Identification of 9 novel IDS gene mutations in 19 unrelated Hunter syndrome (Mucopolysaccharidosis type II) patients

Hunter syndrome is an X-linked lysosomal storage disorder caused by a deficiency of the lysosomal enzyme iduronate-2-sulfatase (IDS). The IDS deficiency can be caused by several different types of mutations in the IDS gene. We have performed a molecular and mutation analysis of a total of 19 unrelated MPS II patients of different ethnic origin and identified 19 different IDS mutations, 9 of which were novel and unique. SSCP analysis followed by DNA sequencing revealed four novel missense mutations: S143F, associated with the 562C→T polymorphism, C184W, D269V and Y348H. Two novel nonsense mutations were found: Y103X (433C→A) and Y234X (826C→G). In two patients two novel minor insertions (421insA and 499insA) were identified. In one patient a complete IDS deletion was found, extending from locus DXS1185 to locus DXS466. © 1998 Wiley-Liss, Inc.     

Molecular analysis of Turkish mucopolysaccharidosis IVA (Morquio A) patients: identification of novel mutations in the N-acetylgalactosamine-6-sulfate sulfatase (GALNS) gene

Mucopolysaccharidosis IVA (MPS IVA) is a lysosomal storage disorder caused by the deficiency of N-acetylgalactosamine-6-sulfate sulfatase (GALNS; EC 3.1.6.4). The deficiency of N-acetylgalactosamine-6-sulfate sulfatase leads to lysosomal accumulation of undegraded glycosaminoglycans, keratan sulfate and chondroitin-6-sulfate. Mutation screening of the GALNS gene was performed by SSCP and direct sequence analyses using genomic DNA samples from 10 Morquio A patients. By nonradioactive SSCP screening, 6 different gene mutations and 2 polymorphisms were identified in 10 severely affected MPS IVA patients. Five of the mutations and one of the polymorphisms are novel. The vast majority of the gene alterations were found to be single nucleotide deletions (389delG, 929delG, and 763delT) or insertions (1232-1233insT). The other two mutations were one previously identified missense mutation (Q473X) and one novel nonsense (P179S) mutation. Together they account for 95% of the disease alleles of the patients investigated. Beside mutations, one previously identified E477 polymorphism and one novel W520 polymorphism were found among Turkish MPS IVA patients.     

Identification of 6 new mutations in the iduronate sulfatase gene. Mutation in brief no. 233. Online

Mucopolysaccharidosis type II (Hunter syndrome) is an X-linked lysosomal storage disorder caused by a deficiency of the enzyme iduronate-2-sulfatase. We sequenced genomic DNA and RT-PCR products in the iduronate sulfatase (IDS) gene in 6 unrelated patients with Hunter syndrome to assess genotype/phenotype relationships and offer carrier testing where required. Six novel mutations were identified: four missense mutations, one four-base pair deletion (596-599delAACA) and a cryptic splice site mutation. Three of the missense mutations were significant amino acid substitutions (S143F, S491F, E341K) of which the latter two involve amino acids conserved amongst sulfatase enzymes. The patients identified with these mutations all had a severe clinical phenotype. One missense mutation with a minimal amino acid substitution (H342Y), in a non-conserved region of the gene, was associated with a mild clinical phenotype. We identified a novel cryptic splice site (IVS5+934G>A) with some normal (wild type) mRNA processing. We predict that the normal mRNA product confered some residual functional enzyme, resulting in a mild phenotype associated with the absence of overt central nervous system disease.     

Identification of 6 new mutations in the iduronate sulfatase gene

Mucopolysaccharidosis type II (Hunter syndrome) is an X‐linked lysosomal storage disorder caused by a deficiency of the enzyme iduronate‐2‐sulfatase. We sequenced genomic DNA and RT‐PCR products in the iduronate sulfatase (IDS) gene in 6 unrelated patients with Hunter syndrome to assess genotype / phenotype relationships and offer carrier testing where required. Six novel mutations were identified: four missense mutations, one four‐base pair deletion (596‐599delAACA) and a cryptic splice site mutation. Three of the missense mutations were significant amino acid substitutions (S143F, S491F, E341K) of which the latter two involve amino acids conserved amongst sulfatase enzymes. The patients identified with these mutations all had a severe clinical phenotype. One missense mutation with a minimal amino acid substitution (H342Y), in a non‐conserved region of the gene, was associated with a mild clinical phenotype. We identified a novel cryptic splice site (IVS5+934G>A) with some normal (wild type) mRNA processing. We predict that the normal mRNA product confered some residual functional enzyme, resulting in a mild phenotype associated with the absence of overt central nervous system disease. © 1999 Wiley‐Liss, Inc.     

Two cases of steroid sulfatase deficiency with complex phenotype due to contiguous gene deletions

We report contiguous gene deletions in the distal short arm of the X chromosome in two patients with ichthyosis, due to steroid sulfatase deficiency, and other complex phenotypes. One patient had chondrodysplasia punctata (CDP) and ichthyosis with a normal chromosome constitution. Another patient had a CDP-like phenotype, ichthyosis, and hypogonadism. His karyotype was 46, -X,Y, +der(X)t(X;Y)(p22;q11). DNA from the two patients was analyzed by Southern blotting using cloned fragments mapped in the Xp21-Xpter region to investigate gene deletions. DNA from the patient with CDP showed a gene deletion of the STS, DXS31, and DXS89 loci, and DNA from the patient with X-Y translocation lacked fragments of the STS, DXS31, DXS89, and DXS143 loci. These findings suggest that the common deleted region involving the STS locus might have caused the similar phenotypes in both patients.     

Identification of recurrent and novel mutations in the LDL receptor gene in Spanish patients with familial hypercholesterolemia. Mutations in brief no. 135. Online

We used the single strand conformation polymorphism (SSCP) method to investigate 13 apparently unrelated Spanish patients with familial hypercholesterolemia (FH) for mutations in the promoter region and the 18 exons and their flanking intron sequences of the low density lipoprotein (LDL) receptor gene. We found 16 aberrant SSCP patterns, and the underlying mutations were characterized by DNA sequencing. Five novel missense mutations, Q71E, C74G, C95R, C281Y and D679E, and one nonsense mutation, Q133X, were identified. We also found six missense mutations, S156L, D200Y, D200G, E256K, T413K and C646Y, and one stop codon mutation, W(-18)X, that were previously described in patients from other populations. A new frameshift mutation, 2085del19, was found in one patient. We also identified three splicing mutations; two of them are novel mutations, 1706-10G->A and 2390-1G->A, and the other one has been reported recently, 313+1G->C. Four patients were found to carry two different mutations in the same allele: Q71E and 313+1G->C; C95R and D679E; W(-18)X and E256K, and C281Y and 1706-10G->A. Our results demonstrate that there is a broad spectrum of mutations in the LDL receptor gene in the Spanish population.     

Multipoint linkage of 9 anonymous probes to HPRT, factor 9, and fragile X

We have analyzed the segregation of restriction fragment length polymorphisms (RFLPs) associated with 9 anonymous probes detecting loci DXS10, DXS15, DXS19, DXS37, DXS51, DXS52, DXS98, DXS99, and DXS100 and probes for HPRT and F9 in a set of 40 families segregating fragile X (fra(X]. Using two-point and multipoint analysis, we have established their relative genetic locations. The results indicate that DXS99 and DXS10, unlike previous reports, are not tightly linked to F9. A new locus was found to map within the F9 - fra(X) region. DXS98 showed 6% recombination with fra(X) and appeared to be the closest locus to fra(X). These results will be useful for mapping the relative position of newly defined X probes in this region and for future genetic studies of families with fra(X), hemophilia B, or Lesch-Nyhan mutations.     

Mutation analysis of 19 North American mucopolysaccharidosis type I patients: Identification of two additional frequent mutations

Mucopolysaccharidosis type I (MPS I) is an autosomal recessive genetic disorder caused by deficiency of the lysosomal glycosidase α-L-iduronidase. Patients with this disorder present with varied clinical phenotypes ranging from early severe onset of disease and death in early childhood to mild manifestations compatible with adult life. An understanding of the molecular basis of iduronidase deficiency and its correlation to clinical phenotype will improve prognostic prediction at diagnosis, aid in genetic counselling of families, and provide a framework to more accurately assess experimental treatment protocols. We have used the approach of single-strand conformational polymorphism analysis and direct sequencing of the α-L-iduronidase gene in an attempt to define the molecular basis of iduronidase deficiency in affected individuals. An initial series of 19 patients representing 35 independently segregating mutant alleles were studied. In addition to five previously identified mutations (W402X, Q70X, E274X, H82P, and P533R) two novel mutations (A75T and 474-2a→g) were found. These seven mutations account for 71% of the mutant alleles and 53% of the genotypes in this group of patients. Analysis of a larger independently ascertained group of 103 MPS I patients, mainly of Northern European origin, revealed that together the two novel mutations account for 7% of mutant alleles and are associated with severe clinical phenotypes. These mutations are the most frequent MPS I mutations detected so far after W402X and Q70X. With the definition of these two mutations, a clear picture of the molecular heterogeneity of MPS I is emerging. © 1994 Wiley-Liss, Inc.     

Characterization of six novel mutations in the methylenetetrahydrofolate reductase (MTHFR) gene in patients with homocystinuria

Severe deficiency of methylenetetrahydrofolate reductase (MTHFR) is the most common inborn error of folate metabolism. Patients are characterized by severe hyperhomocysteinemia, homocystinuria and a variety of neurological and vascular problems. Eighteen rare mutations have been reported in this group of patients. Two polymorphisms which cause mild enzyme deficiencies have been described (677C-->T and 1298A-->C). The first sequence change encodes a thermolabile enzyme and is associated with mild hyperhomocysteinemia. Six novel point mutations are described in patients with severe deficiency of MTHFR, along with their associated polymorphisms and clinical phenotypes. Of the two nonsense mutations (1762A-->T, 1134C-->G) and four missense mutations (1727C-->T, 1172G-->A, 1768G-->A, and 358G-->A), one was identified in the N-terminal catalytic domain, while the others were located in the regulatory C-terminal region. All four residues affected by missense mutations are conserved in one or more MTHFRs of other species. This report brings the total to 24 mutations identified in severe MTHFR deficiency, with two mutations identified in each of 22 patients.     

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.     

Identification of fifteen novel mutations and genotype-phenotype relationship in Fabry disease

Fabry disease is an X-linked recessive disorder caused by a deficiency in the lysosomal enzyme alpha-galactosidase A, which results in a progressive multisystem disease. Most families have private mutations and no general correlation between genotype and disease manifestations has been described to date. Forty-nine patients (47 males and 2 females) from 36 affected families were selected for the study. Their evaluation included clinical examination, identification of alpha-galactosidase A gene mutations and residual enzymatic activity. For mutation detection, each exon with flanking intronic sequences was amplified by polymerase chain reaction (PCR) from the patient's genomic DNA and sequenced. Analysis of the resulting sequences was conducted to identify structural defects in the gene. Each of the Fabry patients carried a mutation in the alpha-galactosidase A gene. Fifteen mutations were novel. They included missense mutations (M51K, Y123M, G261D), nonsense point mutations (E251X) and small insertions or deletions creating a premature translational termination signal (P6X, D93X, W162X, K240X, H302X, I303X, L403X, S345X, G375X, F396X). Residual alpha-galactosidase A activity was significantly lower in patients with neuropathic pain (p=0.01) and in patients with mutations leading to a nonconservative amino acid change (p=0.04). Our findings emphasize the wide variety of genetic mechanisms leading to Fabry disease. A significant genotype-phenotype relationship was found.     

Severe phenotype in MPS II patients associated with a large deletion including contiguous genes

Hunter disease or mucopolysaccharidosis type II (MPS II) is an X-linked recessive lysosomal disorder caused by the deficiency of iduronate-2-sulfatase, which is involved in the catabolism of the glycosaminoglycans (GAGs) heparan and dermatan sulphate. Our aim was to analyze three patients with severe Hunter syndrome that showed a total deletion of the iduronate-2-sulphatase (IDS) gene, after exon by exon PCR. DNA was used as a template for PCR synthesis of IDS, FRAXA, FRAXE, and DXS1113 specific amplicons. The DNA analysis for all three patients demonstrated a complete deletion of IDS, FRAXA, and FRAXE contiguous genes. We further performed SNP-array to delineate the deletion breakpoints and to characterize the deletion extension in the different patients. The results indicated a ～9.4 Mb deletion in Patient 1, a ～3.9 Mb deletion of the Xq27.3-Xq28 and a ～3.1 Mb duplication of the X q28 region in Patient 2 and a ～41.8 Kb deletion in Patient 3. SNP-array was shown to be important to map for deletion breakpoints. A comprehensive molecular analysis in patients with Hunter syndrome, especially in the ones presenting the severe form, is important to the understanding of the genetic determinants of the phenotype and for the genetic counseling to be provided to the families.     

Lysosomal multienzymatic complex-related diseases: a genetic study among Portuguese patients

The functional activity of lysosomal enzymes sialidase, β-galactosidase and N-acetylaminogalacto-6-sulfate-sulfatase in the cell depends on their association in a multienzyme complex with cathepsin A. Mutations in any of the components of this complex result in functional deficiency thereby causing severe lysosomal storage disorders. Here, we report the molecular defects underlying sialidosis (mutations in sialidase; gene NEU1), galactosialidosis (mutations in cathepsin A; gene PPGB) and GM1 gangliosidosis (mutations in β-galactosidase; gene GLB1) in Portuguese patients. We performed molecular studies of the PPGB, NEU1 and GLB1 genes in biochemically diagnosed Portuguese patients. Gene expression was determined and the effect of each mutation predicted at protein levels. In the NEU1 gene, we found three novel missense mutations (p.P200L, p.D234N and p.Q282H) and one nonsense mutation (p.R341X). In the PPGB gene, we identified two missense mutations, one novel (p.G86V) and one already described (p.V104M), as well as two new deletions (c.230delC and c.991-992delT) that give rise to non-functional proteins. We also present the first molecular evidence of a causal missense mutation localized to the cathepsin A active site. Finally, in the GLB1 gene, we found six different mutations, all of them previously described (p.R59H, p.R201H, p.H281Y, p.W527X, c.1572-1577InsG and c.845-846delC). Seven novel mutations are reported here, contributing to our knowledge of the mutational spectrum of these diseases and to a better understanding of the genetics of the lysosomal multienzymatic complex. The results of this study will allow carrier detection in affected families and prenatal molecular diagnosis, leading to the improvement of genetic counseling.     

Novel mutations in African American patients with glycogen storage disease Type II. Mutations in brief no. 209. Online

The infantile form of GSD II (an inherited deficiency of the lysosomal enzyme, acid alpha-glucosidase, Pompe disease) is a severe and invariably fatal disease characterized by a rapidly progressive generalized hypotonia, hepatomegaly, and cardiomegaly. We have recently demonstrated that African American patients share a common nonsense R854X mutation in exon 18 (Becker et al., 1998). Two other mutations, D645E and M519V, have been identified in individual African American patients (Hermans et al., 1993a; Huie et al., 1994a). We describe here three novel mutations in this population group: a missense W481R in exon 10, a deletion of a T1441 in exon 10, and a splicing defect at the 5' donor site of intron 8 (IVS g+la) . The splicing defect is shared by two unrelated patients and it is linked to intragenic polymorphic sites identical to those found in patients bearing the common R854X mutation.     

The major allele of the alanine:glyoxylate aminotransferase gene: seven novel mutations causing primary hyperoxaluria type 1

We describe 7 novel mutations occurring on the major allele of the human AGT gene in patients with primary hyperoxaluria type 1, an autosomal recessive disease resulting from a deficiency of the liver peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT; EC 2.6.1.44). These mutations include 3 small deletions, 570delG, 744delC, and 983_988del, two splice junction mutations, IVS7-1G-->C and IVS8+1G-->T, and two nonsense mutations, R111X and W251X. We have also identified recurrences of previously identified reported mutations, 679-(IVS6+2)delAAgt, IVS8-3C-->G and 33insC. Deletion mutation 679-(IVS6+2)delAAgt has now been identified in a second Chinese patient and may be specific to that population. In contrast, 33insC has been found in patients of varying ethnic and racial backgrounds; a single vs multiple origin for this mutation is thus an intriguing question. It also appears to occur at a high frequency on the major allele. Five of the novel mutations were detected in patients who were compound heterozygotes for one of the common mis-targeting mutation, G170R or F152I, while the other two mutations occurred in the same patient.     

Molecular and phenotypic variation in patients with severe Hunter syndrome

Severe Hunter syndrome is a fatal X-linked lysosomal storage disorder caused by iduronate-2-sulphatase (IDS) deficiency. Patients with complete deletion of the IDS locus often have atypical phenotypes including ptosis, obstructive sleep apnoea, and the occurrence of seizures. We have used genomic DNA sequencing to identify several new genes in the IDS region. DNA deletion patients with atypical symptoms have been analysed to determine whether these atypical symptoms could be due to involvement of these other loci. The occurrence of seizures in two individuals correlated with a deletion extending proximal of IDS, up to and including part of the FMR2 locus. Other (non-seizure) symptoms were associated with distal deletions. In addition, a group of patients with no variant symptoms, and a characteristic rearrangement involving a recombination between the IDS gene and an adjacent IDS pseudogene (IDS psi), showed normal expression of loci distal to IDS. Together, these results identify FMR2 as a candidate gene for seizures, when mutated along with IDS.      

Five novel mutations of GALNS in Korean patients with mucopolysaccharidosis IVA

Mucopolysaccharidosis IVA (MPS IVA; OMIM #253000) is caused by the deficiency of N‐acetylgalactosamine‐6‐sulfate sulfatase (GALNS), a lysosomal enzyme involved in the catabolism of keratan and chondroitin sulfate. In this study, we examined biochemical and genetic data from 6 Korean patients presenting with classic MPS IVA by measuring GALNS activity in peripheral blood leukocytes and skin fibroblasts. We initially identified Korean patients with MPS IVA by clinical, biochemical, and genetic analyses. We performed PCR‐direct sequencing to identify molecular defects of the GALNS gene in patients and assessed the mutational statuses of family members as well as 50 healthy unrelated subjects. In silico analyses were performed to check for novel mutations. The mean age of the six female patients was 8.0 ± 5.2 years (range: 2–17 years), and were all found to have severe reductions of GALNS enzyme. A total of 12 mutant alleles were identified, corresponding to 7 different mutations. Five novel mutations were c.218A>G (p.Y73C), c.451C>A (p.P151T), c.725C>G (p.S242C), c.752G>A (p.R251Q), and c.1000C>T (p.Q334X). Two other mutations were c.1156C>T (p.R386C) and c.1243‐1G>A. Two mutations, c.451C>A and c.1000C>T, accounted for 58% of all mutations in this sample. © 2013 Wiley Periodicals, Inc.     

Identification of the molecular defects in Spanish and Argentinian mucopolysaccharidosis VI (Maroteaux-Lamy syndrome) patients, including 9 novel mutations

Maroteaux-Lamy syndrome, or mucopolysaccharidosis VI (MPS VI), is an autosomal recessive lysosomal storage disorder caused by a deficiency of N-acetylgalactosamine-4-sulfatase or arylsulfatase B (ARSB). We aimed to analyze the spectrum of mutations responsible for the disorder in Spanish and Argentinian patients, not previously studied. We identified all the ARSB mutant alleles, nine of them novel, in 12 Spanish and 4 Argentinian patients. The new changes were as follows: six missense mutations: c.245T>G [p.L82R], c.413A>G [p.Y138C], c.719C>T [p.S240F], c.922G>A [p.G308R], c.1340G>T [p.C447F] and c.1415T>C [p.L472P]; one nonsense mutation: c.966G>A [p.W322X]; and two intronic changes involving splice sites: c.1142+2T>A, in the donor splice site of intron 5, which promotes skipping of exon 5, and c.1143-1G>C, which disrupts the acceptor site of intron 5, resulting in skipping of exon 6. We also report 10 previously described mutations as well as several non-pathogenic polymorphisms. Haplotype analysis indicated a common origin for most of the mutations found more than once. Most of the patients were compound heterozygotes, whereas only four of them were homozygous. These observations confirm the broad allelic heterogeneity of the disease, with 19 different mutations in 16 patients. However, the two most frequent mutations, c.1143-1G>C and c.1143-8T>G, present in both populations, accounted for one-third of the mutant alleles in this group of patients.