Expression and function of the human granulocyte-macrophage colony- stimulating factor receptor alpha subunit

To determine the expression and function of the granulocyte-macrophage colony-stimulating factor (GM-CSF) receptor alpha chain (GMR alpha) during hematopoiesis and on leukemic cells, monoclonal antibodies were raised by immunizing mice with cells expressing high levels of human GMR alpha. A pool of five antibodies isolated from three different mice was used to characterize GMR alpha. This antibody pool (anti-GMR alpha) immunoprecipitated a protein with the expected molecular weight of GMR alpha from COS cells transiently transfected with the GMR alpha gene. In factor-dependent cells, GMR alpha existed as a phosphoprotein. However, its phosphorylation was not stimulated by the presence of GM- CSF. Anti-GMR alpha inhibited the GM-CSF-dependent growth of cell lines and normal bone marrow cells and inhibited the binding of iodinated GM- CSF to its receptor. Cell surface expression of GMR alpha was examined using anti-GMR alpha and flow cytometry. GMR alpha was readily detectable on both blood monocytes and neutrophils. In adherence- depleted normal bone marrow, two separate populations expressed GMR alpha. The most positive cells were predominantly macrophages, whereas the cells that expressed less GMR alpha were largely myelocytes and metamyelocytes. A small population of lin-CD34+ or CD34+CD38- cells also expressed GMR alpha, but they were not capable of significant growth in colony-forming assays. In contrast, the majority of lin-CD34+ and CD34+CD38- cells were GMR alpha-, yet they produced large numbers of myeloid and erythroid colonies in the same assay. Malignant cells from patients with leukemia were also tested for GMR alpha expression. All of the myeloid leukemias and only rare lymphoid leukemias surveyed tested positive for GMR alpha. These results show that anti-GMR alpha is useful for the functional characterization of the GMR alpha and for the detection of myeloid leukemia and that GMR alpha is expressed on certain lineages throughout hematopoietic development; however, progenitors that express the receptor may have a reduced capacity to proliferate in response to hematopoietic growth factors.     

Characterization of the clinical effects after the first dose of bacterially synthesized recombinant human granulocyte-macrophage colony- stimulating factor

Bacterially synthesized recombinant human granulocyte-macrophage colony- stimulating factor (rhGM-CSF) is an agent with therapeutic potential for neutropenic states, but even at doses below the maximal tolerated dose adverse effects occur during short courses of administration. We have recognized a syndrome of hypoxia and hypotension that follows the first but not subsequent doses of rhGM-CSF. Thirteen of 42 patients receiving rhGM-CSF in phase I studies and 4 of 6 patients in a phase II study developed a reaction that occurred after the first dose of 24 of 78 cycles of rhGM-CSF therapy. The reaction was characterized by flushing (16 of 24), tachycardia (16 of 24), hypotension (14 of 24), musculoskeletal pain (13 of 24), dyspnea (12 of 24), nausea and vomiting (11 of 24), rigors (5 of 24), involuntary leg spasms (3 of 24), and syncope (3 of 24). The reaction did not occur after any of more than 600 second and subsequent consecutive rhGM-CSF doses. Oxygen saturation decreased during first-dose reactions by 8% +/- 4% as compared with 3% +/- 1% on first days without reactions (P less than .001) and 2% +/- 1% on subsequent days (P less than .001). Pulmonary dysfunction was characterized by hypoxemia (59 +/- 9 mm Hg, mean +/- SD) that was fully correctable with supplementary oxygen, decreased single-breath carbon monoxide diffusion capacity, and increased alveolar-arterial oxygen gradients (25 +/- 6 to 60 +/- 4 mm Hg, mean +/- SD), but no significant abnormalities on chest roentgenogram or lung perfusion scan. Factors predisposing to reactions were rhGM-CSF dose greater than or equal to 3 micrograms/kg (P less than .01), intravenous (IV) rather than subcutaneous (SC) administration (P less than .05), occurrence of a reaction after the first dose of a previous cycle of rhGM-CSF therapy (P less than .01), and for patients receiving 15 micrograms/kg/d by SC bolus, the presence of lung cancer (P less than .05). Administration of 15 micrograms/kg/d rhGM-CSF by 24-hour SC infusion rather than SC bolus resulted in a delayed onset of reaction from 30 +/- 8 minutes to 240 +/- 190 minutes (mean +/- SD, P less than .001), and a slower rate of initial transient decrease in neutrophil levels and a more prolonged duration of transient leukopenia. The time of onset of reactions correlated with the rate of rise of rhGM-CSF levels.(ABSTRACT TRUNCATED AT 400 WORDS)     

Macrophage colony-stimulating factor and granulocyte-macrophage colony- stimulating factor stimulate the synthesis of plasminogen-activator inhibitors by human monocytes

Macrophage colony-stimulating factor (M-CSF or CSF-1) and granulocyte- macrophage CSF (GM-CSF) have been shown to increase human monocyte urokinase-type plasminogen-activator (u-PA) activity with possible consequences for cell migration and tissue remodeling; because monocyte u-PA activity is likely to be controlled in part also by the PA inhibitors (PAIs) made by the cell, the effect of M-CSF and GM-CSF on human monocyte PAI-2 and PAI-1 synthesis was investigated. To this end, elutriation-purified human monocytes were treated in vitro with purified recombinant human M-CSF and GM-CSF, and PAI-2 and PAI-1 antigen and mRNA levels measured by specific enzyme-linked immunosorbent assays and Northern blot, respectively. Each CSF could enhance the protein and mRNA levels of PAI-2 and PAI-1 at similar concentrations for each product. This similar regulation of monocyte PAI expression in response to the CSFs contrasted with that found for the effects of lipopolysaccharide, transforming growth factor-beta and a glucocorticoid. Therefore, PAIs may be modulating the effects of the CSFs on monocyte u-PA activity at sites of inflammation and tissue remodeling.     

Enhancement of colony-forming activity of granulocyte-macrophage colony- stimulating factor by monocytes in vitro

Human recombinant granulocyte-macrophage colony-stimulating factor (hrGM-CSF) stimulated granulocyte-macrophage (GM) colony formation from human marrow mononuclear cells (MMCs) in a dose-dependent manner in methylcellulose culture. When phagocytes were depleted from MMCs, GM colony formation from the phagocyte-depleted (PD) MMCs by hrGM-CSF markedly decreased. Experiments in which PD-MMCs were cultured with hrGM-CSF and adherent cells showed that 94% (on day 7 and day 14) of the colonies from PD-MMCs were dependent on the presence of adherent cells. In contrast, the ability of granulocyte colony-stimulating factor (G-CSF) to form colonies was not affected by phagocyte depletion. To check for the presence or absence of progenitors that could form GM colonies in direct response to hrGM-CSF, single-cell culture of hematopoietic progenitor cell surface antigen (My-10)- positive PD-MMCs was carried out using a flow cytometer and an Autoclone System. In duplicate experiments, 0.7% and 3.5% (day 7) or 3.6% and 3.9% (day 14) of My-10-positive PD-MMCs formed GM colonies in response to hrGM-CSF and 5.1% and 6.0% (day 7) of My-10-positive PD- MMCs formed GM colonies in response to G-CSF. This was clear evidence for the presence of progenitors directly responding to hrGM-CSF. Also observed was a synergistic effect on GM colony formation in which more My-10-positive PD-MMCs stimulated by hrGM-CSF and G-CSF could form GM colonies than the sum of those stimulated by each separately. This enhancing effect of colony-forming activity of hrGM-CSF by adherent cells and the single cell culture experiment were reproduced in serum- free culture system.     

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.     

Chemotactic activity of recombinant human granulocyte colony- stimulating factor

Recombinant human granulocyte colony-stimulating factor (rhG-CSF) induced migration across polycarbonate filters of human polymorphonuclear leukocytes (PMN). rhG-CSF was active in inducing PMN migration at concentrations greater than or equal to 10 to 100 U/mL (7 to 70 ng/mL). rhG-CSF did not contain appreciable levels of endotoxin contamination as assessed by Limulus amebocyte assay, and Polymixin B did not affect the chemotactic activity of rhG-CSF. A monoclonal anti-G- CSF antibody blocked the induction of migration by G-CSF, thus establishing that the cytokine was responsible for the activity of the recombinant preparation. Checkerboard analysis was performed by seeding different concentrations of G-CSF above and/or below the filter and revealed that the migratory response to this cytokine was best observed in the presence of a positive concentration gradient between the lower and upper compartments of the chamber, thus indicating an actual chemotactic effect. When different migrating cells were examined, rhG- CSF was inactive on large granular lymphocytes and endothelial cells under conditions in which appropriate reference attractants were active. In contrast, rhG-CSF elicited a chemotactic response in monocytes inhibited by specific antibody. Thus, G-CSF is a chemotactic signal for phagocytes. This cytokine, when produced at inflammatory sites, may contribute to the recruitment of phagocytes from the blood compartment to amplify resistance against certain noxious agents.     

Enhancement of neutrophil function by granulocyte-macrophage colony- stimulating factor involves recruitment of a less responsive subpopulation

Human granulocyte-macrophage colony-stimulating factor (GM-CSF) enhances numerous functions of mature neutrophils (PMN) including phagocytosis, superoxide responses to chemotaxins, antibody-dependent cellular cytotoxicity, and expression of complement receptors. A central question concerns whether the mechanism of enhancement involves quantitative increases in the response of all cells v subpopulation recruitment. The effects of GM-CSF on individual cell light scatter changes, membrane potential, and oxidant responses induced by the chemoattractant N-formyl-methionyl-leucyl-phenylalanine (FMLP) were assessed by flow cytometry and by scoring individual cells for nitroblue tetrazolium dye (NBT) reduction. GM-CSF produced a dose- and time-dependent shift in forward light scatter that was very similar in character to that seen with FMLP or leukotriene B4 stimulation. Although not capable of depolarizing the cells directly, GM-CSF primed PMNs for enhanced membrane potential responses to FMLP by significantly increasing the proportion of depolarizing cells when compared with diluent-treated controls after a 60-minute incubation at 37 degrees C (79.4% +/- 3.4% v 29.5% +/- 4.7% GM-CSF v diluent, mean +/- SE, P less than .005, n = 11). Subpopulation recruitment by GM-CSF treatment was also demonstrated by the FMLP-elicited NBT test. Taken together, these results indicate that GM-CSF can modulate the function of mature PMN by enhancing the proportion of responsive cells.     

Recombinant human interleukin-3 and granulocyte-macrophage colony- stimulating factor show common biological effects and binding characteristics on human monocytes

Two human hemopoietic growth factors involved in monocytopoiesis, interleukin-3 (IL-3) and granulocyte-macrophage colony-stimulating factor (GM-CSF) were studied for their ability to stimulate blood monocytes and to bind to the monocyte membrane. Both cytokines maintained monocyte/macrophage numbers during long-term culture and increased cell size as compared with controls. Effects on cell numbers were present at low cytokine concentrations (6 to 20 pmol/L), whereas enhanced 3H-thymidine incorporation was observed only at higher concentrations (greater than or equal to 60 pmol/L). Autoradiographic studies showed only 1% to 3% of stimulated monocytes with nuclear grains. These results suggest that the primary mechanism for IL-3 and GM-CSF-induced maintenance of monocyte/macrophage numbers in humans is through an effect on cell survival. Surface receptors for both IL-3 and GM-CSF were studied by using 125I-labeled recombinant human (rh) cytokines and performing Scatchard analyses. Both cytokines showed curvilinear Scatchard plots, and computer analyses favored a two-site binding model. High-affinity binding data for 125I rhIL-3 (Kd 7.7 to 38.2 pmol/L; receptor number/cell 95 to 580) and for 125I rhGM-CSF (Kd 4.7 to 38.9 pmol/L; receptor number/cell 8 to 67) show similar binding affinities for the two cytokines but a lower receptor number/cell for 125I rhGM-CSF. Low-affinity binding characteristics for 125I rhIL-3 (Kd 513 to 939 pmol/L; receptor number/cell 179 to 5,274) and for 125I rhGM- CSF (Kd 576 to 1,120 pmol/L; receptor number/cell 130 to 657) show a similar pattern for the two cytokines. Specificity of 125I rhIL-3 and 125I rhGM-CSF binding to monocytes was established by the ability of the homologous cytokine to inhibit binding and the inability of a range of other cytokines to compete at 100-fold excess molar concentration. It is important, however, that binding of 125I rhIL-3 was partially inhibited by rhGM-CSF and that rhIL-3 partially inhibited binding of 125I rhGM-CSF to the monocyte membrane under conditions shown to prevent receptor internalization. The degree of inhibition varied between 25% and 80% in different experiments, and quantitative inhibition experiments showed that 1,000-fold excess concentrations of competitor failed to inhibit binding of the heterologous ligand completely. These results demonstrate that human IL-3 and GM-CSF have similar effects on growth and survival of human monocytes in vitro and suggest that these and other common biological effects may be mediated either through a common receptor or through distinct receptors associated on the monocyte membrane.     

Treatment of poor-prognosis, newly diagnosed acute myeloid leukemia with ara-C and recombinant human granulocyte-macrophage colony- stimulating factor

We administered recombinant granulocyte-macrophage colony-stimulating factor (GM-CSF) (120 micrograms/m2/d by continuous intravenous [IV] infusion) to 12 patients with newly diagnosed acute myeloid leukemia (AML) at relatively high risk of early death during remission induction. GM-CSF began 3 days after completion of induction chemotherapy (ara-C 1.5 g/m2 d x 4 days by continuous IV infusion after a 3 g/m2 bolus). Rates of fatal infection (42%), pneumonia and/or sepsis (83%), and CR (50%) did not differ significantly (P less than .05) from those observed after administration of the identical chemotherapy without GM-CSF to 53 historical controls with newly diagnosed AML at similarly high risk of early death. There were no significant differences between the GM-CSF-treated and the historical groups in the time required to reach neutrophil counts of 500 or 1,000/microL after administration of chemotherapy. Four patients died of infection before they could have benefited from the earliest recovery of neutrophil count observed in patients who entered CR. Growth of leukemia after GM-CSF administration was observed in only 1 of the 8 patients who survived long enough for response to induction therapy to be fully evaluated. This observation suggests that it might be safe to undertake larger, randomized studies, perhaps using earlier administration of GM-CSF, to definitively determine the role of GM-CSF added to chemotherapy in patients with newly diagnosed AML.     

Phase I/II study of recombinant human granulocyte-macrophage colony- stimulating factor in aplastic anemia and myelodysplastic syndrome

We performed a phase I/II study of the administration of recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF) to patients with aplastic anemia or myelodysplastic syndrome. Doses ranging from 15 to 480 micrograms/m2 were administered as a one-hour or four-hour intravenous infusion daily for 7 days or as a 12-hour infusion for 14 days. Temporary improvements were seen in granulocyte counts, monocyte counts, and reticulocyte counts in six of eight patients with aplastic anemia and five of seven patients with myelodysplastic syndromes. The patients with myelodysplastic syndromes had larger increases in granulocyte, monocyte, and reticulocyte counts than did those with aplastic anemia, and they also had increases in the numbers of eosinophils (two of seven), immature myeloid cells (two of seven), and myeloblasts (two of seven) that were not observed in patients with aplastic anemia. There was no reduction in erythrocyte transfusion requirements, and no effect was observed on platelet counts. There was only minimal toxicity consisting of transient low- back discomfort, anorexia, myalgias/arthralgias, and low-grade fever. Our data suggest that GM-CSF is well tolerated and is more likely to result in elevations of blood counts in patients with myelodysplasia than in patients with aplastic anemia, but the role of GM-CSF therapy in these disorders remains to be determined.     

Identification of proteins immunologically related to interferon regulatory factor-1 that bind with interferon regulatory factor element

Interferon regulatory factor (IRF)-1 expression was surveyed in nontransformed and oncogene-transformed mouse fibroblasts, using Western immunoblot with an IRF-1-specific antiserum, to examine possible differences resulting from cellular transformation. Ten additional proteins that reacted with the IRF-1 antibody and that underwent specific competition by peptide antigen were observed in extracts of both nontransformed and oncogene-transformed cell lines. Cross-reacting proteins were also observed in mouse macrophage extracts. Protein was captured from fibroblast nuclear extracts, using oligonucleotides representing IRF-binding sequences linked to magnetic beads. Captured proteins were eluted and analyzed by immunoblot with anti-IRF-1. Along with 43-kDa IRF-1, 4 of the 7 nuclearly located cross-reacting proteins (97, 90, 66, and 33 kDa) were found to complex with the IRF binding element. These proteins, with an epitope in common with the IRF-1 C-terminal region and IRF element DNA sequence-binding capability, may represent new members of the IRF family.     

Murine myeloid cells transformed by myb require fibroblast-derived or autocrine growth factors in addition to granulocyte-macrophage colony- stimulating factor for proliferation

Murine myeloid cells can be transformed in vitro by infection with recombinant retroviruses carrying activated myb genes. While these myb- transformed hematopoietic cells (MTHCs) can proliferate continuously in culture, they exhibit several characteristics of progenitor cells of the granulocyte-macrophage (GM) lineage, including an absolute dependence on hematopoietic growth factors (HGFs) such as GM colony- stimulating factor (GM-CSF) for survival and growth. Whereas we have previously shown that MTHCs respond synergistically to certain combinations of HGFs, we report here that MTHCs apparently require two HGFs for proliferation, because GM-CSF alone appears insufficient to promote growth when MTHCs are cultured at very low densities. However, proliferation can be stimulated by either increasing the density at which MTHCs are cultured (implying the production of an autocrine growth factor) or by the presence of a feeder layer of irradiated fibroblasts. We find that the activity of such feeder layers is greatest when the MTHCs are allowed to contact them directly; and by using mutant fibroblast lines, that it depends on the production of CSF- 1, but not Steel factor (SLF). In contrast, the autocrine factor appears not to be either CSF-1 or SLF, and the possibility is raised that it may represent a novel HGF activity. Potential implications of these results for normal and leukemic hematopoiesis are discussed.     

Enhanced resistance of bone marrow transplanted mice to bacterial infection induced by recombinant granulocyte-macrophage colony- stimulating factor

The in vivo effect of recombinant murine granulocyte-macrophage colony stimulating factor (rGM-CSF) on the resistance of mice to bacterial infection and on the number and function of neutrophils was studied in lethally irradiated mice transplanted with syngeneic bone marrow cells. Bone marrow transplanted (BMT) mice were injected intraperitoneally with 150 ng rGM-CSF or buffer solution (diluent) twice daily for 18 consecutive days. Total neutrophil recovery from the peripheral blood and the number of neutrophils mobilized into the peritoneal cavity were accelerated in rGM-CSF-treated recipients. Peritoneal neutrophils isolated from mice treated with rGM-CSF exhibited primed superoxide generation (O2-) after in vitro stimulation with suboptimal concentrations of phorbol myristate acetate (PMA), as compared with control mice (treated with diluent). No additional increase in O2- production occurred upon in vitro incubation of these cells with rGM- CSF. The protective activity of rGM-CSF was examined in mice injected with Salmonella typhimurium. There was a 44- and 9-fold increase in the number of S typhimurium at 96 hours postinfection in the spleen and liver, respectively, of control mice, as compared with rGM-CSF-treated mice, after a single injection of the bacteria (3 X 10(7) per mouse). All the untreated control mice died within 14 days postinoculation (1 X 10(7) bacteria per mouse), whereas 35% of the mice treated with rGM-CSF remained alive for more than 30 days postinfection. These findings support the concept that increased granulopoiesis and enhanced functional activity of phagocytic cells is induced by rGM-CSF and is responsible for enhanced resistance of BMT mice to bacterial infection.     

Thrombocytopenia in dogs induced by granulocyte-macrophage colony- stimulating factor: increased destruction of circulating platelets

Administration of recombinant canine granulocyte-macrophage colony- stimulating factor (rcGM-CSF) to normal dogs in previous studies induced an increase in peripheral blood neutrophils and a dose- dependent decrease in platelet counts. In six dogs that received the highest tested dose of rcGM-CSF (50 micrograms/kg/d) for a minimum of 12 days, the mean nadir of the platelet count was 46,000/microL (range, 4,000 to 91,000/microL) on day 9 +/- 1.1 after starting therapy, compared with a mean baseline platelet count of 398,000/microL (range, 240,000 to 555,000/microL). In three dogs, survival of autologous 111In- labeled platelets was reduced from a mean of 4.9 days to 1.3 days during the administration of rcGM-CSF. Biodistribution studies with gamma camera imaging indicated that there was an increase in mean hepatic uptake during the administration of rcGM-CSF, from 15% to 44% of the total injected 111In-labeled platelets at 2 hours, whereas splenic uptake was not significantly changed. In contrast, in two evaluable dogs who were recipients of 111In-labeled platelets from matched allogeneic donors receiving rcGM-CSF, platelet survival was not reduced and no increased hepatic uptake was noted. A third dog became alloimmunized to the matched donor platelets and was not evaluable. Immunohistologic studies of liver and spleen were performed with monoclonal antibodies specific for canine gpIIb/IIIa and P-selectin in dogs treated with rcGM-CSF and compared with untreated controls. On treatment, a marked reduction of platelets in the red pulp of the spleen was evident, and in general, the presence of platelet antigen in the liver was unchanged. Therefore, platelets were not being sequestered, but destroyed in the liver and spleen. The platelet antigens, P-selectin and gpIIb/IIIa, were identified in association with Kupffer cells in the liver, but no difference in the number of distribution of these Kupffer cells was found between controls and rcGM- CSF-treated dogs. In the spleen during rcGM-CSF treatment, most platelet antigens were associated with large mononuclear cells in the marginal zone. During administration of rcGM-CSF, CD1c and CD11c expression was increased on Kupffer cells. Platelet P-selectin expression and binding of leukocytes to circulating platelets were unchanged from baseline studies with rcGM-CSF treatment. In conclusion, during the administration of rcGM-CSF to dogs, a local process in the liver and spleen is induced resulting in thrombocytopenia.(ABSTRACT TRUNCATED AT 400 WORDS)     

Therapeutic potential of recombinant granulocyte-macrophage colony- stimulating factor and interleukin-3 in murine B-cell leukemia

The antileukemic activity of murine recombinant granulocyte-macrophage colony-stimulating factor (rGM-CSF) and a combination of rGM-CSF and recombinant interleukin-3 (rIL-3) was examined by using a murine model of spontaneous B-cell leukemia (BCL1) in BALB/c mice. All untreated mice inoculated with 2 x 10(2) BCL1 cells developed leukemia within 4 weeks, with extreme lymphocytosis and a massive increase in both spleen weight and cell number while the number of myeloid progenitors (CFU-C) per spleen was decreased. In contrast, rGM-CSF-or rGM-CSF- and rIL-3- treated recipients did not show any evidence of leukemia or splenomegaly at 4 weeks and showed a significant increase in CFU-C per spleen. Hematologic parameters in the peripheral blood of untreated mice showed anemia and thrombocytopenia. Significant elevations in these parameters were recorded in mice treated with either protocol of CSF. Treatment of recipient mice with either rGM-CSF or rGM-CSF and rIL- 3 prolonged their median survival from 6 weeks in untreated controls (range, 5 to 9 weeks) up to the time they were killed at 105 days. Adoptive transfer of spleen cells obtained from mice treated with rGM- CSF, mice treated with a combination of rGM-CSF and rIL-3, and untreated controls, into normal secondary recipients indicated improved survival in recipients inoculated with rGM-CSF. These data indicate that CSFs may inhibit in vivo expansion of leukemic cells of lymphoid origin.     

Induction of anti-recombinant human granulocyte-macrophage colony- stimulating factor (Escherichia coli-derived) antibodies and clinical effects in nonimmunocompromised patients

The pharmacokinetics of recombinant human granulocyte-macrophage colony- stimulating factor (rhGM-CSF), induction of anti-GM-CSF antibodies, and clinical effects related to the induction of the antibodies were analyzed in patients with metastatic colorectal carcinoma (CRC) who were not on chemotherapy (n = 20, nonimmunocompromised patients). rhGM- CSF (250 micrograms/m2/d; Escherichia coli-derived) was administered subcutaneously for 10 days every month for 4 months. Eight patients with multiple myeloma (MM) on intensive chemotherapy followed by rhGM- CSF treatment were also included (immunocompromised patients). After a single injection of GM-CSF at the first cycle in CRC patients, the maximum calculated concentration (Cmax) was 5.24 +/- 0.56 ng/mL; the half life (T1/2) was 2.91 +/- 0.8 hours; and the area under the concentration curve (AUC) was 30.86 +/- 6.03 hours x ng/mL (mean +/- SE). No anti-GM-CSF antibodies were detected. During the subsequent cycles, 95% of the CRC patients developed anti-GM-CSF IgG antibodies, which significantly altered the pharmacokinetics of rhGM-CSF at the third and fourth cycles with decreased Cmax (2.87 +/- 0.57 ng/mL; P < .05), T1/2 (1.57 +/- 0.2 hours; P < .05), and AUC (14.90 +/- 4.10 hours x ng/mL; P < .005). The presence of anti-GM-CSF antibodies significantly reduced the GM-CSF-induced enhancement of granulocytes, and there was a clear tendency for a decreased increment of monocytes. Antibodies diminished systemic side effects of rhGM-CSF. Only 1 of 8 MM patients showed a very low anti-GM-CSF antibody titer after GM-CSF therapy, as shown by enzyme-linked immunosorbent assay and Western blot. Therefore, in nonimmunocompromised patients, exogenous nonglycosylated GM-CSF induced an anti-GM-CSF IgG antibody response in practically all patients, which seemed to be of clinical significance. In immunocompromised patients, virtually no significant antibody response was shown.     

Demonstration of a blood-bone marrow barrier to macrophage colony- stimulating factor

Several previous studies suggested that murine macrophage colony- stimulating factor (CSF-1) might have impaired access to hematopoietic cells in the marrow. The apparent lack of hematopoietic responses to exogenous CSF and the finding of available or unoccupied CSF receptors despite saturating CSF levels in the serum led to studies of a potential blood-bone marrow barrier for this factor. Groups of mice were injected with pure unlabeled CSF-1 by either intravenous (IV) or intraperitoneal (IP) routes. Marrow and spleen cells were obtained at intervals after injection, held at 0 degree C, and assessed for changes in binding of 125I-CSF. Saturation of all available CSF receptors is achieved in vitro with 100 to 150 U CSF/mL. Despite achieving serum levels of 5,000 to 7,000 U/mL after IV injection of 25,000 units of CSF, less than 50% of the marrow receptors and less than 85% of the splenic receptors were saturated or downregulated. The decline in receptor availability was transient, with return of receptor sites in two to four hours. Increasing the IV dose to 125,000 units increased serum CSF values to approximately 20,000 U/mL and led to a virtual disappearance of available receptors for two to three hours. When administered IP, only approximately 40% of marrow and 80% of splenic receptors were affected for two hours. It was necessary to increase the dose of CSF to 250,000 units IP to saturate or downregulate receptors for three to four hours after injection. These observations indicate a marked blood-bone marrow barrier and lesser blood-spleen barrier for the transfer of serum CSF to responsive hematopoietic cells in vivo.     

Biosynthetic (recombinant) human granulocyte-macrophage colony- stimulating factor: effect on normal bone marrow and leukemia cell lines

To examine the biologic properties of the molecule encoded by the human gene for granulocyte-macrophage colony-stimulating factor (GM-CSF), we expressed the cloned complementary DNA (cDNA) in transfected monkey COS cells and purified the resultant protein. Purified biosynthetic human GM-CSF was added to cultures of normal hematopoietic progenitor cells in semisolid media, and the resulting colonies were characterized cytochemically. Non-adherent light-density bone marrow cells from healthy adult volunteers were maximally stimulated with GM-CSF (approximately 250 pmol/L, and four types of colonies were consistently identified by aspirating the individual colonies and staining with a triple stain for specific and nonspecific esterases and eosinophilic granules. Pure neutrophilic granulocyte (G), mixed granulocyte- macrophage (GM), pure macrophage (M), and pure eosinophil (EO) colonies were observed, the mean incidences on day 8 being 70%, 20%, 5%, and 5%, and on day 14, 7.5%, 16.6%, 50.9%, and 25.0%, respectively. In all types of colonies, complete maturation to segmented forms or typical macrophages was detected. GM-CSF did not enhance the growth of BFU-E from normal peripheral blood buffy coat cells in the simultaneous presence of erythropoietin alone or erythropoietin with purified erythroid-potentiating activity. GM-CSF stimulated HL-60 and KG-1 colony formation twofold and fivefold, respectively; consistent differentiation induction towards monocytic and eosinophilic lineages was observed in HL-60 but not in KG-1. These in vitro findings indicate that GM-CSF is a multilineage stimulator for progenitor cells of G, GM, M, and EO colonies.