Occurrence of Malassezia spp. in the external ear canals of dogs and cats with and without otitis externa.

We studied the lipophilic microbiota of the external ear canals of 332 animals (264 dogs and 68 cats), with and without otitis externa, over an 11-year period from 1988 to 1999. Malassezia pachydermatis was isolated from 62.2% and 50% of dogs with and without otitis externa, respectively, and from 41.2% and 17.6% of cats with and without otitis externa, respectively. In the group of animals studied for lipid-dependent species, these yeasts were isolated from 4.5% of dogs with otitis externa and from 23.1% and 8.9% of cats with and without otitis externa, respectively. M. sympodialis and M. furfur were isolated from cats and M. furfur and M. obtusa from dogs. Our findings show that lipid-dependent Malassezia species may contribute to the etiology of otitis externa in dogs and cats.     

Prevalence of Malassezia spp. in the ears of asymptomatic cattle and cattle with otitis in Brazil.

Yeasts of the genus Malassezia are lipophilic microorganisms that are saprophytes that can act as opportunistic pathogens in animals. Malassezia pachydermatis is commonly isolated from the ear canal and skin of healthy dogs, or in association with seborrheic dermatitis and otitis externa conditions. The objective of the present study was to determine the occurrence of Malassezia spp. in the ears of healthy bovines and bovines with otitis. Specimens (secretion or cerumen) were collected with sterile swabs, inoculated onto Mycosel medium, supplemented with olive oil, and incubated at 35 degrees C for 1 week. Yeasts were identified according to morphological characteristics, growth in Dixon medium at 32 degrees C and Sabouraud glucose medium modified by the addition of Tween 20, 40 or 80. The results showed that 54.7% of the cultures were positive in bovines with otitis (75) and 34.6% were positive in healthy bovines (378). Analysis of the positive cultures (41) from animals with otitis allowed presumptive identification of 24 strains corresponding to M. globosa (12), M. slooffiae (5), M. furfur (5) and M. sympodialis (2). Further studies on a larger number of animals may confirm the trend verified thus far, i.e. a higher frequency of isolation of Malassezia spp. from animals with otitis than from healthy animals (P<0.01) and a predominance of the species M. globosa.     

Carriage of Malassezia spp. yeasts in healthy and seborrhoeic Devon Rex cats.

Skin and anal mucosal carriage of Malassezia spp. yeasts was investigated in 21 healthy Devon Rex cats (DRC) and in 9 seborrhoeic DRC using swabs and contact plates. M. pachydermatis was isolated from 26 cats and lipid-dependent Malassezia spp. isolates were recovered from the claw fold of 5 healthy and 3 seborrhoeic DRC. The frequencies of isolation and population sizes of M. pachydermatis in the axillae, left groin and claw fold in seborrhoeic DRC significantly exceeded (P<0.05) those of healthy animals. The frequencies of isolation and population sizes of M. pachydermatis in the axillae and groin in both groups of DRC, and the frequencies of isolation and population sizes of M. pachydermatis in the claw fold of the seborrhoeic DRC, exceeded those of healthy Domestic short-haired cats. Using polymerase chain reaction--restriction enzyme analyses (PCR-REA) based on amplification of the large subunit rRNA gene, all eight lipid-dependent isolates had profiles that were indistinguishable from that of M. slooffiae CBS 7956. These data indicate that DRC are frequently colonized by M. pachydermatis and that the claw folds may also be colonized by M. slooffiae. The pathogenic significance of the high Malassezia spp. counts in the seborrhoeic DRC should now be determined.     

Susceptibility of yeast isolates from cattle with otitis to aqueous solution of povidone iodine and to alcohol-ether solution.

Lipid-dependent Malassezia species, Candida spp. and Rhodotorula mucilaginosa have been associated with bovine parasitic otitis. This paper evaluated the susceptibility of 63 yeast isolates from cattle with otitis to a povidone iodine aqueous solution (1% and 0.5% v/v) and to an alcohol-ether solution (1:1 v/v). The effectiveness of these antiseptics was assessed using the European suspension test. Products achieving equal to or greater than 5-log reduction in numbers of the challenge organism after 5 min contact are considered to have as acceptable microbicidal effect (ME). The two antiseptic solutions achieved ME greater than 5, when tested at 1 and 5 min contact time, against the majority of yeast strains. The exceptions were alcohol and ether solution against two Candida tropicalis strains. Urea broth macrodilution method was used to determine the minimum inhibitory concentration (MIC), defined as the lowest concentration that resulted in a visually negative urease test or, in the case of Candida spp., turbidity inhibition when compared with that produced by the growth control. Analysis of the results for all 63 isolates showed Malassezia sympodialis and Rhodotorula mucilaginosa to be more susceptible to povidone iodine and Malassezia furfur strains to be less susceptible. Malassezia sympodialis was significantly more susceptible to alcohol-ether solution than other species. This study showed the in vitro efficacy of alcohol-ether solution and povidone iodine and proposes the need for clinical evaluation of the topical treatment and control of bovine otitis with these antiseptics and their effects on the ear microbiota and the ear canal.     

Otitis externa associated with Malassezia sympodialis in two cats

The lipid-dependent species Malassezia sympodialis was isolated from two cats with otitis externa. To our knowledge, this is the first report of the isolation of lipid-dependent species of the genus Malassezia associated with skin disease in domestic animals.     

Proteinase, phospholipase, hyaluronidase and chondroitin-sulphatase production by Malassezia pachydermatis.

The production of four functional enzyme categories was investigated in 30 strains of Malassezia pachydermatis isolated from dogs with otitis or dermatitis. The most appropriate reading intervals for these assays were determined with the aid of statistical comparisons. All strains produced proteinase and chondroitin-sulphatase; hyaluronidase and phospholipase were produced by all skin isolates (15/15) and 14 out of 15 ear canal isolates. Strains from ear canals did not differ significantly as a group from skin strains in quantitative production of any of the four enzymes; production of proteinase and chondroitin-sulphatase in particular was markedly uniform.     

Identification of Malassezia species

Malassezia spp. are lipophilic unipolar yeasts recognized as commensals of skin that may be pathogenic under certain conditions. The genus Malassezia now comprises of seven species. This study was aimed at using a simple practical approach to speciate Malassezia yeasts from clinical material. Seventy skin scrapings from patients with pityriasis versicolor infection, positive in 10% potassium hydroxide (KOH), were cultured onto modified Dixon's agar (mDixon's agar) and Sabouraud dextrose agar (SDA) and incubated at 32 degrees C. Speciation was done on the basis of Gram stain morphology, catalase test, and utilization of Tweens. Out of 70 scrapings 48 (68.75%) showed growth on mDixon's agar. The commonest isolate was M. sympodialis (28, 58%) followed by M. globosa (19, 40%) and one isolate was (2%) of M. restricta. M. sympodialis was the commonest species affecting our population and there was no isolation of M. obtusa, M. slooffiae, M. pachydermatis and M. furfur.     

Chitin Synthase 2 (CHS2) gene of Malassezia species]

Malassezia species have been recognized as members of the microbiological flora of human and animal skin; they are also considered to play an important role in the pathogenesis of folliculitis, atopic dermatitis and otitis externa. Therefore, the molecular characteristics were investigated to clarify the epidemiology and the pathogenesis of diseases associated with Malassezia species in human and animals. Molecular investigation was made of 105 clinical isolates of M. pachydermatis from dogs and cats by random amplification of polymorphic DNA (RAPD) and chitin synthase 2 (CHS2) gene sequence analyses. The RAPD analysis and CHS2 gene analysis indicated that clinical isolates of M. pachydermatis were divided into four distinct genetic types (A, B, C and D). Type A was isolated from lesions of atopic dermatitis, flea allergic dermatitis, otitis externa, pyoderma and seborrheic (dermatitidis) in dogs and cats, and might be predominant on this. The phylogenetic analysis of the nucleotide sequences of CHS2 gene fragments of standard strains of 11 Malassezia species showed 11 distinct clusters of this species.     

Tween 40-based precipitate production observed on modified chromogenic agar and development of biological identification kit for Malassezia species.

We developed a simple identification kit for nine species of Malassezia (M. furfur, M. slooffiae, M. sympodialis, M. restricta, M. obtusa, M. globosa, M. pachydermatis, M. dermatis, and M. japonica) based on their biological features. This method utilizes Tween 40-based precipitate production on modified chromogenic agar (CHROMagar) Malassezia medium, growth on specific agars (Sabouraud's dextrose agar, Cremophor EL agar, Tween 60-esculin agar), and catalase reactions. This identification kit was verified with 11 type and reference strains of nine Malassezia species. An additional 26 clinical isolates were also successfully identified using the kit and the results were confirmed by molecular biological analysis.     

The genetic diversity of clinical isolates of Malassezia pachydermatis from dogs and cats.

Molecular investigation of 110 clinical isolates of non-lipid-dependent Malassezia pachydermatis from dogs and cats was carried out by random amplification of polymorphic DNA (RAPD) and chitin synthase 2 (CHS2) gene sequence analyses. The RAPD analysis indicated that the clinical isolates of M. pachydermatis constituted four distinct genetic types (A, B, C and D). Moreover, the results from CHS2 gene analysis completely agreed with those from the RAPD analyses. The clinical isolates of M. pachydermatis were obtained from normal external ears, lesions of atopic dermatitis, flea allergic dermatitis, otitis externa, pyoderma and seborrheic dermatitidis in dogs and cats. Type A consisted of 93 clinical isolates as well as the ex-neotype strain of M. pachydermatis. The isolates of type A M. pachydermatis originated from lesions of all kinds of diseases. They were predominant on dog and cat skin. The other types, B, C, and D were isolated mainly from otitis externa.     

DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.     

Identification of Malassezia species isolated from patients with seborrhoeic dermatitis, atopic dermatitis, pityriasis versicolor and normal subjects.

We identified Malassezia species isolated from 42 patients with seborrhoeic dermatitis, 17 patients with atopic dermatitis, 22 patients with pityriasis versicolor, 35 normal subjects and 73 healthy medical students. Regarding the prevalence of Malassezia species in the 35 normal subjects, the frequency of isolation of Malassezia globosa was 22%, M. sympodialis 10% and M. furfur 3%. M. slooffiae, M. pachydermatis, M. restricta and M. obtusa were infrequently isolated from normal skin. Two different species were isolated coincidentally from seven samples. In the patients with atopic dermatitis, M. furfur was isolated more frequently from lesional skin (21%) than non-lesional skin (11%). However, there was no statistical significance. Therefore, this result, by itself, is insufficient to prove that M. furfur should be considered to be an exacerbating factor of atopic dermatitis. In seborrhoeic dermatitis, M. furfur (35%) and M. globosa (22%) were isolated from lesional skin on the face at significantly high rates in comparison with the normal subjects. Therefore, M. furfur and/or M. globosa may be pathogens of seborrhoeic dermatitis. M. globosa was isolated at a frequency of 55% from lesional skin of pityriasis versicolor, while all other species were below 10%. These data suggest that the pathogenic species of pityriasis versicolor is M. globosa.     

Carriage of Malassezia spp. yeasts in cats with diabetes mellitus, hyperthyroidism and neoplasia.

The frequencies of isolation and population sizes of Malassezia spp. on skin and at mucosal sites in 16 cats with diabetes mellitus, 20 cats with hyperthyroidism and 8 cats with neoplasia did not vary significantly from those of healthy cats when measured with the use of contact plates and a swab technique. M. pachydermatis was isolated from nine sites in one cat with feline paraneoplastic alopecia and pancreatic adenocarcinoma, two cats with diabetes mellitus and five cats with hyperthyroidism. A polymerase chain reaction-restriction enzyme analysis (PCR-REA) method that differentiated the 11 species of Malassezia spp was used to identify the lipid-dependent isolates that were obtained from two cats with diabetes mellitus, two cats with hyperthyroidism and one cat with multicentric lymphoma. Six isolates had PCR-REA patterns that were indistinguishable from M. slooffiae CBS 7956 and three matched M. nana CBS 9557. Our data suggests that skin and mucosal counts of Malassezia spp. are not routinely increased in cats with diabetes mellitus or hyperthyroidism but we report a further example of an association between feline paraneoplastic alopecia and Malassezia spp. proliferation. To the authors' knowledge, this is the first report of the isolation of M. slooffiae from feline skin.     

A Case of central venous catheter-related infection with Malassezia sympodialis]

We report a 63-year-old male with central venous catheter-related infection caused by Malassezia sympodialis after total gastrectomy for a gastric cancer. He had fever and his leukocyte counts and C-reactive protein were elevated 14 days after his operation. After his central venous hyperalimentation catheter was removed, the inflammatory signs immediately disappeared, suggesting an intravenous catheter-related infection. A yeast-like fungus was cultured in brain-heart infection semi-solid agar ten days later, and was diagnosed morphologically as Malassezia sp. This strain was identified as M. sympodialis by Tween assimilation test and was confirmed by whole-sequence of internal transcribed spacer 1 regions (ITS1). This is the first report of catheter-related infection caused by M. sympodialis. This strain grew and was subcultured on CHROMagar Candida, potato dextrose agar and Sabouraud agar. There have been no reports of such a lipid-independent Malassezia sp. except for M. pachydermatis. The mechanism of lipid independence of this strain is undetermined and future work is needed. Malassezia sp. is receiving increased attention as an etiologic pathogen of catheter-related fungemia in clinical microbiology laboratories and infectious disease sections.     

Granulomatous dermatitis due to Malassezia sympodialis

A 67-year-old man, with multiple skin lesions that appeared over 2 years, had biopsies that disclosed granulomatous dermatitis with associated small yeasts. The urinary antigen test results were negative for Histoplasma infection; cultures from the biopsies did not grow any fungi or other potential pathogens. The chest roentgenogram results were normal. Morphologic examination revealed features of a Malassezia species. Broad-range fungal polymerase chain reaction and DNA sequencing disclosed that the infecting fungus was Malassezia sympodialis , a lipid-dependent yeast. This report supports one other case report that Malassezia species may cause granulomatous dermatitis; in the previous case, the etiologic agent was Malassezia pachydermatis , a nonlipid-dependent species. We recommend the use of lipid-supplemented culture media for specimens from patients with granulomatous dermatitis because several Malassezia species are dependent on lipid; the absence of lipid supplementation in routine cultures likely explains the negative culture results for this patient. This, to our knowledge, is the first report of granulomatous dermatitis caused by M sympodialis.     

Species identification and strain typing of Malassezia species stock strains and clinical isolates based on the DNA sequences of nuclear ribosomal internal transcribed spacer 1 regions

This study demonstrated the application of internal transcribed spacer 1 (ITS1) ribosomal DNA sequences to the species identification and strain typing of 28 standard strains and 46 clinical isolates of the genus Malassezia. The size of ITS1 regions ranged from 162 to 266 bp. Members of the genus Malassezia (M. pachydermatis, M. furfur, M. sympodialis, M. globosa, M. obtusa, M. restricta and M. slooffiae) were classified into seven ITS1-homologous groups and 22 ITS1-identical, individual groups. The 46 clinical isolates of lipophilic Malassezia spp. were identified as belonging to just three ITS1-homologous groups, i.e., M. furfur (19 strains: 11 from pityriasis versicolor, 4 from seborrhoeic dermatitis and 4 from atopic dermatitis). M. sympodialis (22 strains: 7 from pityriasis versicolor, 3 from seborrhoeic dermatitis, 1 from atopic dermatitis and 11 from healthy controls) and M. slooffiae (five strains: three from chronic otitis media and two from healthy controls).     

Human infections due to Malassezia spp.

The genus Malassezia contains three member species: Malassezia furfur and Malassezia sympodialis, both obligatory lipophilic, skin flora yeasts of humans, and Malassezia pachydermatis, a nonobligatory lipophilic, skin flora yeast of other warm-blooded animals. Several characteristics suggest the basidiomycetous nature of these yeasts, although a perfect stage has not been identified. Classically, these organisms are associated with superficial infections of the skin and associated structures, including pityriasis versicolor and folliculitis. Recently, however, they have been reported as agents of more invasive human diseases including deep-line catheter-associated sepsis. The latter infection occurs in patients, primarily infants, receiving parenteral nutrition (including lipid emulsions) through the catheter. The lipids presumably provide growth factors required for replication of the organisms. It is unclear how deep-line catheters become colonized with Malassezia spp. Skin colonization with M. furfur is common in infants hospitalized in neonatal intensive care units, whereas colonization of newborns hospitalized in well-baby nurseries and of older infants is rarely observed. Catheter colonization, which may occur without overt clinical symptoms, probably occurs secondary to skin colonization, with the organism gaining access either via the catheter insertion site on the skin or through the external catheter hub (connecting port). There is little information on the colonization of hospitalized patients by M. sympodialis or M. pachydermatis. Diagnosis of superficial infections is best made by microscopic examination of skin scrapings following KOH, calcofluor white, or histologic staining. Treatment of these infections involves the use of topical or oral antifungal agents, and it may be prolonged. Diagnosis of Malassezia catheter-associated sepsis requires detection of the organism in whole blood smears or in buffy coat smears of blood drawn through the infected catheter or isolation of the organism from catheter or peripheral blood or the catheter tip. Culture of M. furfur from blood is best achieved with Isolator tubes and plating onto a solid medium supplemented with a lipid source. Appropriate treatment of patients requires removal of the infected catheter with or without temporary stoppage of lipid emulsions; administration of antifungal therapeutic agents does not appear to be necessary. Because many patients who develop Malassezia catheter-associated sepsis have severe underlying illnesses, caution must be exercised in attributing all clinical deterioration to Malassezia infection. Our better understanding of how these organisms cause disease awaits the development of a useful typing scheme for epidemiologic studies and further studies on microbial virulence factors and the role of the immune response in pathogenesis.     

Taxonomy of genus Malassezia: progress and problems]

The genus Malassezia is composed of lipophilic basidiomycetous yeasts which were recently shown to consist of seven species, one lipid-independent species, M. pachydermatis and six lipid-dependent species, M. furfur, M. sympodialis, M. globosa, M. obtusa, M. restricta and M. slooffiae. Based on this classification, we will be able to analyze pathogenicity or relationship between Malassezia-related diseases and each species.     

Monitoring spread of Malassezia infections in a neonatal intensive care unit by PCR-mediated genetic typing.

Malassezia furfur and Malassezia pachydermatis were isolated from newborn children and incubators in a neonatal intensive care unit. To assess whether persistence or frequent import of the organisms was the cause of the elevated incidence, genetic typing of the strains was performed by PCR-mediated DNA fingerprinting. By using PCR primers aimed at repeat consensus motifs, six different genotypes could be detected in a collection of six M. furfur reference strains. In the case of 10 M. pachydermatis reference strains, nine different genotypes were detected by three different PCR assays. None of these assays could document genetic differences among the clinical isolates of either M. furfur or M. pachydermatis. On the basis of these results it is concluded that within the neonatal intensive care unit the longitudinal persistence of both an M. furfur and an M. pachydermatis strain has occurred and that Malassezia species can persist on incubator surfaces for prolonged periods of time. It can be concluded that PCR fingerprinting is a Malassezia typing procedure that is to be preferred over the analysis of chromosomal polymorphisms by pulsed-field gel electrophoresis in this genus.