The genome of the archaeal virus SIRV1 has features in common with genomes of eukaryal viruses

The virus SIRV1 of the extremely thermophilic archaeon Sulfolobus has a double-stranded DNA genome similar in architecture to the genomes of eukaryal viruses of the families Poxviridae, Pycodnaviridae, and Asfarviridae: the two strands of the 32,301 bp long linear genome are covalently connected forming a continuous polynucleotide chain and 2029 kb long inverted repeats are present at the termini. Very likely it also shares with these viruses mechanisms of initiation of replication and resolution of replicative intermediates.     

A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus

Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.     

AFV1, a novel virus infecting hyperthermophilic archaea of the genus acidianus

We describe a novel virus, AFV1, of the hyperthermophilic archaeal genus Acidianus. Filamentous virions are covered with a lipid envelope and contain at least five different proteins with molecular masses in the range of 23-130 kDa and a 20.8-kb-long linear double-stranded DNA. The virus has been assigned to the family Lipothrixviridae on the basis of morphotypic characteristics. Host range is confined to several strains of Acidianus and the virus persists in its hosts in a stable carrier state. The latent period of virus infection is about 4 h. Viral DNA was sequenced and sequence similarities were found to the lipothrixvirus SIFV, the rudiviruses SIRV1 and SIRV2, as well as to conjugative plasmids and chromosomes of the genus Sulfolobus. Exceptionally for the linear genomes of archaeal viruses, many short direct repeats, with the sequence TTGTT or close variants thereof, are closely clustered over 300 bp at each end of the genome. They are reminiscent of the telomeric ends of linear eukaryal chromosomes.     

A novel lipothrixvirus, SIFV, of the extremely thermophilic crenarchaeon Sulfolobus

We describe a novel lipothrixvirus, SIFV, of the crenarchaeotal archaeon Sulfolobus islandicus. SIFV (S. islandicus filamentous virus) has a linear virion with a linear double-stranded DNA genome. These two features coincide in several crenarchaeotal but not in any other viruses. The SIFV core is formed by a zipper-like array of DNA-associated protein subunits and is covered by a lipid envelope containing host lipids. We sequenced approximately 96% of the virus genome excepting the DNA termini, which were modified in an unusual, yet uncharacterized, manner. Both, the 5' and the 3' DNA termini were insensitive to enzymatic degradation and labelling. Two open reading frames (ORFs) of the SIFV genome are likely to encode helicases and resemble uncharacterized ORFs from other archaea in sequence. Three ORFs showed sequence similarity with each other and each contained a glycosyl transferase motif. Another ORF of the SIFV genome showed significant sequence similarity to the ORF a291 from the well characterized, spindle-shaped Sulfolobus virus SSV1. Due to its structure, SIFV is classified as a lipothrixvirus.     

Genome of the Acidianus bottle-shaped virus and insights into the replication and packaging mechanisms

The Acidianus bottle-shaped virus, ABV, infects strains of the hyperthermophilic archaeal genus Acidianus and is morphologically distinct from all other known viruses. Its genome consists of linear double-stranded DNA, containing 23,814 bp with a G+C content of 35%, and it exhibits a 590-bp inverted terminal repeat. Of the 57 predicted ORFs, only three produced significant matches in public sequence databases with genes encoding a glycosyltransferase, a thymidylate kinase and a protein-primed DNA polymerase. Moreover, only one homologous gene is shared with other sequenced crenarchaeal viruses. The results confirm the unique nature of the ABV virus, and support its assignment to the newly proposed viral family the Ampullaviridae. Exceptionally, one region at the end of the linear genome of ABV is similar in both gene content and organization to corresponding regions in the genomes of the bacteriophage varphi29 and the human adenovirus. The region contains the genes for a putative protein-primed DNA polymerase, and a small putative RNA with a predicted secondary structure closely similar to that of the prohead RNA of bacteriophage varphi29. The apparent similarities in the putative mechanisms of DNA replication and packaging of ABV to those of bacterial and eukaryal viruses are most consistent with the concept of a primordial gene pool as a source of viral genes.     

Relationships between fuselloviruses infecting the extremely thermophilic archaeon Sulfolobus: SSV1 and SSV2

The fusellovirus SSV2 from an Icelandic Sulfolobus strain was isolated, characterized and its complete genomic sequence determined. SSV2 is very similar in morphology, replication, genome size and number of open reading frames (ORFs) to the type virus of the family, SSV1 from Japan, except in its high level of uninduced virus production. The nucleotide sequences are, however, only 55% identical to each other, much less than related bacteriophage, related animal viruses and the rudiviruses of Sulfolobus, SIRV1 and SIRV2. Nevertheless the genome architecture is very similar between the two viruses, indicating that despite this genomic dissimilarity the virus genomes are mostly homologous. Unlike SSV1, the sequence of SSV2 indicates integration into a glycyl tRNA gene and is completely missing a DNA packaging gene. There is a unique, perfectly tandemly directly repeated sequence of 62 nucleotides in SSV2 that has no similarity to known sequences or structures. By comparison to the SSV2 genome, an integrated partial fusellovirus genome was found in the Sulfolobus solfataricus P2 genome further confirming the dynamism of the Sulfolobus genome. Clustering of cysteine codon containing ORFs both in SSV1 and SSV2 indicates that these Fuselloviridae arose from a genome fusion event.     

Morphology and genome organization of the virus PSV of the hyperthermophilic archaeal genera Pyrobaculum and Thermoproteus: a novel virus family, the Globuloviridae

A novel virus, termed Pyrobaculum spherical virus (PSV), is described that infects anaerobic hyperthermophilic archaea of the genera Pyrobaculum and Thermoproteus. Spherical enveloped virions, about 100 nm in diameter, contain a major multimeric 33-kDa protein and host-derived lipids. A viral envelope encases a superhelical nucleoprotein core containing linear double-stranded DNA. The PSV infection cycle does not cause lysis of host cells. The viral genome was sequenced and contains 28337 bp. The genome is unique for known archaeal viruses in that none of the genes, including that encoding the major structural protein, show any significant sequence matches to genes in public sequence databases. Exceptionally for an archaeal double-stranded DNA virus, almost all the recognizable genes are located on one DNA strand. The ends of the genome consist of 190-bp inverted repeats that contain multiple copies of short direct repeats. The two DNA strands are probably covalently linked at their termini. On the basis of the unusual morphological and genomic properties of this DNA virus, we propose to assign PSV to a new viral family, the Globuloviridae.     

The genome of the Cryptophlebia leucotreta granulovirus

The genome of the Cryptophlebia leucotreta granulovirus (CrleGV) was sequenced and analyzed. The double-stranded circular genome contains 110907 bp and potentially encodes 129 predicted open reading frames (ORFs), 124 of which were similar to other baculovirus ORFs. Five ORFs were CrleGV specific and 26 ORFs were common to other granulovirus genomes. One ORF showed a significant similarity to a nonstructural protein of Bombyx mori densovirus-2. A baculovirus chitinase gene was identified, which is most likely not functional, because its central coding region including the conserved chitinase active site signature is deleted. Three gene copies (Crle20, 23, and 24) containing the Baculo PEP N domain of the polyhedron envelope protein were identified in CrleGV and other GV genomes. One of them (Crle23) appeared also to contain a p10-like sequence encoding of a number of leucine-rich heptad repeats and a proline-rich domain. Another striking feature of the genome is the presence of a hypervariable non-hr ori-like region of about 1800 bp consisting of different kinds of repeats and palindromes. Three other repeat-rich regions were identified within the genome and are considered as homologous regions (hrs). CrleGV is most closely related to the Cydia pomonella granulovirus (CpGV) as revealed by genome order comparisons and phylogenetic analyses. However, the AT content of the CrleGV genome, which is 67.6% and the highest found so far in baculoviruses, differed by 12.8% from the AT content of CpGV. This resulted in a major difference in the codon usage of both viruses and may reflect adaptive selection constraints to their particular hosts.     

Nucleotide sequence of the left-terminus of infectious laryngotracheitis virus (Gallid herpesvirus 1) SA-2 strain

Summary.  The nucleotide sequence of 10.6 kilobase pairs (kbp) at the left-terminus of infectious laryngotracheitis virus (ILTV) SA-2 vaccine strain was determined. Several features were elucidated, including, 102 base pair (bp) inverted repeats separated by 750 bp of unique sequence which contains an NF-1 binding site indicating that the terminal may be a site for an origin of replication. Other direct repeats were also found in this region. To the right of the inverted repeat region, a 2130 bp region was found to contain small open reading frames (ORFs) of less than 100 aa. Another potential ORF was found to the right of the region containing the small ORFs which consisted of two 184 bp direct repeats inserted into the reading frame, which would truncate the putative product. Only one copy of this repeat was found in the corresponding homologue of the wild type strain SA-0. Six other ORFs were found, which shared little or no identity to homologues of other alphaherpesviruses, suggesting that these putative genes are unique to ILTV. Received December 19, 1996 Accepted April 9, 1997     

A capripoxvirus pseudogene whose only intact homologs are in other poxvirus genomes

Equivalent regions from within the inverted terminal repeats (ITRs) of the genomes of two capripoxviruses, KS-1 and InS-1, were sequenced. The sequence from KS-1 DNA covers the major part of three contiguous open reading frames (ORFs), which match three contiguous ORFs from within the genomic ITRs of the leporipoxvirus Shope Fibroma Virus (SFV). The sequenced region of InS-1 DNA contains only two of the three ORFs. The region homologous to the third ORF has no coding potential due to the presence of several stop codons, resulting from small frameshifting deletions and insertions. The significance of a degenerate poxvirus gene, intact homologs of which are only found in other poxvirus genomes, is discussed.     

His1 and His2 are distantly related, spindle-shaped haloviruses belonging to the novel virus group, Salterprovirus

Spindle-shaped viruses are a dominant morphotype in hypersaline waters but their molecular characteristics and their relationship to other archaeal viruses have not been determined. Here, we describe the isolation, characteristics and genome sequence of His2, a spindle-shaped halovirus, and compare it to the previously reported halovirus His1. Their particle dimensions, host-ranges and buoyant densities were found to be similar but they differed in their stabilities to raised temperature, low salinity and chloroform. The genomes of both viruses were linear dsDNA, of similar size (His1, 14,464 bp; His2, 16,067 bp) and mol% G+C (approximately 40%), with long, inverted terminal repeat sequences. The genomic termini of both viruses are likely to possess bound proteins. They shared little nucleotide similarity and, except for their putative DNA polymerase ORFs, no significant similarity at the predicted protein level. A few of the 35 predicted ORFs of both viruses showed significant matches to sequences in GenBank, and these were always to proteins of haloarchaea. Their DNA polymerases showed 42% aa identity, and belonged to the type B group of replicases that use protein-priming. Purified His2 particles were composed of four main proteins (62, 36, 28 and 21 kDa) and the gene for the major capsid protein was identified. Hypothetical proteins similar to His2 VP1 are present in four haloarchaeal genomes but are not part of complete prophages. This, and other evidence, suggests a high frequency of recombination between haloviruses and their hosts. His1 and His2 are unlike fuselloviruses and have been placed in a new virus group, Salterprovirus.     

The DNA sequence of the simian varicella virus genome

In nonhuman primates, simian varicella virus (SVV) causes a natural disease which is clinically similar to human varicella-zoster virus (VZV) infections. The SVV and VZV genomes are similar in size and structure and share extensive DNA homology. This report presents the complete DNA sequence of the SVV genome. SVV DNA is 124,138 bp in size, 746 bp shorter than VZV DNA, and 40.4% G + C. The viral genome includes a 104,104-bp unique long component bracketed by 8-bp inverted repeat sequences and a short component composed of a 4904-bp unique short region bracketed by 7557-bp inverted repeat sequences. A total of 69 distinct SVV open reading frames (ORFs) were identified, including three that are duplicated within the inverted repeats of the short component. Each of the SVV ORFs shares extensive homology to a corresponding VZV gene. The only major difference between SVV and VZV DNA occurs at the leftward terminus. SVV lacks a VZV ORF 2 homolog. In addition, SVV encodes an 882-bp ORF A that is absent in VZV, but has homology to the SVV and VZV ORF 4. The results of this study confirm the relatedness of SVV and VZV and provide further support for simian varicella as a model to investigate VZV pathogenesis and latency.     

Cysteine usage in Sulfolobus spindle-shaped virus 1 and extension to hyperthermophilic viruses in general

Fuselloviridae are ubiquitous crenarchaeal viruses found in high-temperature acidic hot springs worldwide. The type virus, Sulfolobus spindle-shaped virus 1 (SSV1), has a double-stranded DNA genome that contains 34 open reading frames (ORFs). Fuselloviral genomes show little similarity to other organisms, generally precluding functional predictions. However, tertiary protein structure can provide insight into protein function. We have thus undertaken a systematic investigation of the SSV1 proteome and report here on the F112 gene product. Biochemical, proteomic and structural studies reveal a monomeric intracellular protein that adopts a winged helix DNA binding fold. Notably, the structure contains an intrachain disulfide bond, prompting analysis of cysteine usage in this and other hyperthermophilic viral genomes. The analysis supports a general abundance of disulfide bonds in the intracellular proteins of hyperthermophilic viruses, and reveals decreased cysteine content in the membrane proteins of hyperthermophilic viruses infecting Sulfolobales. The evolutionary implications of the SSV1 distribution are discussed.     

Characterization, molecular cloning, and physical mapping of the Shope fibroma virus genome

Five strains of Shope fibroma virus (SFV), a strain of rabbit myxoma virus, and a strain of vaccinia virus were compared by restriction endonuclease digestion of their viral DNAs. Restriction digest patterns revealed that SFV and rabbit myxoma, both members of the Leporipoxvirus genus, were distinct from vaccinia, an Orthopoxvirus. All strains of SFV examined had a high degree of nucleotide sequence homology as shown by conservation of restriction sites within their genomes. However, restriction patterns of SFV and myxoma were quite different from one another suggesting that the genomes from these two viruses of the Leporipoxvirus genus do not share a large, highly conserved region of homology as do the viruses belonging to the Orthopoxvirus genus. Restriction mapping identified inverted terminal repeats of approximately 12 kb in length. Restriction fragments representing all but 400 bp of the termini were cloned in plasmid vectors.     

Concatemeric forms of intracellular herpesvirus DNA.

Newly synthesized pseudorabies viral DNA sediments in neutral sucrose gradients as molecules with high S values. The fast-sedimenting structures are precursors of mature viral DNA and represent replicative intermediates of this DNA. The sedimentation characteristics of the replicative intermediates are not affected by treatments which should eliminate protein, membrane fragments, or RNA. The buoyant density of the replicative intermediates in cesium chloride indicates that they probably consist of DNA only.Electron microscopic examination of intracellular viral DNA purified by equilibrium sedimentation in CsCl revealed DNA “tangles,” as well as longer than unit-size linear molecules. Mature viral-DNA preparations treated similarly did not contain such structures. Thus, concatemeric forms of viral DNA are present in the infected cells.Maturation of newly synthesized viral DNA to unit-size length occurs in the absence of further DNA synthesis but is dependent on protein synthesis. The “Hirt” procedure separates mature viral DNA from cellular DNA and also separates viral replicative intermediates from mature viral DNA.     

Sequence analysis of the Plutella xylostella granulovirus genome

The Plutella xylostella granulovirus (PxGV) genome DNA was sequenced and the predicted open reading frames (ORFs) were compared to genes of the first-sequenced GV, Xestia c-nigrum GV (XcGV), and those from other baculoviruses and organisms. PxGV DNA has a size of 100,999 bp with a G + C content of 40.7%. The analysis predicted 120 ORFs with a size of 150 nucleotides or larger that showed minimal overlap. Blast searches followed by a comparison of ORF arrangement with those of completely sequenced baculovirus genomes showed the presence of 102 homologs to other genes in the database. Among them, 74 and 100 were homologous to genes of Autographa californica NPV (AcMNPV) and XcGV, respectively. A striking feature of the relationship between the genomes of PxGV and XcGV was the conservation of the order and orientation of homologous genes. Even though the XcGV genome is much larger than that of PxGV (178 vs 101 kb) and had many more predicted ORFs (181 vs 120) with an average amino acid sequence relatedness of 42%, the order and orientation of almost all homologous genes was conserved. The PxGV genome contained four homologous regions (hrs), each with 10 to 23 repeated sequences of 101 to 105 nucleotides containing a 15-bp imperfect palindrome in the center of the repeats.