Germline MEN1 mutations in sixteen Japanese families with multiple endocrine neoplasia type 1 (MEN1)

OBJECTIVE: Multiple endocrine neoplasia type 1 (MEN1) is a syndrome of endocrine tumors involving the parathyroids, anterior pituitary and enteropancreatic neuroendocrine tissues, and is inherited in an autosomal dominant manner. Recently, the gene responsible for this syndrome, MEN1, was positionally cloned in 11q13. We aimed to assess the significance of MEN1 gene diagnostics in families with MEN1. DESIGN: Sixteen probands of familial MEN1 and their 40 family members were subjected to the study. METHODS: Full-length sequencing of the open reading frame and exon-intron boundaries in the MEN1 gene was performed with probands of familial MEN1. Family members were examined for the identified mutation in the proband. RESULTS: We identified heterozygous germline mutations of the MEN1 gene in all of 16 Japanese MEN1 families examined, achieving the highest detectability of MEN1 mutations in familial MEN1 among studies that examined more than 10 families. Eleven kinds of the identified MEN1 germline mutations were novel. More than half were nonsense or frameshift mutations resulting in a premature stop codon (9/15; 60%), and no mutation hot spots or no apparent genotype-phenotype relationships were observed, in support of the results of other studies. We identified 40 mutant MEN1 gene carriers and 16 non-carriers in the course of the present study in those families. CONCLUSIONS: Analysis of the germline mutations in the MEN1 gene, providing significantly useful clinical information to probands and family members of MEN1, should be considered as a standard procedure and categorized as belonging to Group 1 cancer predisposition testing by the American Society of Clinical Oncology.     

MEN1 gene mutations in Hungarian patients with multiple endocrine neoplasia type 1

OBJECTIVE: Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant hereditary disorder associated with mutations of the MEN1 gene. MEN1 may present as a familial or a sporadic disorder, with multiple endocrine tumours including parathyroid adenomas or hyperplasias, and pancreatic endocrine and pituitary gland tumours. The aim of this study was to examine the prevalence and spectrum of MEN1 gene mutations in Hungarian patients with familial and sporadic MEN1 and in those with a MEN1-related state. DESIGN: Mutation analysis, using temporal temperature gradient gel electrophoresis and direct sequencing of all coding exons and the corresponding exon-intron boundaries of the MEN1 gene, was performed. PATIENTS AND MEASUREMENTS: Peripheral blood DNA was obtained from 32 patients (19 index patients with familial or sporadic MEN1 and 13 index patients with familial or sporadic MEN1-related state). First degree relatives were also studied. RESULTS: Ten different MEN1 gene mutations were identified in 10 index patients, including four novel mutations (A91V, G28A and E26X all in exon 2, and L301R in exon 6). All but one mutation occurred in index patients with familial or sporadic MEN1; the prevalence of mutation was considerably higher in index patients with familial MEN1 (6/6 patients, 100%) than in those with sporadic MEN1 (3/13 patients, 23%). Of the 13 index patients with a MEN1-related state, only one patient with recurrent isolated primary hyperparathyroidism had a MEN1 gene mutation. Family screening indicated mutations in six symptomatic and in one asymptomatic first degree relative. CONCLUSION: These results confirm previous reports on the high prevalence of novel MEN1 gene mutations among patients with MEN1, and support the questionable efficacy of mutation screening in patients with sporadic MEN1-related states.     

Effect of multiple endocrine neoplasia type 1 (MEN1) gene mutations on premature mortality in familial MEN1 syndrome with founder mutations

Estimation of mortality and the natural course of a disease is usually based on information of carefully studied individuals with or at risk for a specific disease. Genealogical information has rarely been accurate enough for such studies.With the help of church records and multiple endocrine neoplasia type 1 (MEN1) family information of the two founder MEN1 mutations in Northern Finland (1466del12 and 1657insC), we could trace back common ancestors born in the beginning of the 1700s (1466del12) and approximately 1850 (1657insC) and find 67 probable gene carriers born between 1728 and 1929, which were identified among their offspring. Information was gathered from 34 obligatory MEN1 gene carriers and 31 spouses. The mean age (+/- sd) of death of affected males (n = 16) was 61.1 +/- 12.0 yr vs. 65.8 +/- 15.3 yr for unaffected males (n = 16) and for affected females (n = 16) was 67.2 +/- 10.7 yr vs. 67.7 +/- 14.7 yr for unaffected females (n = 13). The ages of death of the obligatory heterozygotes did not differ from that of the spouses in sex groups or from the sex-matched life expectancy estimates derived from Finnish national statistics. Causes of death differed significantly between female probands and spouses. In conclusion, obligatory MEN1 gene carrier status did not show a harmful effect on survival in this retrospective analysis tracing back to almost 300 yr.     

Novel MEN1 germline mutations in Brazilian families with multiple endocrine neoplasia type 1

OBJECTIVE: To characterize clinical features and identify MEN1 germline mutations in Brazilian families with multiple endocrine neoplasia type 1 (MEN1). Settings Non-profit academic centre. PATIENTS: Fourteen Brazilian families with MEN1 and 141 at-risk relatives. RESULTS: We identified 12 different MEN1 disease-causing mutations, seven of them previously unreported: 308delC; 375del21; 549A>T (I147F); 1243delA; 1348T>G (L413R); 1351T>C (L414P) and 1523G>T (W471C). Families with the recurrent mutations 360delTCTA and L413R were shown to be unrelated by mitochondrial-DNA and Y-chromosome haplotype analyses. Most of the MEN1 single point mutations involved evolutionarily conserved residues, whereas most of the deletion/frameshift changes occurred in GC-rich repetitive regions. Genetic screening of 141 at-risk family members identified 38 MEN1 mutation carriers, 37 (97.4%) of whom had at least one major MEN1-related tumour upon clinical investigation. CONCLUSIONS: High frequencies of MEN1 gene mutations were detected in Brazilian families with MEN1, including seven new genetic mutations that are predicted to cause inactivation of the MEN1 tumour suppressor gene. Our data underscore the need to implement a systematic MEN1 screening programme in Brazil.     

MEN1 gene mutations are a rare event in patients with sporadic neuroendocrine tumors

BACKGROUND: Neuroendocrine tumors of the gastroenteropancreatic (GEP) tract are encountered either as a sporadic type or as part of multiple endocrine neoplasia type 1 (MEN-1) syndrome. Inactivating MEN1 gene mutations have been found to be responsible for this syndrome and have also been described in sporadic cases. The aim of the present study was to evaluate the presence of mutations in the MEN1 gene in a series of 10 well-differentiated neuroendocrine tumors: five of the foregut and five of the midgut tract. METHODS: Retrospective screening for MEN1 gene mutations was carried out in 10 archived, paraffin-embedded neuroendocrine tumors. Polymerase chain reaction amplification and automated sequence analysis of the DNA extracted from the tumors were performed. RESULTS: One mutation (359 del 4) in exon 2 of the MEN1 gene was identified in a neuroendocrine tumor of the foregut (VIPoma of the pancreas). No mutation was identified in midgut neuroendocrine tumors. CONCLUSIONS: Our data confirm that retrospective genetic analysis can be used to identify mutations in the MEN1 gene and indicate that somatic MEN1 gene mutations are a rare event in sporadic neuroendocrine GEP tumors. The frequency of these mutations was 10% in our series, which may differ from that in other studies, due to the small number of cases analyzed.     

Screening for MEN1 tumor suppressor gene mutations in sporadic pituitary tumors

The molecular pathogenesis of the majority of sporadic pituitary tumors is largely unknown. Pituitary adenomas can develop sporadically or as a part of multiple endocrine neoplasia type 1 (MEN1). The MEN1 is thought to be a tumor suppressor gene based on loss of heterozygosity (LOH) for polymorphic markers on 11q13 in tumors of the pancreas, parathyroid, and pituitary. Most patients with familial and sporadic MEN1 carry germ-line mutations in the MEN1 gene. Two previous studies and recently a third one have analyzed mutations by sequencing the MEN1 gene in sporadic pituitary tumors but yielded conflicting results. This study was to investigate and clarify the potential role of MEN1 mutations, in sporadic pituitary adenomas. First, we examined 59 sporadic pituitary adenomas by analyzing LOH on 11q13 in the MEN1 minimal interval with microsatellite analysis. We found 3 tumors with LOH in 1 to 4 polymorphic markers in the MEN1 region. Sequencing analysis did not reveal any mutations in the coding region of the MEN1 gene. However, we found 3 polymorphisms, one of which was a novel CAC to CAT transition encoding His433His, in exon 9. The data show that while LOH occurs in some sporadic pituitary tumors, inactivating mutations of the tumor suppressor gene MEN1 are rare. These results also suggest there may be another additional tumor suppressor gene at this locus which is involved in the pathogenesis of sporadic pituitary neoplasms.     

Novel germline mutations of the MEN1 gene in Greek families with multiple endocrine neoplasia type 1

Introduction  Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant hereditary disorder associated with mutations of the MEN1 gene and characterized by the combined occurrence of tumours of the parathyroid glands, the pancreatic islet cells and the anterior pituitary.
Aim  To identify MEN1 gene mutations and characterize clinical manifestations in Greek patients with MEN1.
Patients and methods  We studied four unrelated index patients with MEN1, 17 relatives and 100 control subjects. Among the relatives, seven were clinically and/or biochemically affected, while 10 were unaffected. DNA extraction, polymerase chain reaction (PCR) and direct sequencing of the MEN1 exons 2–10 and exon/intron boundaries were performed according to standard procedures.
Results  We identified novel MEN1 gene mutations in three out of four index patients (75%) and in all affected (100%) relatives. Novel mutations included: a frameshift mutation in exon 4 (c.684_685insG) at codon 229 (index patient A); a frameshift mutation in exon 8 (c.1160_1170dupAGGAGCGGCCG) involving codons 387–390 (index patient B); and a missense mutation in exon 4 (c.776T > C), which substitutes leucine with proline at codon 259 (L259P) (index patient C). In the fourth index patient, a common polymorphism (D418D) was detected.
Conclusions  This is the first report to reveal a high prevalence of novel MEN1 gene mutations among Greek MEN1 patients with apparent absence of genotype–phenotype correlation. Because of the small number of patients examined, the high prevalence detected might be a chance phenomenon.     

Clinical features of multiple endocrine neoplasia type 1 (MEN1) phenocopy without germline MEN1 gene mutations: analysis of 20 Japanese sporadic cases with MEN1

OBJECTIVE: Multiple endocrine neoplasia type 1 (MEN1) is a familial tumour syndrome of endocrine tumours involving parathyroids, anterior pituitary and enteropancreatic neuroendocrine tissues, and is inherited in an autosomal dominant manner with high penetrance. Recently, the gene responsible for this syndrome, MEN1, was positionally cloned from chromosome 11q13. PATIENTS: To characterize sporadic MEN1 patients, we analysed the MEN1 gene by direct sequencing of the entire open reading frame from 20 individuals. RESULTS: We identified heterozygous germline mutations of the MEN1 gene in 8 of 20 (40%) cases. Seven were novel MEN1 germline mutations. Three mutations were splicing abnormalities, and all were confirmed to be splicing defects by RT-PCR. The clinical significance of detecting germline MEN1 mutations, not only in familial MEN1 but also in sporadic MEN1, was confirmed by the finding of asymptomatic mutant carriers among family members of the sporadic MEN1 patients. Seven of 8 cases with MEN1 mutations had enteropancreatic lesions in contrast to 4 of 12 (P < 0.018) in those cases with no mutation. Ten of the 12 cases without MEN1 mutation were more than 50-year-old. Six of these 10 cases had the same clinical features; primary hyperparathyroidism and a GH-secreting pituitary tumour. CONCLUSIONS: It is likely that the six cases without mutations were MEN1 phenocopies due to (i) two kinds of tumours with high natural incidence in older subjects developed by chance (ii) another familial tumour syndrome with low penetrance, e. g. familial acromegaly with primary hyperparathyroidism by mutation of another gene, or (iii) somatic mutation during early embryonic stages.     

Novel mutations in MEN1, CDKN1B and AIP genes in patients with multiple endocrine neoplasia type 1 syndrome in Spain

Context Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1‐like patients. Objective The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP. Results A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively. Conclusions Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested.     

Novel mutations in the MEN1 gene in subjects with multiple endocrine neoplasia-1

OBJECTIVE: To identify MEN1 gene mutations and characterize clinical manifestations in Chinese kindred with multiple endocrine neoplasia type 1 (MEN1) in Taiwan. PATIENTS AND METHODS: Eight unrelated subjects (one male and seven females, age range 26-70 years) with clinical manifestations of MEN1 were analysed. In addition, 45 relatives that included 10 affected (three males and seven females, age range 32-53 years) and 35 unaffected (17 males and 18 females, age range 15-80 years) subjects were evaluated. Genomic DNA extraction, polymerase chain reaction (PCR) and DNA sequence analysis were performed according to standard procedures. RESULTS: We identified heterozygous MEN1 gene mutations in all eight probands and 10 affected subjects as well as in 13 clinically asymptomatic relatives. Novel mutations included a missense mutation in a heterozygous mutation in exon 9 (GAC --> CAC) resulting in a substitution of aspartic acid by histidine at codon 418 (family 1); a nonsense mutation at codon 556 of exon 10 (GAG --> TAG) resulting in a stop codon and termination (family 2); a missense mutation in exon 2 (GGG --> GAG) causing the substitution of glycine by glutamic acid at codon 110 (family 3); and a deletion/insertion mutation in nucleotide 1200 of exon 8 resulting in frameshift and early termination (family 4). Affected subjects in families 5-7 shared the same C insertion at nucleotide 1650 of exon 10, similar to that previously described as a hotspot for mutation, and proband 8 had a previously described mutation in intron 4 of the MEN1 gene (IVS4-9 G --> A). We also found that 18 (58%) of our 31 MEN1 mutant carriers had clinical symptoms, whereas four (13%) had biochemical abnormalities without clinical symptoms, and nine (29%) were unaffected both clinically and biochemically. CONCLUSIONS: We have identified four novel mutations in the MEN1 gene in patients with MEN1 in Taiwan.     

Pituitary disease in MEN type 1 (MEN1): data from the France-Belgium MEN1 multicenter study

To date, data on pituitary adenomas in MEN type 1 (MEN1) still have to be evaluated. We analyzed the data of a large series of 324 MEN1 patients from a French and Belgian multicenter study. Data on pituitary disease were compared with those from 110 non-MEN1 patients with pituitary adenomas, matched for age, year of diagnosis, and follow-up period. Genetic analysis of the MEN1 gene was performed in 197 of the MEN1 patients. In our MEN1 series, pituitary disease occurred in 136 of 324 (42%), less frequently than hyperparathyroidism (95%, P < 0.001) and endocrine enteropancreatic tumors (54%, P < 0.01). Mean age of onset of pituitary tumors was 38.0+/-15.3 yr (range, 12-83 yr). Pituitary disease was associated with hyperparathyroidism in 90% of cases, with enteropancreatic tumors in 47%, with adrenal tumors in 16%, and with thoracic neuroendocrine tumors in 4%. Pituitary disease was the initial lesion of MEN1 in 17% of all MEN1 patients. MEN1 pituitary adenomas were significantly more frequent in women than in men (50% vs. 31%, P < 0.001). Among the 136 pituitary adenomas, there were 85 prolactinomas and 12 GH-secreting, 6 ACTH-secreting, 13 cosecreting, and 20 nonsecreting tumors. Eighty-five percent of MEN1-related pituitary lesions were macroadenomas (vs. 42% in non-MEN1 patients, P < 0.001), including 32% of invasive cases. Among secreting adenomas, hormonal hypersecretion was normalized, after treatment, in only 42% (vs. 90% in non-MEN1 patients, P < 0.001), with a median follow-up of 11.4 yr. No correlation was found between the type of MEN1 germ-line mutation and the presence or absence of pituitary adenoma. Our study, based on a large group of MEN1 patients, shows that pituitary adenomas occur in 42% of the cases and are characterized by a larger size and a more aggressive presentation than without MEN1.     

Multiple endocrine neoplasia type 1 (MEN1) germline mutations in familial isolated primary hyperparathyroidism

BACKGROUND: Familial isolated hyperparathyroidism (FIHP) is an autosomal dominant disorder characterized by uniglandular or multiglandular parathyroid tumours that occur in the absence of other endocrine tumours. The disorder may represent either an early stage of multiple endocrine neoplasia type 1 (MEN1), or an allelic variant of MEN1, or a distinct entity involving another locus. We have explored these possibilities in seven families in whom primary hyperparathyroidism occurred as the sole endocrinopathy. METHODS: Seven FIHP families were ascertained and venous blood samples obtained from 35 members (17 affected and 18 unaffected) for DNA sequence analysis of the MEN1 gene. The mean (+/- SD) follow-up period in the 17 affected members was 15.06 (+/- 8.83) years. RESULTS: Four heterozygous germline mutations of the MEN1 gene were identified. These consisted of two 4-bp intragenic deletions that would result in prematurely truncated proteins, and two missense (Asp153Val and Ala411Pro) mutations. Furthermore, analysis of parathyroid tumour DNA from one individual revealed a loss of the wild-type allele and retention of the mutant allele, consistent with Knudson's 'two-hit' model of hereditary cancer and a tumour suppressor role for MEN1 in FIHP. CONCLUSIONS: Our results provide further support for FIHP being a distinct allelic variant of MEN1, and an analysis of the 16 mutations reported to date indicate that FIHP is associated with a higher frequency of missense MEN1 mutations.     

Two novel mutations in the MEN1 gene in subjects with multiple endocrine neoplasia-1

Multiple endocrine neoplasia type 1 (MEN1) is characterized by parathyroid, enteropancreatic endocrine and pituitary adenomas as well as germline mutation of the MEN1 gene. We describe 2 families with MEN1 with novel mutations in the MEN1 gene. One family was of Turkish origin, and the index patient had primary hyperparathyroidism (PHPT) plus a prolactinoma; three relatives had PHPT only. The index patient in the second family was a 46-yr-old woman of Chinese origin living in Taiwan. This patient presented with a complaint of epigastric pain and watery diarrhea over the past 3 months, and had undergone subtotal parathyroidectomy and enucleation of pancreatic islet cell tumor about 10 yr before. There was also a prolactinoma. Sequence analysis of the MEN1 gene from leukocyte genomic DNA revealed heterozygous mutations in both probands. The Turkish patient and her affected relatives all had a heterozygous A to G transition at codon 557 (AAG-->GAG) of exon 10 of MEN1 that results in a replacement of lysine by glutamic acid. The Chinese index patient and one of her siblings had a heterozygous mutation at codon 418 of exon 9 (GAC-->TAT) that results in a substitution of aspartic acid by tyrosine. In conclusion, we have identified 2 novel missense mutations in the MEN1 gene.     

Different phenotypes of multiple endocrine neoplasia type 1 (MEN1) in monozygotic twins found in a Japanese MEN1 family with MEN1 gene mutation

We report monozygotic twins who showed different MEN1 phenotypes. The proband (28 y.o., female) had both primary hyperparathyroidism (PHP) and insulinoma, and genetic analysis revealed a point mutation (569del1, exon 3) of the MEN1 gene. This mutation causes a frameshift and produces a stop codon at codon 184. Restriction digestion (HinfI) analysis confirmed the same mutation of the MEN1 gene in six of the affected members including her two sisters, the monozygotic twins, and no such mutation in two unaffected members. In two generations of this family, eight of eleven family members had PHP and four of them were found to have other MEN1-related lesions. Both of the monozygotic twins had PHP. Interestingly, one had pancreatic tumor but the other had no evidence of it. Pituitary MRI showed no pituitary lesion in either of them. This is the first Japanese case of monozygotic twins with different MEN1 phenotypes.     

Clinical and genetic features of patients with multiple endocrine tumors who have neither family history nor MEN1 germline mutations

Multiple endocrine neoplasia type 1 (MEN1) is an hereditary tumor syndrome that involves specific endocrine organs such as parathyroids, anterior pituitary gland, and endocrine pancreas. The responsible gene for this syndrome, MEN1, has been isolated and that enabled genetic diagnosis for patients with endocrine tumors and early detection of asymptomatic gene carriers in affected families. Nevertheless, there are a considerable number of patients with MEN1 who have neither family history nor germline MEN1 mutations. In this article, clinical features of such patients are described. Among 53 MEN1 patients we have seen during the last 20 yr, five patients who did not have either MEN1 germline mutation or family history were categorized as MEN1 phenocopy. During the same period, we have also experienced three patients who had primary hyperparathyroidism and adrenocortical tumor but had no apparent family history of endocrine tumors. These patients were considered as MEN1 phenocopy variants and included in the study. The mean age of MEN1 phenocopy patients (including variants) at diagnosis was 48 yr, which was not significantly different from that of probands of familial MEN1 (46 yr) who carry heterozygous MEN1 gene mutations. In the majority of MEN1 phenocopy patients, primary hyperparathyroidism was due to a single parathyroid adenoma. In contrast to a previous report, we found that MEN1 phenocopy patients are not necessarily older than probands of familial MEN1. Phenotypic expression of such patients is variable, thus differentiation of familial MEN1 and MEN1 phenocopy cannot be made based on age and clinical phenotype alone.     

Cutaneous tumors in patients with multiple endocrine neoplasm type 1 (MEN1) and gastrinomas: prospective study of frequency and development of criteria with high sensitivity and specificity for MEN1

Multiple endocrine neoplasm type 1 (MEN1) is associated with parathyroid, pancreatic, and pituitary tumors. Although most patients present with hyperparathyroidism, the diagnosis can be difficult, because a significant proportion present with other endocrinopathies or may lack a family history, and other MEN1 manifestations may be mild. Recently, multiple cutaneous lesions (angiofibromas and collagenomas) were reported to be frequent in MEN1 patients, and it was proposed that their discovery suggested the diagnosis of MEN1. The purpose of this study was to prospectively assess the frequency and sensitivity/specificity of various cutaneous criteria for MEN1 in 110 consecutive patients with gastrinomas with or without MEN1. All patients had hormonal and functional studies to determine MEN1 status (48 with MEN1, 62 without MEN1), dermatological evaluation, and tumor imaging studies. Angiofibromas and collagenomas were more frequent in MEN1 patients (64% vs. 8% and 62% vs. 5%; P < 0.00001) and were multiple in 77-81% of the MEN1 patients. Lipomas occurred in 17%. The presence of these skin lesions did not correlate with age, disease duration, or other MEN1 features. Angiofibromas or collagenomas (single or multiple) had 50-65% sensitivity for MEN1 and 92-100% specificity. The combination criterion of multiple angiofibromas (more than three) and any collagenomas had the highest sensitivity (75%) and specificity (95%). This criterion has greater sensitivity than pituitary or adrenal disease and is comparable to hyperparathyroidism in some studies of patients with MEN1 with gastrinoma. This criterion should have sufficient sensitivity/specificity to be clinically useful.     

Somatic mutations of the MEN1 gene and microsatellite instability in a case of tertiary hyperparathyroidism occurring during high phosphate therapy for acquired, hypophosphatemic osteomalacia.

Somatic mutations of the MEN type 1 (MEN1) gene were recently shown to be responsible for tumorigenesis in 13-26% of sporadic, nonfamilial primary hyperparathyroidism. However, it is unknown whether these mutations are also involved in tumorigenesis of parathyroid glands occurring during high phosphate therapy for hypophosphatemic rickets or osteomalacia. A male patient with adult-onset, hypophosphatemic osteomalacia had been treated with 1alpha-OHD3 and oral phosphate for 13 yr when tertiary hyperparathyroidism developed. After total resection of four enlarged parathyroid glands and autotransplantation of a hyperplastic gland, the patient has continued to do well for the last 2 yr. Sequence analysis of the coding exons of MEN1 gene revealed a 36-bp deletion with a 2-bp insertion (exon 2) in the right upper parathyroid gland accompanied with loss of heterozygosity at 11q13 locus and a heterozygous mutation of 2-bp deletion (AG) in exon 10 in the right lower gland, in which microsatellite instability was also found. No MEN1 gene mutation was detected in the other two hyperplastic parathyroid glands or in the peripheral blood. These findings indicate that MEN1 gene mutations contributed to tumorigenesis of the right upper parathyroid gland in this case of phosphate-induced tertiary hyperparathyroidism. Very recently a bone tumor was found in the right femoral neck, and the tumor (chondroblastoma) was resected.     

Multiple endocrine neoplasia type 1 (MEN1): loss of one MEN1 allele in tumors and monohormonal endocrine cell clusters but not in islet hyperplasia of the pancreas

CONTEXT: The occurrence of multiple small pancreatic endocrine tumors in patients suffering from multiple endocrine neoplasia type 1 (MEN1) represents a unique possibility to study early neoplasms and their potential precursor lesions. To date, it is unknown whether small islet-like endocrine cell clusters found in MEN1 patients are neoplastic or rather hyperplastic. It is also unclear whether microadenomas develop from islets. DESIGN: We hypothesized that monohormonal endocrine cell clusters observed in MEN1 patients are small neoplasms with loss of heterozygosity of the MEN1 locus. Using a technique combining fluorescence in situ hybridization of the MEN1 locus and the centromeric region of chromosome 11q with hormone immunostaining, we examined resection specimens from four MEN1 patients. We focused our investigations on the following: 1) typical microadenomas; 2) monohormonal endocrine cell clusters; 3) endocrine and exocrine structures entrapped in microadenomas; and 4) morphologically normal islets. RESULTS: Loss of one MEN1 allele was found in all 27 microadenomas and 19 of 20 (95%) monohormonal endocrine cell clusters. By contrast, it was absent in islets and ductal or acinar structures. Our results indicate that monohormonal endocrine cell clusters represent a minute form of microadenomas. CONCLUSION: The frequent presence of single nonneoplastic insulin cells in microadenomas and the occurrence of microadenomas in islets suggest an islet origin of microadenomas. Islet hyperplasia does not seem to be an obligatory stage in pancreatic MEN1-associated tumor development.