Development and evaluation of immunochromatographic assay for simple and rapid detection of Campylobacter jejuni and Campylobacter coli in human stool specimens

An immunochromatographic assay (Campy-ICA) using a newly generated single monoclonal antibody against a 15-kDa cell surface protein of Campylobacter jejuni was developed. When cell suspensions of 86 C. jejuni strains and 27 Campylobacter coli strains were treated with a commercially available bacterial protein extraction reagent and the resulting extracts were tested with the Campy-ICA, they all yielded positive results. The minimum detectable limits for the C. jejuni strains ranged from 1.8 x 10(4) to 8.2 x 10(5) CFU/ml of cell suspension, and those for the C. coli strains ranged from 1.4 x 10(5) to 4.6 x 10(6) CFU/ml of cell suspension. All 26 non-Campylobacter species tested yielded negative results with the Campy-ICA. To evaluate the ability of the Campy-ICA to detect C. jejuni and C. coli in human stool specimens, suspensions of 222 stool specimens from patients with acute gastroenteritis were treated with the bacterial protein extraction reagent, and the resulting extracts were tested with the Campy-ICA. The Campy-ICA results showed a sensitivity of 84.8% (28 of 33 specimens) and a specificity of 100% (189 of 189 specimens) compared to the results of isolation of C. jejuni and C. coli from the stool specimens by a bacterial culture test. The Campy-ICA was simple to perform and was able to detect Campylobacter antigen in a fecal extract within 15 min. These results suggest that Campy-ICA testing of fecal extracts may be useful as a simple and rapid adjunct to stool culture for detecting C. jejuni and C. coli in human stool specimens.     

Evaluation of rapid commercial enzyme immunoassay for detection of Giardia lamblia in formalin-preserved stool specimens.

Two hundred twenty-three formalin-preserved stool specimens were evaluated by using ProSpecT Giardia Rapid Assay (membrane bound) (Alexon, Inc., Sunnyvale, Calif.). Enzyme immunoassay (EIA) results were compared with those by conventional microscopic examination. Two hundred four specimens were negative by both methods, and 13 (6.3%) were positive. Five specimens were negative by initial microscopic exam and positive by EIA; three of these specimens were found to be positive upon extensive microscopic reexamination. The remaining two specimens were from patients who previously tested positive and who had recurrent symptoms of or responded to therapy for giardia. Therefore, we consider both cases to be true positives. One specimen exhibited a single cyst by microscopic exam and was negative by EIA Resolved results yielded a relative sensitivity of 95%, a relative specificity of 100%, a positive predictive value of 99.6%, and a negative predictive value of 100%, compared with a sensitivity of 74% for conventional microscopy.     

Evaluation of an antigencapture enzyme immunoassay for detection ofEntamoeba histolytica in stool samples

In order to identify the prevalence ofEntamoeba histolytica in tourists with diarrhoea returning from countries of the developing world, sensitivity and specificity of a commercially available enzyme immunoassay (EIA) kit for the detection ofEntamoeba histolytica coproantigen in stool were evaluated. Five hundred seventy-seven specimens from 469 patients were examined by microscopy and EIA. Sixty-two specimens from 49 patients were considered positive forEntamoeba histolytica. Compared with microscopic examination of stool samples, the EIA was found to be slightly more sensitive (90.3% vs. 87.1%) and was 97.7% specific forEntamoeba histolytica.     

Evaluation of new rapid commercial enzyme immunoassay for detection of Cryptosporidium oocysts in untreated stool specimens.

Sixty-six stool specimens were evaluated by the ProSpecTR Cryptosporidium rapid enzyme immunoassay (EIA) (Alexon, Sunnyvale, Calif.). Approximately 2 g of untreated stool suspended in buffer was filtered through membranes labelled with anti-Cryptosporidium-specific antigen antibody. Anti-Cryptosporidium-specific antigen antibody was labelled with biotin, horseradish peroxidase conjugated to streptavidin, and tetramethylbenzidine, and each labelled antibody was added in sequence to the membranes. Each membrane had a positive control and test area. EIA results were compared with those of the modified acid-fast procedure. Twenty-three specimens were positive by the initial acid-fast procedure and the EIA. Forty-two specimens were negative by the initial acid-fast test and the EIA. One specimen was negative by the initial acid-fast test and positive by the EIA (sensitivity, 100%; specificity, 98.5%). This technique is easy to use by comparison with the cumbersome, labor-intensive, and more subjective microscopic methods currently available, and its sensitivity equals that of current microscopic methods.     

Use of an enzyme immunoassay does not eliminate the need to analyze multiple stool specimens for sensitive detection of Giardia lamblia

The relative sensitivities of a commercially available enzyme immunoassay (EIA) (ProSpecT Giardia; Alexon-Trend Inc., Ramsey, Minn.) and conventional ovum-and-parasite (O&P) examination for the detection of Giardia lamblia in preserved stool specimens were determined. Paired stool samples collected independently within a 7-day period from 103 patients were analyzed by both methods. A total of 54 specimens from 30 patients (18 asymptomatically infected with G. lamblia and 12 with symptoms consistent with intestinal giardiasis) were determined to be positive for G. lamblia, of which 48 (88.9%) were positive by microscopy and 52 (96.3%) were positive by EIA. Both specimens submitted were positive for G. lamblia by O&P examination for 66.7% (20 of 30) of the positive patients; for 26.7% (8 of 30) a single specimen was positive by O&P examination, and for 6.7% (2 of 30) of those determined to be infected with G. lamblia, both samples were negative by microscopy. The sensitivity of conventional O&P examination was somewhat higher in symptomatically infected individuals, with 75% (9 of 12) of patients in this category having G. lamblia detected in both samples, compared with 61% (11 of 18) of asymptomatic patients. A total of 24 positive patients (80%) had G. lamblia antigen detected by EIA in both submitted samples, 4 positive patients (13.3%) had one specimen positive by EIA, and the EIA was negative in both specimens from 2 infected individuals (6.5%), the sensitivity of EIA was substantially equivalent in asymptomatic and symptomatic individuals (77 versus 83% of patients with positive results on both specimens). Although the sensitivity of EIA for the detection of G. lamblia on a single stool specimen was somewhat higher than that of conventional O&P examination in symptomatic patients (83 versus 75%), in asymptomatic patients (77 versus 61%), and overall (80 versus 67%), examination of two specimens by either EIA or microscopy was necessary to achieve a diagnostic sensitivity of greater than 90%.     

Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR

A two-tube real-time assay, developed in a LightCycler, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO(4)-3'), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 degrees C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85+/-0.5 and 56 degrees C determined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.     

Rapid Identification of Thermotolerant Campylobacter jejuni, Campylobacter coli, Campylobacter lari, and Campylobacter upsaliensis from Various Geographic Locations by a GTPase-Based PCR-Reverse Hybridization Assay

Recently, a gene from Campylobacter jejuni encoding a putative GTPase was identified. Based on two semiconserved GTP-binding sites encoded within this gene, PCR primers were selected that allow amplification of a 153-bp fragment from C. jejuni, C. coli, C. lari, and C. upsaliensis. Sequence analysis of these PCR products revealed consistent interspecies variation, which allowed the definition of species-specific probes for each of the four thermotolerant Campylobacter species. Multiple probes were used to develop a line probe assay (LiPA) that permits analysis of PCR products by a single reverse hybridization step. A total of 320 reference strains and clinical isolates from various geographic origins were tested by the GTP-based PCR-LiPA. The PCR-LiPA is highly specific in comparison with conventional identification methods, including biochemical and whole-cell protein analyses. In conclusion, a simple method has been developed for rapid and highly specific identification of thermotolerant Campylobacter species.     

Evaluation of an immunoassay for direct detection of Escherichia coli O157 in stool specimens.

An enzyme-linked immunosorbent assay (ELISA) produced by LMD Laboratories, Inc., Carlsbad, Calif., was compared with culture for the detection of Escherichia coli O157. Nine of 185 stool specimens evaluated had positive results by the LMD E. coli O157 ELISA and grew E. coli O157 on culture; 174 had negative by LMD E. coli O157 ELISA results and did not grow E. coli O157 on culture. Of 174 specimens negative by LMD E. coli O157 ELISA, 117 specimens grew other enteric pathogens: Campylobacter spp. (46 isolates), Salmonella spp. (43 isolates), Yersinia spp. (20 isolates), and Shigella spp. (8 isolates). There were two indeterminant results by the LMD E. coli O157 ELISA. One stool specimen did not grow other enteric pathogens on culture, and one grew a Campylobacter sp. on culture. Both had negative LMD E. coli O157 ELISA results upon repeat testing. The LMD E. coli O157 ELISA is an accurate, easy-to-read screening method for the detection of E. coli O157 in fecal specimens.     

Evaluation of a commercial monoclonal antibody-based enzyme immunoassay for detection of adenovirus types 40 and 41 in stool specimens.

A commercial monoclonal antibody-based enzyme immunoassay (Adenoscreen; Mercia Diagnostics Ltd., Guildford, United Kingdom) for the detection of adenovirus types 40 and 41 in stool specimens was evaluated. Two assay modes were tested. In the first, 177 stool samples were screened for the presence of adenovirus type 40 or 41 (assay mode 1). Virus was detected in 79 of 82 specimens positive for adenovirus type 40 or 41 by a polyclonal antibody-based immune electron microscope test, giving a sensitivity of 96.3%. The enzyme immunoassay was negative in 91 of 95 stool samples which contained either other adenovirus serotypes or other viruses or were virus negative. The specificity was thus 95.8%. The positive and negative predictive values of this assay against immune electron microscopy were 95.2 and 96.8%, respectively, and the diagnostic accuracy was 96.0%. Viruses from the three false-negative enzyme immunoassay stool samples were verified as adenovirus type 40 or 41 by restriction enzyme analysis, monoclonal antibody-based immune electron microscopy, or both. Two of the three false-negative stool samples were subsequently concentrated by ultracentrifugation, and one of the two stool samples was then positive by enzyme immunoassay. The third false-negative virus was typed as adenovirus type 41 in the second (serotyping) enzyme immunoassay mode. The four enzyme immunoassay false-positive stool samples all contained other adenovirus serotypes (two were type 2, and two were type 5), but no cross-reactivity was seen with other strains of these serotypes and the results probably reflected simultaneous excretion of adenovirus type 40 or 41 with other adenovirus serotypes. In the second assay mode viruses from 15 stool samples were serotyped. The results by enzyme immunoassay (4 were type 40 and 11 were type 41) correlated completely with previous results from restriction endonuclease analyses. The commercial enzyme immunoassay system showed excellent sensitivity and specificity for the detection of adenovirus types 40 and 41 in stool specimens and will make an important contribution to the accurate diagnosis of adenovirus gastroenteritis.     

Rapid and improved gas-liquid chromatography technique for detection of hippurate hydrolysis by Campylobacter jejuni and Campylobacter coli.

A gas-liquid chromatographic method which requires no chloroform extraction of the split products has been investigated for the detection of hippurate hydrolysis by Campylobacter spp. This technique gave better reproducibility than other tests also used in this study and allows the routine use of the gas-liquid chromatographic method for identification of Campylobacter isolates.     

Rapid detection of Clostridium difficile toxin A in stool specimens

Objective: To evaluate a rapid (15-min) enzyme immunoassay in the format of an individual cassette (ImmunoCard toxin A, Meridian, BMD, Marne-la-Vallée, France) for the detection of Clostridium difficile toxin A in stool specimens.
Methods: We compared this new test with the cytotoxicity assay using MRC-5 cells, the ToxA test (TechLab, BioWhittaker, Fontenay-sous-bois, France) and toxigenic culture for the diagnosis of C. difficile -associated diseases (CDAD). A total of 236 stool specimens collected from 220 patients was simultaneously tested with the four methods. Discordant results were resolved by reviewing patients' clinical records.
Results: The prevalence of CDAD was 13.9%. Test sensitivities and specificities were 100% and 99% respectively for the cytotoxicity assay, 87.5% and 100% for ImmunoCard toxin A, 77.4% and 100% for the ToxA test and 100% and 98% for toxigenic culture.
Conclusions: The ImmunoCard Toxin A is a very rapid, individual and easy-to-perform test for the diagnosis of CDAD. It provides same-day results and may be useful for both guiding appropriate treatment and controlling nosocomial spread of C. difficile.     

A new enzyme immunoassay for the detection of enteroviruses in faecal specimens

A new enzyme immunoassay (EIA) for direct detection of enteroviruses based on a group-specific monoclonal antibody was evaluated using stool samples from patients with suspected enteroviral infection. The EIA was compared with polymerase chain reaction (PCR) and virus isolation in cell culture. Of 204 samples tested, 20 were positive by EIA, 34 by PCR, and 18 by cell culture. Compared with PCR, the most sensitive method, the sensitivity of EIA was 58% (20/34); the sensitivity of cell culture isolation was 52% (18/34). The results of both assays correlated in only 60% of cases. The combination of EIA and cell culture isolation detected 76% of PCR-positive stool samples. Enterovirus EIA provides results within 3-4 hr and requires only standard EIA equipment. It represents a rapid, reliable, and cost-effective diagnostic tool for enterovirus diagnosis from faecal samples. Negative results must be confirmed by other techniques, such as PCR or virus isolation in cell culture.     

Development of an immunoassay for rapid detection of ganglioside GM(1) mimicry in Campylobacter jejuni strains

Mimicry of peripheral nerve gangliosides by Campylobacter jejuni lipopolysaccharides (LPSs) has been proposed to induce cross-reacting antiganglioside antibodies in Guillain-Barré syndrome (GBS). Because current methods for LPS characterization are labor-intensive and inhibit the screening of large numbers of strains, a rapid GM(1) epitope screening assay was developed. Biomass from two agar plates of confluent growth yielded sufficient LPS using a novel phenol-water and ether extraction procedure. Extracts of LPS were reacted with cholera toxin (GM(1) ligand), peanut agglutinin (Gal beta1-->3GalNAc ligand), and anti-GM(1) antibodies. After the assay was validated, 12 of 59 (20%) C. jejuni serostrains, including four serotypes that have not previously been associated with GBS, reacted with two or more anti-GM(1) ganglioside reagents. Subsequently, LPS extracts from 5 of 7 (71%) C. jejuni isolates and 2 of 3 (67%) C. jejuni culture collection strains bore GM(1) structures. Overall, the assay system was reliable, efficient, and reproducible and may be adapted for large-scale epidemiological studies.     

Occurrence of nonspecific reactions among stool specimens tested by the Abbott TestPack rotavirus enzyme immunoassay.

Sixty-five stool specimens obtained from children suffering from gastroenteritis were tested for the presence of antigen to rotavirus by the Abbott TestPack Rotavirus (TestPack) enzyme immunoassay kit. The Kallestad Pathfinder enzyme immunoassay, polyacrylamide gel electrophoresis, immune electron microscopy, and virus isolation were utilized as reference assays. Fifty-four specimens were in accord by TestPack and Kallestad Pathfinder. Among 11 discordant specimens positive with TestPack but negative by Kallestad Pathfinder, rotavirus was not identified by polyacrylamide gel electrophoresis, immune electron microscopy, or isolation in primary African green monkey kidney cell cultures. TestPack displayed a performance specificity of 83%. The inordinately high number of stool specimens reported as false-positive by TestPack precludes the incorporation of this antigen detection kit into our routine regimen of diagnostic virologic testing.     

Detection of Helicobacter pylori antigen in stool by enzyme immunoassay

Invasive techniques for diagnosis of Helicobacter pylori (H. pylori) infection require an endoscopic examination which is expensive and inconvenient and may cause complications. Stool cultures for H. pylori or a direct detection of H. pylori antigen in stools by PCR are expensive, tedious, and have a low sensitivity. We recently used an enzyme immunoassay (EIA) to detect H. pylori antigen in stool specimens. A total of 41 patients were seen at Inha University Hospital, Inchon, Korea between September and October 1998. There were 26 men and 15 women who had an average age of 37.6 years which ranged from 5 to 71 years in the present study. All of these patients came to the hospital complaining of an upper abdominal discomfort and were subjected to endoscopy and biopsies. Fifteen had a gastric ulcer, 13 had a duodenal ulcer, 1 had an early gastric cancer, and there were 12 chronic gastritis patients as shown by endoscopy. The biopsy specimens were examined by histology, CLO test, and cultures and these results were used as gold standards. Stool specimens were tested for the H. pylori antigen by EIA. A dual wavelength cut-off of 0.100 that was recommended by the manufacturer gave a good performance (87.1% sensitivity, 100% specificity, 100% positive predictive value, 71.4% negative predictive value, and a 90.2% efficiency). But the adjusted cut-off value using the receiver operating characteristic curve improved the performance of the test (using the cut-off value of 0.024, the sensitivity, specificity, PPV, NPV, and efficiency were 100%, 90.0%, 96.9%, 100%, and 97.6% respectively). Re-evaluation of the cut-off value may be needed for Korean patients. This technique is non-invasive, rapid, easy-to-use, and shows good performance characteristics for diagnosis of H. pylori infections. Therefore, this technique may be a substitute for gastric endoscopy especially in children and some patients who are unable to tolerate an endoscopic examination and it may be substituted for a serologic test in epidemiological research.     

Biotin-avidin-amplified enzyme immunoassay for detection of herpes simplex virus antigen in clinical specimens

A biotin-avidin-amplified enzyme-linked immunosorbent assay (B-A ELISA) has been developed to detect herpes simplex virus type 1 (HSV-1) and HSV-2 antigens in clinical specimens. The test was designed as a solid-phase, double-antibody, sandwich assay in which plates were coated with a polyclonal rabbit immunoglobulin G anti-HSV reagent, and the sandwich antibody was a biotin-labeled mouse immunoglobulin M monoclonal antibody that reacts with a common antigen associated with HSV-1 and HSV-2. The test can be completed in 4 h if antibody-coated plates are available. The detection limit of the B-A ELISA, determined by titration of virus stocks, was found to be approximately 90 PFU or 6 X 10(3) physical particles of either HSV-1 or HSV-2 per 50 microliter of virus stock. The following results were obtained in a study in which swabs were taken from a variety of lesions and assayed for infectivity in tissue culture and by B-A ELISA. Of 421 suspected HSV lesions tested, 69 were positive by both tests and 159 were negative by both tests. A total of 122 were positive by B-A ELISA but negative for infectivity. Seventy-one were negative by B-A ELISA but contained infectious virus. The HSV specificity of the assay was substantiated by partial blocking of reactivity with rabbit immunoglobulin G anti-HSV and by the absence of reactivity with a nonspecific biotin-labeled mouse immunoglobulin M monoclonal antibody.     

Rapid detection of Vibrio cholerae O139 Bengal from stool specimens by PCR.

In a previous study using pure bacterial cultures in a PCR assay, a primer pair corresponding to a unique chromosomal region of Vibrio cholerae O139 Bengal generated an amplicon from only V. cholerae O139 Bengal. PCR with the same primer pair was used to screen 180 diarrheal stool specimens. All the 67 V. cholerae O139 culture-positive stool specimens were positive by PCR, and the remaining specimens, which contained either other recognized enteric pathogens or no pathogens, were all negative by PCR.     

Evaluation of transport media for Campylobacter jejuni in human fecal specimens

It is not always possible to culture feces immediately, and appropriate methods for transport of human specimens, unlike those from animals, have not been fully evaluated. Therefore, we took serial subcultures in two phases from six transport media inoculated with human diarrheal stools known to be positive for Campylobacter jejuni. In phase 1, Cary-Blair medium and buffered glycerol saline did not preserve C. jejuni as well as did alkaline peptone-water (APW), modified Cary-Blair medium, thioglycolate broth (Thio), and Campy-Thio. The four best media (APW, Cary-Blair medium, Thio, and Campy-Thio) preserved 20 fecal samples with C. jejuni better at 4 degrees C (90% survival for 5 to 8 days) than at 25 degrees C (90% survival for 1.7 to 2 days). In phase 2, APW and Thio, along with four modifications of the best media in phase 1, were tested with 23 positive strains. The ranges of survival times with modified media at 25 degrees C were 1.3 to 2.2 days (90%) and 4.7 to 6.8 days (50%). APW with reducing agents preserved C. jejuni better than did APW alone, Thio plus ox bile, or Campy-Thio plus ox bile (P less than 0.05). Thio at pH 8.5 was better at preserving C. jejuni than was APW or Thio plus ox bile (P less than 0.05). If human fecal specimens cannot be refrigerated during transport or storage, we recommend the use of Thio at pH 8.5 or APW with reducing agents for preservation of C. jejuni at 25 degrees C.