Involvement of cyclophilin B in the replication of Japanese encephalitis virus

Japanese encephalitis virus (JEV) is a mosquito-borne RNA virus that belongs to the Flaviviridae family. In this study, we have examined the effect of cyclosporin A (CsA) on the propagation of JEV. CsA exhibited potent anti-JEV activity in various mammalian cell lines through the inhibition of CypB. The propagation of JEV was impaired in the CypB-knockdown cells and this reduction was cancelled by the expression of wild-type but not of peptidylprolyl cis-trans isomerase (PPIase)-deficient CypB, indicating that PPIase activity of CypB is critical for JEV propagation. Infection of pseudotype viruses bearing JEV envelope proteins was not impaired by the knockdown of CypB, suggesting that CypB participates in the replication but not in the entry of JEV. CypB was colocalized and immunoprecipitated with JEV NS4A in infected cells. These results suggest that CypB plays a crucial role in the replication of JEV through an interaction with NS4A.     

Lactate dehydrogenase-elevating virus replication, maturation, and viral RNA synthesis in primary mouse macrophage cultures.

High titers of lactate dehydrogenase-elevating virus (LDV) are obtained after infection of 1-day primary peritoneal mouse macrophage cultures. The capacity of these cells to support LDV replication, however, progressively decreases as the cells age. Almost no replication occurs in 7-day cultures, in spite of the fact that the cells are viable and metabolically active, though nondividing. Mitotically active cultures of simian virus 40 (SV40)-transformed macrophages also fail to support LDV replication. The synthesis of LDV-specific RNA was studied by labeling infected 1-day macrophage cultures with [5-³H]uridine in the presence of actinomycin D. The synthesis of single-stranded 48 S viral RNA and RNase-resistant 27 S RNA commence between 4 and 5 hr after infection, and the first mature virions are released between 5 and 6 hr. The time period between synthesis of viral RNA and its appearance in mature extracellular virions is about 1.5 hr. The induction of viral RNA synthesis is completely inhibited by treatment of cells with cycloheximide 0.5 hr after infection.Electron microscopic examination of thin sections of infected macrophages shows that LDV matures by budding from the cytoplasm into intracytoplasmic vesicles. Mature virions seem to be rapidly released into the culture fluid by an as yet unknown mechanism.     

In vitro synthesis of Japanese encephalitis virus (JEV) RNA: membrane and nuclear fractions of JEV-infected cells possess high levels of virus-specific RNA polymerase activity

Japanese encephalitis virus (JEV)-specific RNAs (including 42S RNA) were synthesized in subcellular fractions prepared from infected C6/36 cells. This in vitro RNA synthesis essentially required Mg2+ and four ribonucleotides, and it was enhanced by K+. The amounts of RNA synthesized in vitro (in extracts from JEV-infected cells) increased as a function of time after infection. The RNA-synthetic activity in nuclear fractions was the highest among three kinds of subcellular fractions. Our data showed that nonstructural proteins NS3 and NS5 were membrane-associated proteins. In particular, NS3 was found almost exclusively in the nuclear and membrane fractions. Our results suggest that NS5 and NS3 may play specific role(s) in flavivirus RNA replication.     

Japanese encephalitis virus replication: Studies on host cell nuclear involvement

Replication, as measured by virus production, of both the flavivirus Japanese encephalitis virus (JEV) and the alphavirus Venezuelan encephalitis virus (VEV) was unaffected by short pulses of actinomycin D (act D) at early times postinfection (PI). Replication of JEV was found to be partially inhibited by continuous exposure to act D under conditions where VEV replication was equally sensitive to the drug. JEV replication proceeded normally in the presence of mitomycin C, a DNA synthesis inhibitor. Autoradiographic analysis revealed that virus-specific RNA was present only in the cytoplasm at both early and late times PI. When infected cell membranes were separated on a discontinuous sucrose gradient, most of the virus-specific RNA was associated with the endoplasmic reticulum fraction.     

Metabolic and morphological changes inA. albopictus cells infected with Mayaro virus under heat-shock conditions

Summary We addressed the question how temperature elevation inhibits Mayaro virus replication inAedes albopictus infected cells. The morphology and macromolecular changes induced by temperature, infection and high serum concentration were investigated in these cells. Cells incubated with 2 and 10% serum at 28°C disclosed an intense vacuolization and inhibition of [³⁵S]methionine incorporation in a time-dependent manner. 34 and 50 kDa viral structural proteins were detected 24 h after infection. In contrast, an inhibition of viral proteins synthesis occurred when infected cells were kept at 37°C (heat-shock conditions). Total cellular RNA was isolated from mock and infected cells incubated at 28 or 37°C. Northern blot analysis with a Mayaro genomic probe coding for viral structural proteins showed a decrease in the amount of viral 26S RNA in stressed cells when compared to those kept at 28°C. Taken together, these results suggest that the inhibition of viral proteins synthesis in response to temperature elevation is associated with a decrease in the amount of subgenomic 26S RNA.     

Isolation and characterization of double stranded RNA containing infectious viral genome RNA from cells infected with Semliki Forest virus

Summary A double stranded virus specific RNA sedimenting at about 19S on sucrose density gradients has been isolated from BHK-21 cells infected with Semliki Forest virus (SFV). The molecule consists of double stranded RNA (ds RNA) since it is labeled with³H-uridine, is souble in 2m LiCl, resistant against treatment with DNase and RNase at 2×SSC, hydrolyzed by alkali treatment, has a sharp thermal melting point at 89° in 1/10 SSC, and an extended appearance under non denaturing conditions in the electronmicroscope. The following findings show that it consists of intact, infectious 42S RNA similar or identical to the genome RNA of SFV complexed to a complementary 42S minus strand RNA: 1. Denaturation converts the ds RNA into molecules cosedimenting with 42S RNA isolated from SFV particles. 2. About 50 per cent of the radioactivity of³H-uridine labeled 42S RNA molecules generated from 19S ds RNA by denaturation hybridizes to 42S viral RNA. 3. The specific infectivity of denatured 19S ds RNA is about half of that of similarly treated viral 42S RNA. Further properties of this molecule are discussed.With 5 Figures     

Comparative studies on nucleic acid synthesis and virus-induced RNA polymerase activity in mammalian cells infected with certain arboviruses

Summary Variations in the metabolism of African green monkey (AGMK) and stable porcine kidney (PS) cells infected with certain arboviruses were investigated. Virus-directed RNA synthesis and RNA polymerase activity were stimulated in actinomycin-treated infected cells. The rate of³H-uridine incorporation into RNA in Western equine encephalitis (WEE) virus-infected AGMK cells reached a maximum at approximately 5 hours after infection. In contrast, the viral RNA synthesis induced by Japanese encephalitis (JE) or dengue virus did not increase appreciably during the first 15 hours, and a maximum was reached from 24 to 30 hours after infection. Cytoplasmic large- and small-particle fractions from cells infected with WEEV or JEV were found to catalyze the incorporation of 4 nucleoside triphosphates into acid-insoluble products. In WEEV-infected AGMK cells, the enzyme activity was associated almost solely with the small-particle fraction, whereas nuclear and large-particle fractions of JEV-infeeted cells still contained 15 to 30% of the total enzyme activity 24 hours after infection. Rapid inhibition of cellular DNA synthesis was observed 4 hours after infection, with each of the three kinds of arbovirus used. Heat-inactivated WEEV was unable to suppress host cell DNA synthesis appreciably, whereas infection by UV-irradiated virus did result in a clear inhibition of DNA synthesis. However, the effect was apparently less marked than that of the active WEE virus.     

Restriction of vesicular stomatitis virus in a nonpermissive rabbit cell line is at the level of protein synthesis

Replication of vesicular stomatitis virus (VSV) is restricted in a line of rabbit cornea (RC-60) cells; less than one infectious particle is produced per infected cell. We show that VSV is blocked at the level of viral-specific protein synthesis. VSV proteins are synthesized early in infection but the rate of VSV protein synthesis declines rapidly as infection proceeds. At times when synthesis of VSV proteins is barely detectable, VSV mRNA is produced and polyribosome structures are present. The VSV mRNA recovered from the polysome region directs the synthesis of VSV proteins in an in vitro reticulocyte translation system. This suggests that protein synthesis is blocked at some step beyond the level of initiation possibly at the level of elongation. Coinfection with vaccinia virus converts RC-60 cells to a permissive host. In contrast to the abortive infection with VSV alone, VSV proteins are synthesized throughout the replication cycle in doubly infected cells. Vaccinia supplies a product essential for sustained protein synthesis in the abortive system. We have confirmed that the replication of genome length 42 S RNA does not occur at late times in the abortive infection. This lack of 42 S RNA replication is explained by the shut-off of VSV protein synthesis, since continuous protein synthesis is required for the replication of VSV 42 S RNA.     

A specific and sensitive antigen capture assay for NS1 protein quantitation in Japanese encephalitis virus infection

Japanese encephalitis virus (JEV) is a human pathogenic, mosquito-borne flavivirus that is endemic/epidemic in Asia. JEV is rarely detected or isolated from blood or cerebrospinal fluid (CSF), and detection of IgM is generally diagnostic of the infection. The flavivirus nonstructural glycoprotein NS1 is released transiently during flavivirus replication. The aim of this study was to set up a quantitative JEV NS1 antigen capture assay. A soluble hexameric form of JEV NS1 protein was produced in a stable Drosophila S2 cell clone and purified from supernatant fluids. Two IgG1 monoclonal antibodies (MAbs) with high affinity against two different epitopes of JEV NS1 antigen were used to develop an antigen-capture assay with a limit of detection of 0.2 ng ml⁻¹ NS1. Up to 1 μg ml⁻¹ JEV NS1 protein was released in supernatants of mammalian cells infected with JEV but <10 ng ml⁻¹ was released in sera of virus-infected mice before the onset of encephalitis and death. Moreover, NS1 protein was detected at low levels (<10 ng ml⁻¹) in 23.8% of sera and in 10.5% of CSF of patients diagnosed as IgM-positive for JEV. This quantitative test of NS1 protein is proposed for highly specific diagnosis of acute infection with JEV genotypes I to IV.     

Association of virus specific replicative ribonucleic acid with nuclear membrane in chick embryo cells infected with japanese encephalitis virus

Using high resolution electron microscopic autoradiography and velocity sedimentation, RNA synthesis was examined in chick embryo cells infected with Japanese encephalitis virus (JEV). RNA was labelled with 3H-uridine for 5 min or 10 min at 15 h after infection in the presence of actinomycin D and D-glucosamine. Microautoradiography showed significantly numbers of silver grains on the nuclear membranes of 5 min pulse-labelled thin cell sections. The RNA species in membrane fractions obtained from the nucleus and cytoplasm of the infected cells were analysed by sucrose density gradient sedimentation. Radioactive 23S replicative form RNA and 8-12S RNA were obtained from the outer membrane fractions of the nuclear envelope. Labelled 42S virus RNA was obtained from the fractions containing large vesicle membranes and plasma membranes. These results suggest that JEV-RNA synthesis is initiated in the perinuclear region in close association with the outer membranes of the nuclear envelope.     

Biochemical and physiological studies of certain ticks (ixodoidea)

Summary Protease activity cycles following the bloodmeal are demonstrated in both sexes of Argas (Persicargas) persicus and A. (P.) arboreus. Increased protease activity immediately after feeding indicates the presence of an inert, readily activated precursor molecule. Further increases are caused by enzyme synthesis. The male activity cycle is similar in both species, but is shorter in persicus A. than in A. arboreus. In A. persicus, the cycle is longer in the female than in the male. High activity lasts 12 days in the mated female and more than 3 weeks in the unmated female. There is a close relationship between unfed tick weight, bloodmeal size, and protease activity. Protease increase immediately after feeding affects the survival and multiplication of piroplasms, rickettsia, and viruses in the tick and is discussed in connection with the early multiplication cycles of microorganisms in tick gut cells.From Research Project MF 12.524.009-3010 B, Bureau of Medicine and Surgery, Department of the Navy, Washington, D.C. The opinions and assertions contained herein are the private ones of the authors and are not to be construed as official or as reflecting the views of the Department of the Navy or of the naval service at large. This work was supported in part by U.S.N. Contract N00014-71-C00064 with the University of Maryland School of Medicine, Baltimore, and by Agreement 03-016-1 between the National Institute of Allergy and Infectious Diseases (National Institutes of Health) and NAMRU-3.     

Sendai virus RNA synthesis and nucleocapsid formation in the presence of cycloheximide

The effect of cycloheximide on viral specific RNA synthesis and viral nucleocapsid formation was studied in chick embryo cells infected with Sendai virus. When cells were infected at a high multiplicity in the presence of cycloheximide, the 18 S and 35 S viral specific RNAs but not the 57 S (virion) RNA were synthesized during a 90-min period indicating that new protein synthesis is not necessary for the initiation of synthesis of the two smaller RNAs. When cells were treated with cycloheximide 18 hr after infection at the time of maximum viral specific RNA synthesis, the rate of synthesis of the 57 S RNA decreased much more rapidly than synthesis of the 35 S and 18 S RNAs. At the same time after infection, newly synthesized 57 S RNA continued to be converted to viral nucleocapsid in the presence of cycloheximide and the rate of incorporation of uridine-5′-³H into nucleocapsid decreased in parallel with the decrease in 57 S RNA synthesis. This indicates that nucleocapsid assembly continues in the absence of active protein synthesis.     

High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier

Summary A method, using LiAc to yield competent cells, is described that increased the efficiency of genetic transformation of intact cells of Saccharomyces cerevisiae to more than 1 × 10⁵ transformants per microgram of vector DNA and to 1.5% transformants per viable cell. The use of single stranded, or heat denaturated double stranded, nucleic acids as carrier resulted in about a 100 fold higher frequency of transformation with plasmids containing the 2m origin of replication. Single stranded DNA seems to be responsible for the effect since M13 single stranded DNA, as well as RNA, was effective. Boiled carrier DNA did not yield any increased transformation efficiency using spheroplast formation to induce DNA uptake, indicating a difference in the mechanism of transformation with the two methods.     

Terminal sequences of Sindbis virus-specific nucleic acids: Identity in molecules synthesized in vertebrate and insect cells and characteristic properties of the replicative form RNA

The terminal sequences of the virus-specific nucleic acids synthesized in BHK vertebrate cells and in Aedes albopictus insect cells infected with the alphavirus Sindbis virus have been analyzed. The 26 S and 42 S plus-strand RNA molecules have the 5′-terminal sequences m⁷GpppAUAG and m⁷GpppAUAGGCGGCGUAGUACACAC, respectively. A 22 S replicative form (RF) RNA which contains an infectious 42 S plus-strand genome RNA molecule and a complementary 42 S negative-strand RNA accumulates in infected cells. The 5′-terminal sequence of the 42 S plus-strand RNA component of the RF is identical to that of the single-stranded plus-strand 42 S RNA molecule except for the absence of a 5′-terminal cap in the constituent of the RF RNA. The identification of a poly(U) sequence at the 5′-terminus of the 42 S minus strand RNA in our experiments is in accordance with earlier results obtained in other laboratories (Sawicki and Gomatos, 1976; Frey and Strauss, 1978). Analogous to our data concerning the structure of the RF RNA of the alphavirus Semliki Forest virus (Wengler et al., 1979) the 3′-terminus of the 42 S minus strand RNA component of the Sindbis virus-specific RF RNA is complementary to the 5′-terminus of the 42 S plus strand RNA molecule but in addition contains a 3′-terminal extra unpaired guanosine residue. The 3′-terminal sequence of the 42 S minus strand is strongly conserved between the two alphaviruses, Sindbis virus and Semliki Forest virus. The terminal sequences of the RF RNA synthesized in BHK and Aedes albopictus cells are identical. Analyses of the capped oligonucleotides derived from virus-specific single-stranded 42 S plus-strand RNA and from 26 S RNA strongly indicate that no base sequence differences exists between the corresponding molecules synthesized in either vertebrate or insect cells. Possible implications of these findings concerning the structure of alphavirus RF RNA and the synthesis of alphavirus-specific nucleic acids are discussed.     

Studies on the adaptation of mumps virus to chick embryo

About 15 serial passages of wild type mumps virus (Sasazaki strain) in the amnion sac of chick embryo (CE) yielded a CE-adapted strain which was poorly replicative and did not form plaques in Vero cells where the wild strain grew well. In the course of this limited replication of the CE-adapted strain in Vero cells, we have analysed the viral protein and RNA synthesis. It was found that protein synthesis took place very efficiently at least early in infection by 12 h. The subsequent rate of synthesis remained, however, at a low level without showing the progressively increasing synthesis observed with the wild strain. Furthermore, 50S genomic RNA was synthesized early in the limited infection, but the subsequent synthesis was markedly suppressed. In addition, the other virus-specific RNA species could not be detected throughout. Thus the amplified RNA synthesis observed in the permissive CE cells and in the wild strain-infection of Vero cells seemed not to occur in the limited replication. Neither interferon nor DI (defective interfering) RNA was involved in the limited virus growth. When Vero cells were infected with the wild strain 6 to 8 h before inoculation of CE-adapted strain, growth restriction was overcome and the yield of the latter virus was greatly enhanced by a factor more than 10³. These results suggest that through adaptation to CE, mumps virus may be altered in such a way that there is a restriction, probably at a step (s) involved in amplification of the viral RNA synthesis in Vero cells and that the restriction may be overcome by the simultaneous genome expression of the prototype wild strain.     

A spontaneous temperature sensitive mutant of Japanese encephalitis virus: Preliminary characterization

Summary A spontaneously arising temperature sensitive (ts) mutant of Japanese encephalitis virus (JEV),ts 104, was isolated from chick fibroblast (CF) cell cultures of JEV strain M1/311. Straints 104 was plaque purified and characterized to ascertain its potential as a candidate for a live vaccine. Parameters of its growth, temperature lability, immunogenicity and virulence were examined.Ts 104 has been shown to be a stablets JEV strain, multiplying as well as the parent strain in CF cultures at 35° C, but not multiplying at 39° C. It was avirulent for embryonated chicken eggs incubated at 39° C and of reduced virulence for intracerebrally (i. c.) inoculated mice as measured by LD₅₀ in weanling mice and average day of death in weanling and suckling mice. Intraperitoneal injection of adult mice with either parent orts strain resulted in similar levels of protection against challenge with either strain. The potential ofts 104 as a candidate live JEV vaccine strain is discussed.With 1 FigureDisclaimers: Supported by Naval Medical Research and Development Command, Navy Department, Research Task No. MF 51.524.009.0067. The opinions and statements contained herein are the private ones of the writer and are not to be construed as official or reflecting the views of the Navy Department or the naval service at large.The animals used in this study were handled in accordance with the provisions of Public Law 89–44 as amended by Public Law 91–579, the Animal Welfare Act of 1970 and the principles outlined in the Guide for the Care and Use of Laboratory Animals, U.S. Department of Health, Education and Welfare Publication No. (NIH) 73–23.     

Japanese encephalitis virus infection of mouse cell lines: ability to prime mice for generation of virus specific cytotoxic T lymphocytes and differences in CTL recognisable viral determinants

Summary Ten different mouse cell lines were examined for Japanese encephalitis virus (JEV) infection in vitro and then tested for their ability to generate virus specific cytotoxic T lymphocytes (CTL). Among all cell lines examined, Neuro 2a (a neuroblastoma) was readily infected with JEV as examined by immunofluorescence and viral replication. Among other cells, P388D1, RAW 264.7 (Macrophage origin), Sp2/0 (B-cell Hybridoma), YAC-1 (T-cell lymphoma), and L929 (Fibroblast) were semipermissive to JEV infection. The cytopathic effects caused by progressive JEV infection varied from cell line to cell line. In the case of YAC-1 cells long-term viral antigen expression was observed without significant alterations in cell viability. Intermediate degrees of cytopathicity are seen in RAW 264.7 and L929 cells while infection of PS, Neuro 2a, P388D1 and Sp2/0 caused major viability losses. All infected cell lines were able to prime adult BALB/c (H-2^d) mice for the generation of secondary JEV specific CTL. In contrast to YAC-1, the permissive neuroblastoma cell line Neuro 2a (H-2K^kD^d) was found to be least efficient in its ability to stimulate anti-viral CTL generation. Cold target competition studies demonstrated that both Neuro 2a and YAC-1 (H-2K^kD^d) cells expressed similar viral determinants that are recognised by CTL, suggesting that the reason for the lower ability of Neuro 2a to stimulate anti-viral CTL was not due to lack of viral CTL determinants. These findings demonstrate that a variety of mouse cell lines can be infected with Japanese encephalitis virus, and that these infected cells could be utilised to generate virus specific CTL in BALB/c mice.     

Nucleic acid synthesis during the focus formation by Shope fibroma virus on green monkey kidney cells

Summary Nucleic acid synthesis during the focus formation on Shope fibroma virus (SFV)-infected cells was studied. When African green monkey kidney (AGMK) cells were infected with SFV, the cell-focus was observed as a local piling up of cells at 3 to 5 days after infection. The number of foci increased in proportion to the size of the SFV inoculum. In the SFV-AGMK cell system, however, the growth rate of virus was comparatively low and no apparent cytopathic effect was demonstrated as a result of virus infection. The incorporation of³H-thymidine into the nuclear fraction of infected cells was suppressed early in the cycle of virus replication and before focus formation. On the other hand, the rate of DNA synthesis increased markedly in the infected cytoplasm. Cytoplasmic RNA synthesis also tended to increase gradually accompanying the induction of the viral DNA synthesis. In addition, the sedimentation properties of the newly synthesized DNA were investigated by sucrose density gradient centrifugation.