Checklist for optimization and validation of real‐time PCR assays

Real‐time polymerase chain reaction (PCR) is a frequently used technique in molecular diagnostics. To date, practical guidelines for the complete process of optimization and validation of commercial and in‐house developed molecular diagnostic methods are scare. Therefore, we propose a practical guiding principle for the optimization and validation of real‐time PCR assays. Based on literature, existing guidelines, and personal experience, we created a checklist that can be used in different steps of the development and validation process of commercial and in‐house developed real‐time PCR assays. Furthermore, determination of target values and reproducibility of internal quality controls are included, which allows a statistical follow‐up of the performance of the assay. Recently, we used this checklist for the development of various qualitative and quantitative assays for microbiological and hematological applications, for which accreditation according to ISO 15189:2007 was obtained. In our experience, the use of the proposed guidelines leads to a more efficient and standardized optimization and validation. Ultimately, this results in reliable and robust molecular diagnostics. The proposed checklist is independent of environment, equipment, and specific applications and can be used in other laboratories. A worldwide consensus on this kind of checklist should be aimed at. J. Clin. Lab. Anal. 23:145–151, 2009. © 2009 Wiley‐Liss, Inc.     

Antibiograms and randomly amplified polymorphic DNA‐polymerase chain reactions (RAPD‐PCR) as epidemiological markers of gonorrhea

The development of antimicrobial resistance of Neisseria gonorrhoeae arising from wide dissemination of resistant clones is a major global health problem. In this study, a total of 235 isolates of N. gonorrhoeae isolated from patients of Bangrak Hospital were tested for their antibiotic susceptibilities to penicillin, norfloxacin, ofloxacin, ciprofloxacin, spectinomycin, and ceftriaxone. Mutation (Ser‐91) in the quinolone resistance determining regions of gyrA and random amplification of the polymorphic DNA polymerase chain reaction (RAPD‐PCR) were examined from 145 isolates. Among these, 55 isolates were obtained during January–March 2000, 46 isolates during January–March 2002, and 44 isolates during October–December 2002. The occurrence of combination resistance between penicillin and quinolone was 20% in January–March 2000, which was increased to 57.8% during the period of October–December 2002 (P<0.0001). Mutation of Ser‐91 in gyrA could be directly linked with the resistance or declining of susceptibility to ciprofloxacin. Using RAPD‐PCR, we could classify the 145 isolates into 4 and 5 groups by primers D11344 (5′‐AGTGAATTCGCGGTGAGATGCCA‐3′) and D8635 (5′‐GAGCGGCCAAAGGGAGCA GAC‐3′), respectively. Combination of the data obtained from these two primers produced 11 fingerprint groups. Our findings conclude that monitoring of the Ser‐91 mutation of gyrA and RAPD‐PCR methods are most useful for epidemiological screening. J. Clin. Lab. Anal. 24:31–37, 2010. © 2010 Wiley‐Liss, Inc.     

Prevalence and clinical significance of low‐avidity HPA‐1a antibodies in women exposed to HPA‐1a during pregnancy

BACKGROUND: Recent studies suggest that HPA‐1a–specific, low‐avidity maternal antibodies not detectable by conventional methods can cause neonatal alloimmune thrombocytopenia (NAIT). We performed studies to further define the incidence and clinical significance of this type of antibody. STUDY DESIGN AND METHODS: Surface plasmon resonance analysis was used to detect low‐avidity antibodies in HPA‐1a–negative, “antibody‐negative” mothers of suspected NAIT cases. The ability of antibodies detected to promote immune destruction of human platelets (PLTs) was examined in a newly developed NOD/SCID mouse model. RESULTS: Among 3478 suspected cases of NAIT, 677 HPA‐1a–negative mothers were identified. HPA‐1a–specific antibodies were detected by conventional antibody testing in 616 cases (91%). Low‐avidity HPA‐1a–specific antibodies were identified in 18 of the remaining 61 cases (9%). Clinical follow‐up on 13 cases showed that eight were referred because of suspected NAIT and five because the mother's sister had previously had an infant with NAIT. Only six infants born to the 13 sensitized mothers had clinically significant thrombocytopenia at birth. Three of four low‐avidity antibodies tested in the mouse caused accelerated clearance of HPA‐1a/a but not HPA‐1b/b PLTs. Only 3 of 12 mothers with low‐avidity HPA‐1a antibodies were positive for HLA‐DRB3*0101. CONCLUSIONS: The findings confirm previous reports that low‐avidity HPA‐1a antibodies can cause NAIT but show that the presence of such an antibody does not predict that an infant will be affected. The low incidence of HLA‐DRB3*0101 in this cohort (p < 0.0001) suggests that women negative for DRB3*0101 may be predisposed to produce low‐avidity HPA‐1a antibodies.     

Stability of hepatitis C virus RNA in blood samples by TaqMan real‐time PCR

The storage conditions of blood samples for reliable results are very important in hepatitis C virus (HCV) RNA amplification tests used in routine HCV analyses. According to many studies, storage conditions could affect the RNA stability for HCV RNA detection. We have studied HCV RNA stability in blood samples stored at 4°C. Nineteen blood samples containing different HCV RNA levels were stored at 4°C and they were then analyzed by TaqMAN real‐time PCR method. HCV RNA levels remained almost stable (100%) at least for five weeks at this storage condition. However, among them, the stability period was up to 11 weeks in two of the samples. As with these findings, there was a slightly significant correlation between the positivity time and the beginning HCV RNA levels (r=0.474, P=0.040). We conclude that, blood samples can be stored at 4°C for five weeks without any significant difference in detected HCV RNA level by using TaqMan real‐time PCR. J. Clin. Lab. Anal. 24:134–138, 2010. © 2010 Wiley‐Liss, Inc.