis-acting elements on globin gene chromatin structure and gene expression in MEL cells and transgenic mice. Single or tandem HSFEs increased the size of the portion of the promoter accessible to DNase digestion, increased the proportion of promoters in an accessible conformation, and increased gene expression approximately 5-fold. These were equivalent to expression levels attained using a 2.8-kb microLCR construct. Inclusion of the LCR HS2 enhancer did not increase expression further. In transgenic mouse fetal liver cells the HSFE increased average expression 2.5-fold compared to the minimal promoter alone. These results indicate that a small cis-acting element is capable of remodeling local beta-globin promoter chromatin structure and producing expression similar to that seen with a microLCR construct.