Evolution of codon usage bias in Drosophila

We first review what is known about patterns of codon usage bias in Drosophila and make the following points: (i) Drosophila genes are as biased or more biased than those in microorganisms. (ii) The level of bias of genes and even the particular pattern of codon bias can remain phylogenetically invariant for very long periods of evolution. (iii) However, some genes, even very tightly linked genes, can change very greatly in codon bias across species. (iv) Generally G and especially C are favored at synonymous sites in biased genes. (v) With the exception of aspartic acid, all amino acids contribute significantly and about equally to the codon usage bias of a gene. (vi) While most individual amino acids that can use G or C at synonymous sites display a preference for C, there are exceptions: valine and leucine, which prefer G. (vii) Finally, smaller genes tend to be more biased than longer genes. We then examine possible causes of these patterns and discount mutation bias on three bases: there is little evidence of regional mutation bias in Drosophila, mutation bias is likely toward A+T (the opposite of codon usage bias), and not all amino acids display the preference for the same nucleotide in the wobble position. Two lines of evidence support a selection hypothesis based on tRNA pools: highly biased genes tend to be highly and/or rapidly expressed, and the preferred codons in highly biased genes optimally bind the most abundant isoaccepting tRNAs. Finally, we examine the effect of bias on DNA evolution and confirm that genes with high codon usage bias have lower rates of synonymous substitution between species than do genes with low codon usage bias. Surprisingly, we find that genes with higher codon usage bias display higher levels of intraspecific synonymous polymorphism. This may be due to opposing effects of recombination.     

Senecavirus A Enhances Its Adaptive Evolution via Synonymous Codon Bias Evolution

Synonymous codon bias in the viral genome affects protein translation and gene expression, suggesting that the synonymous codon mutant plays an essential role in influencing virulence and evolution. However, how the recessive mutant form contributes to virus evolvability remains elusive. In this paper, we characterize how the Senecavirus A (SVA), a picornavirus, utilizes synonymous codon mutations to influence its evolution, resulting in the adaptive evolution of the virus to adverse environments. The phylogenetic tree and Median-joining (MJ)-Network of these SVA lineages worldwide were constructed to reveal SVA three-stage genetic development clusters. Furthermore, we analyzed the codon bias of the SVA genome of selected strains and found that SVA could increase the GC content of the third base of some amino acid synonymous codons to enhance the viral RNA adaptive evolution. Our results highlight the impact of recessive mutation of virus codon bias on the evolution of the SVA and uncover a previously underappreciated evolutionary strategy for SVA. They also underline the importance of understanding the genetic evolution of SVA and how SVA adapts to the adverse effects of external stress.     

Genetic organization and diversity of the hepatitis C virus.

The nucleotide sequence of the RNA genome of the human hepatitis C virus (HCV) has been determined from overlapping cDNA clones. The sequence (9379 nucleotides) has a single large open reading frame that could encode a viral polyprotein precursor of 3011 amino acids. While there as little overall amino acid and nucleotide sequence homology with other viruses, the 5' HCV nucleotide sequence upstream of this large open reading frame has substantial similarity to the 5' termini of pestiviral genomes. The polyprotein also has significant sequence similarity to helicases encoded by animal pestiviruses, plant potyviruses, and human flaviviruses, and it contains sequence motifs widely conserved among viral replicases and trypsin-like proteases. A basic, presumed nucleocapsid domain is located at the N terminus upstream of a region containing numerous potential N-linked glycosylation sites. These HCV domains are located in the same relative position as observed in the pestiviruses and flaviviruses and the hydrophobic profiles of all three viral polyproteins are similar. These combined data indicate that HCV is an unusual virus that is most related to the pestiviruses. Significant genome diversity is apparent within the putative 5' structural gene region of different HCV isolates, suggesting the presence of closely related but distinct viral genotypes.     

Isolation of a complementary DNA fragment of hepatitis C virus in Taiwan revealed significant sequence variations compared with other isolates.

To clone and characterize hepatitis C virus strains present in Taiwan, RNA was extracted from liver tissue collected from a patient during the acute phase of posttransfusion non-A, non-B hepatitis. RNA was then subjected to complementary DNA synthesis and the polymerase chain reaction, using primers derived from the original nucleotide sequence of the United States hepatitis C virus strain. A complementary DNA clone, HCV-T3, containing 552 base pairs of hepatitis C virus complementary DNA sequences was isolated and characterized. The homologies in nucleotide sequence between the Taiwan isolate and either the United States or Japan isolate were 80.1% and 91.5%, respectively. However, most of the nucleotide changes occurred in the third base positions, resulting in much higher homologies in amino acid sequence of 91.8% and 97.3%, respectively. Amplification of the less conserved region of hepatitis C virus genome with the polymerase chain reaction was improved by use of primers with nucleotides matched to the local strain. Finally, in addition to the liver and serum, the viral genome was also demonstrated in the spleen tissue by similar methods, suggesting another possible target for hepatitis C viral infection. These findings indicate that there is considerable heterogeneity in hepatitis C virus genomes isolated from different areas of the world.     

Phylodynamics and Codon Usage Pattern Analysis of Broad Bean Wilt Virus 2

Broad bean wilt virus 2 (BBWV-2), which belongs to the genus Fabavirus of the family Secoviridae, is an important pathogen that causes damage to broad bean, pepper, yam, spinach and other economically important ornamental and horticultural crops worldwide. Previously, only limited reports have shown the genetic variation of BBWV2. Meanwhile, the detailed evolutionary changes, synonymous codon usage bias and host adaptation of this virus are largely unclear. Here, we performed comprehensive analyses of the phylodynamics, reassortment, composition bias and codon usage pattern of BBWV2 using forty-two complete genome sequences of BBWV-2 isolates together with two other full-length RNA1 sequences and six full-length RNA2 sequences. Both recombination and reassortment had a significant influence on the genomic evolution of BBWV2. Through phylogenetic analysis we detected three and four lineages based on the ORF1 and ORF2 nonrecombinant sequences, respectively. The evolutionary rates of the two BBWV2 ORF coding sequences were 8.895 × 10⁻⁴ and 4.560 × 10⁻⁴ subs/site/year, respectively. We found a relatively conserved and stable genomic composition with a lower codon usage choice in the two BBWV2 protein coding sequences. ENC-plot and neutrality plot analyses showed that natural selection is the key factor shaping the codon usage pattern of BBWV2. Strong correlations between BBWV2 and broad bean and pepper were observed from similarity index (SiD), codon adaptation index (CAI) and relative codon deoptimization index (RCDI) analyses. Our study is the first to evaluate the phylodynamics, codon usage patterns and adaptive evolution of a fabavirus, and our results may be useful for the understanding of the origin of this virus.     

Genomic differences between guinea pig lethal and nonlethal Marburg virus variants

The complete genome sequences of 2 closely related plaque-derived variants of Marburg virus (MARV) species Lake Victoria marburgvirus, strain Musoke, indicate only a few regions of the RNA genome as underlying the differences between the 2 viruses. One variant is >90% lethal for guinea pigs and the other much less virulent, when guinea pigs are challenged with 1000 pfu of virus. Only 4 mutations that result in amino acid changes were identified, 1 in viral matrix protein VP40 and 3 in L, the RNA-dependent RNA polymerase. In addition, 6 differences were identified in noncoding regions of transcribed mRNA, and 1 silent codon change was identified in the L gene. Interestingly, the amino acid mutation identified in VP40 occurs in a nonconserved loop structure between 2 domains that are homologues only among MARV species. The L gene mutations were equally intriguing, clustering near a highly conserved motif in viral RNA-dependent RNA polymerases.     

Primary structure and gene organization of human hepatitis A virus.

The RNA genome of human hepatitis A virus (HAV) was molecularly cloned. Recombinant DNA clones representing the entire HAV RNA were used to determine the primary structure of the viral genome. The length of the viral genome is 7478 nucleotides. An open reading frame starting at nucleotide 734 and terminating at nucleotide 7415 encodes a polyprotein of Mr 251,940. Comparison of the HAV nucleotide sequence with that of other picornaviruses has failed to reveal detectable areas of homology. However, a computer analysis of the putative amino acid sequence of HAV and poliovirus demonstrated the existence of short areas of homology in virion protein 3 (VP3) and throughout the carboxyl-terminal portion of the polyproteins. In addition, extensive protein structural homologies with poliovirus were detected.     

Methionine-independent initiation of translation in the capsid protein of an insect RNA virus

Protein synthesis is believed to be initiated with the amino acid methionine because the AUG translation initiation codon of mRNAs is recognized by the anticodon of initiator methionine transfer RNA. A group of positive-stranded RNA viruses of insects, however, lacks an AUG translation initiation codon for their capsid protein gene, which is located at the downstream part of the genome. The capsid protein of one of these viruses, Plautia stali intestine virus, is synthesized by internal ribosome entry site-mediated translation. Here we report that methionine is not the initiating amino acid in the translation of the capsid protein in this virus. Its translation is initiated with glutamine encoded by a CAA codon that is the first codon of the capsid-coding region. The nucleotide sequence immediately upstream of the capsid-coding region interacts with a loop segment in the stem-loop structure located 15-43 nt upstream of the 5' end of the capsid-coding region. The pseudoknot structure formed by this base pair interaction is essential for translation of the capsid protein. This mechanism for translation initiation differs from the conventional one in that the initiation step controlled by the initiator methionine transfer RNA is not necessary.     

Single amino acid change in the helicase domain of the putative RNA replicase of turnip crinkle virus alters symptom intensification by virulent satellites.

The virulent satellite [satellite C (sat C)] of turnip crinkle virus (TCV) is a small pathogenic RNA that intensifies symptoms in TCV-infected turnip plants (Brassica campestris). The virulence of sat C is determined by properties of the satellite itself and is influenced by the helper virus. Symptoms produced in infections with sat C differ in severity depending on the helper virus. The TCV-JI helper virus produces more severe symptoms than the TCV-B helper virus when inoculated with sat C. To find determinants in the TCV helper virus genome that affect satellite virulence, the TCV-JI genome was cloned and the sequence compared to the TCV-B genome. The genomes were found to differ by only five base changes, and only one of the base changes, at nucleotide position 1025, produced an amino acid change, an aspartic acid----glycine in the putative viral replicase. A chimeric TCV genome (TCV-B/JI) containing four of the five base changes (including the base change at position 1025) and a mutant TCV-B genome (TCV-B1025G) containing a single base substitution at position 1025 converted the TCV-B genome into a form that produces severe symptoms with sat C. The base change a position 1025 is located in the helicase of the putative viral replicase, and symptom intensification appears to result from differences in the rate of replication of the satellite supported by the two helper viruses.     

A previously unrecognized influenza B virus glycoprotein from a bicistronic mRNA that also encodes the viral neuraminidase.

RNA segment 6 of the influenza B virus genome codes for a previously unidentified polypeptide designated NB. The reading frame for this polypeptide begins with the first AUG codon on the mRNA and overlaps the reading frame for the viral neuraminidase by 292 nucleotides. The amino acid sequence of polypeptide NB deduced from the nucleotide sequence of the B/Lee/40 strain consists of 100 amino acids with a molecular weight of 11,242. The sequence contains four potential glycosylation sites, and the protein has been found to be glycosylated in infected cells. NB has not been found in virions. Sucrose gradient sedimentation and analysis of the structure of the mRNA by nuclease S1 mapping and sequence analysis by the primer extension method indicated that polypeptide NB and the neuraminidase are translated from a single bicistronic mRNA. A protein analogous to NB has not been found with influenza A virus, and this represents a major difference between the two virus types.     

Nucleotide sequence of 5'' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.

The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.     

Rates of evolution of the retroviral oncogene of Moloney murine sarcoma virus and of its cellular homologues.

A method is proposed for computing the rates of nucleotide substitution for an oncogene of a retrovirus (v-onc), its cellular homologue (c-onc), and the retrovirus genome simultaneously. The method has been applied to DNA sequences of the v-mos gene of Moloney murine sarcoma virus (Mo-MuSV) and the c-mos and gag genes of Mo-MuSV and Moloney murine leukemia virus (Mo-MuLV). The rates of nucleotide substitution for c-mos, the gag gene, and v-mos are estimated to be 1.71 X 10(-9), 6.3 X 10(-4), and 1.31 X 10(-3) per site per year, respectively. The rate of evolution of c-mos is comparable to that of many functional genes in DNA genomes, suggesting some important biological function played by cellular oncogenes. The rates of nucleotide substitution in the v-mos and gag genes are very high and are similar to those of RNA viral genes such as the hemagglutinin and neuraminidase genes in the influenza A virus. Thus, oncogenes seem to exemplify a general feature of genome evolution: the rate of evolution of RNA genomes can be more than a million times greater than that of DNA genomes because of a high mutation rate in the RNA genome.     

Natural Selection Plays an Important Role in Shaping the Codon Usage of Structural Genes of the Viruses Belonging to the Coronaviridae Family

Viruses belonging to the Coronaviridae family have a single-stranded positive-sense RNA with a poly-A tail. The genome has a length of ~29.9 kbps, which encodes for genes that are essential for cell survival and replication. Different evolutionary constraints constantly influence the codon usage bias (CUB) of different genes. A virus optimizes its codon usage to fit the host environment on which it savors. This study is a comprehensive analysis of the CUB for the different genes encoded by viruses of the Coronaviridae family. Different methods including relative synonymous codon usage (RSCU), an Effective number of codons (ENc), parity plot 2, and Neutrality plot, were adopted to analyze the factors responsible for the genetic evolution of the Coronaviridae family. Base composition and RSCU analyses demonstrated the presence of A-ended and U-ended codons being preferred in the 3rd codon position and are suggestive of mutational selection. The lesser ENc value for the spike ‘S’ gene suggests a higher bias in the codon usage of this gene compared to the other structural genes. Parity plot 2 and neutrality plot analyses demonstrate the role and the extent of mutational and natural selection towards the codon usage pattern. It was observed that the structural genes of the Coronaviridae family analyzed in this study were at the least under 84% influence of natural selection, implying a major role of natural selection in shaping the codon usage.     

Evolutionary Patterns of Codon Usage in Major Lineages of Porcine Reproductive and Respiratory Syndrome Virus in China

Porcine reproductive and respiratory syndrome virus (PRRSV) is economically important and characterized by its extensive variation. The codon usage patterns and their influence on viral evolution and host adaptation among different PRRSV strains remain largely unknown. Here, the codon usage of ORF5 genes from lineages 1, 3, 5, and 8, and MLV strains of type 2 PRRSV in China was analyzed. A compositional property analysis of ORF5 genes revealed that nucleotide C is most frequently used at the third position of codons, accompanied by rich GC3s. The effective number of codon (ENC) and codon pair bias (CPB) values indicate that all ORF5 genes have low codon bias and the differences in CPB scores among four lineages are almost not significant. When compared with host codon usage patterns, lineage 1 strains show higher CAI and SiD values, with a high similarity to pig, which might relate to its predominant epidemic propensity in the field. The CAI, RCDI, and SiD values of ORF5 genes from different passages of MLV JXA1R indicate no relation between attenuation and CPB or codon adaptation decrease during serial passage on non-host cells. These findings provide a novel way of understanding the PRRSV’s evolution, related to viral survival, host adaptation, and virulence.     

Sequence analysis of the cDNA encoding human liver glycogen phosphorylase reveals tissue-specific codon usage.

We have cloned the cDNA encoding glycogen phosphorylase (1,4-alpha-D-glucan:orthophosphate alpha-D-glucosyl-transferase, EC 2.4.1.1) from human liver. Blot-hybridization analysis using a large fragment of the cDNA to probe mRNA from rabbit brain, muscle, and liver tissues shows preferential hybridization to liver RNA. Determination of the entire nucleotide sequence of the liver message has allowed a comparison with the previously determined rabbit muscle phosphorylase sequence. Despite an amino acid identity of 80%, the two cDNAs exhibit a remarkable divergence in G+C content. In the muscle phosphorylase sequence, 86% of the nucleotides at the third codon position are either deoxyguanosine or deoxycytidine residues, while in the liver homolog the figure is only 60%, resulting in a strikingly different pattern of codon usage throughout most of the sequence. The liver phosphorylase cDNA appears to represent an evolutionary mosaic; the segment encoding the N-terminal 80 amino acids contains greater than 90% G+C at the third codon position. A survey of other published mammalian cDNA sequences reveals that the data for liver and muscle phosphorylases reflects a bias in codon usage patterns in liver and muscle coding sequences in general.     

A comparison of La Crosse virus isolated obtained from different ecological niches and an analysis of the structural components of California encephalitis serogroup viruses and other bunyaviruses.

Analyses of the oligonucleotide fingerprints of the three genome ribonucleic acid (RNA) species of 11 isolates of La Crosse (LAC) virus, obtained from various ecological niches in the northern United States and compared to those of prototype LAC virus, showed that in each place from which these isolates were obtained LAC variants and varieties were present with related, but distinguishable, nucleotide sequences for their large, medium, or small RNA species. The RNA genomes of prototypes trivittatus (TVT), snowshoe hare (SSH), Tahyna (TAH), and Lumbo (a variety of TAH) viruses of the California encephalitis (CE) serogroup, and Guaroa of the Bunyamwera serogroup also consist of three RNA species, each with unique and distinguishable nucleotide sequences which bear little resemblance to those of the LAC virus isolates. The virions of CE group viruses (CE, Jamestown Canyon, Keystone, LAC, Melao, SSH, TVT, TAH viruses and South River, an unregistered virus) have three major viral polypeptides, designated G1, G2, and N.