Circulating antibodies to heat-shock protein 60 in Crohn''s disease and ulcerative colitis.

Heat-shock proteins (HSPs) are highly conserved immunogenic intracellular molecules that are induced by inflammatory mediators and may induce autoimmune phenomena in vivo. We have recently demonstrated the increased expression of HSP-60 in the colonocytes of patients with ulcerative colitis. To study further the role of HSP-60 in inflammatory bowel disease, we have now measured antibodies to recombinant mycobacterial HSP-65 (a member of the HSP-60 family) in patients with Crohn's disease, ulcerative colitis, healthy volunteers and, as disease controls, patients with confirmed bacterial diarrhoea. In comparison with healthy controls (n = 20; median level of 89 ELISA units; range 24-292), serum IgA HSP-60 antibodies were elevated in Crohn's disease (n = 21; 157; 57-364; P < 0.05) and active ulcerative colitis (n = 16; 188; 58-373; P < 0.01) but not bacterial diarrhoea (n = 10; 106; 51-285). Increased IgA HSP-60 antibody levels in patients with inflammatory bowel disease may occur as the result of HSP release from injured gut epithelium; alternatively, increased intestinal permeability could facilitate mucosal access of luminal antigens and the generation of cross-reactive anti-bacterial HSP antibodies.     

Peripheral cell-mediated immune response to mycobacterial antigens in inflammatory bowel disease.

A mycobacterial etiology has been proposed in Crohn's disease (CD). We have sought evidence of increased or modified T lymphocyte immune responses to Mycobacterium tuberculosis and Myco, paratuberculosis in patients with CD (n = 13), compared with ulcerative colitis (UC; n = 17) and controls (n = 17). Peripheral blood cells were cultured with phytohaemagglutinin (positive mitogen control), mycobacterial purified protein derivative (PPD) preparations, lysates, column fractions and whole, heat-killed bacteria. Responses of T cells and T cell subsets were assessed by expression of activation markers (CD25, CD69), coupled with blastogenesis assays (3H-thymidine uptake) and estimates of proliferation. Virtually all patients responded to Myco. paratuberculosis and Myco. tuberculosis antigens. There were no significant differences between patient groups, although there was a very high overall correlation (r = 0.95; P < 0.0001) between responses to the two mycobacterial species. Most of the activation and proliferative responses resided in the CD4+ (T helper) subset. Although up to 15% of CD8+ (suppressor/cytotoxic) cells also became activated, the CD8+ cells did not proliferate subsequently. Cells expressing the alternate gamma delta form of the T cell receptor (TCR gamma delta+) did not activate or proliferate in response to mycobacterial antigens. There were no differences in any of these parameters between patient groups. We conclude that there is no specific increase or alteration in cell-mediated anti-mycobacterial immunity in inflammatory bowel disease (IBD). Thus our data do not support a mycobacterial etiopathology of Crohn's disease.     

Anti-neutrophil cytoplasmic antibodies (ANCA) in inflammatory bowel disease: characterization and clinical correlates.

ANCA were detected by indirect immunofluorescence in 34 out of 67 patients with ulcerative colitis (UC, 51%) and in 14 out of 35 patients with Crohn's disease (CD, 40%). All but one ANCA-positive sera produced a perinuclear pattern of fluorescence (P-ANCA) on ethanol-fixed neutrophils. On paraformaldehyde-fixed neutrophils 76% of P-ANCA-positive sera in UC and 50% of P-ANCA-positive sera in CD produced cytoplasmic fluorescence, indicating that, indeed, cytoplasmic antigens are recognized by a considerable number of these sera. By Western blot analysis using whole neutrophil extract as a substrate 46% of sera from patients with UC and 32% of sera from patients with CD showed reactivity with either lactoferrin, polypeptides occurring as a doublet of 66/67 kD mol. wt, or polypeptides occurring as a doublet of 63/54 kD mol. wt, respectively. Identical patterns of reactivity have been observed among P-ANCA-positive sera from patients with autoimmune liver disease and rheumatoid arthritis. These data suggest that ANCA of restricted specificities are not specific for inflammatory bowel disease (IBD), but are present in diverse conditions characterized by chronic idiopathic inflammation.     

Mucosal cell-mediated immunity to mycobacterial, enterobacterial and other microbial antigens in inflammatory bowel disease.

Culture studies have suggested that Mycobacterium paratuberculosis may play a role in the aetiology of Crohn's disease. However, evidence of sensitization to mycobacterial antigens amongst patients with Crohn's disease has not yet been adequately demonstrated. Previous studies of cell-mediated immunity (CMI) in Crohn's disease were restricted to responses of peripheral blood mononuclear cells (PBMC) to mycobacterial antigens. In this study we have investigated the proliferative responses of both PBMC and mesenteric lymph node mononuclear cells (MLNMC) to a range of mycobacterial and non-mycobacterial antigens. There was no evidence of specific sensitization in the responses of MLNMC and PBMC from patients with inflammatory bowel disease (IBD) to the mycobacterial antigens. However, anergy to M. paratuberculosis could not be excluded. IBD MLNMC responses to most antigens were generally greater than those of PBMC, which were often undetectable. When compared with controls, there was evidence of increased CMI to a range of non-mycobacterial antigens, especially Yersinia enterocolitica, amongst both MLNMC and PBMC from patients with Crohn's disease and ulcerative colitis (UC). These results do not provide support to the proposed role of mycobacteria in the pathogenesis of Crohn's disease, but indicate that further investigation may determine a role for bacterial-specific T cell-mediated responses in the pathogenesis of IBD.     

Non-response to infliximab may be due to innate neutralizing anti-tumour necrosis factor-alpha antibodies

Infliximab is a chimeric anti-tumour necrosis factor (TNF)-alpha antibody that is therapeutic in many patients with inflammatory bowel disease. What causes certain patients not to respond is unknown. The question posed is whether innate anti-TNF-alpha antibodies play any role in the response to infliximab. Blood was drawn prior to the initial dose of infliximab. Serum anti-TNF-alpha antibodies were quantitated by enzyme-linked immunosorbent assay (ELISA). Affinity-purified anti-TNF-alpha antibodies were isolated from serum immunoglobulin G using TNF-alpha-coated beads. The ability of these antibodies to induce apoptosis of macrophages was measured by annexin and propidium iodide staining. Changes in TNF receptor type 2 (TNFR2) expression and release were determined by immunofluorescence and ELISA respectively. TNF-alpha-neutralization was assessed by the reversal of the lytic actions of TNF-alpha on WEHI cells. The amounts of innate anti-TNF-alpha antibodies in the serum from infliximab responders versus non-responders were the same. Apoptosis of monocytes increased with infliximab and by several of the purified anti-TNF-alpha antibodies, but these findings did not vary with the patients' responses to infliximab. Effects of the anti-TNF-alpha antibodies on the expression of TNFR2 on monocytes and their release of soluble TNFR2 did not vary with the patients' responses to infliximab. However, the neutralizing capacity of these antibodies differed, with responders having antibodies that reduced only 47 +/- 4% of the TNF-alpha activity while those from non-responders reduced 70 +/- 5% of the TNF-alpha activity (P < 0.01). Non-responders have innate anti-TNF-alpha antibodies with greater neutralizing activity than antibodies from responders. Any TNF-alpha-mediated disease process would be neutralized by intrinsic antibodies, so that the disease is likely to be driven by non-TNF-alpha-mediated events.     

Human colonic intraepithelial lymphocytes from patients with inflammatory bowel disease fail to down-regulate proliferative responses of primed allogeneic peripheral blood mononuclear cells after rechallenge with antigens.

Human colonic intraepithelial lymphocytes from control subjects down-regulate the proliferative responses of primed allogeneic peripheral blood mononuclear cells on rechallenge with antigens or phytohaemagglutinin (PHA). In contrast, human colonic intraepithelial lymphocytes from patients with inflammatory bowel disease fail to down-regulate the proliferative responses of primed allogeneic peripheral blood mononuclear cells on rechallenge with antigens. These findings may be important in the development and maintenance of the mucosal immunological activation of inflammatory bowel disease.     

Chemokine expression in IBD. Mucosal chemokine expression is unselectively increased in both ulcerative colitis and Crohn's disease

Mucosal changes in inflammatory bowel disease (IBD) are characterized by ulcerative lesions accompanied by prominent cellular infiltrates in the bowel wall. Chemokines are chemotactic cytokines that are able to promote leukocyte migration to areas of inflammation and are also able to initiate cell activation events. They have recently been implicated in the pathophysiology of many disease states. The aim of this study was to detail the degree and distribution of specific chemokines, interleukin (IL)-8, monocyte chemoattractant protein (MCP)-1, -2, and -3, and macrophage inflammatory protein (MIP)-1alpha and -1beta, in IBD mucosa. Thirty-nine patients were included, ten controls, 20 ulcerative colitis (UC), and nine Crohn's disease (CD), with a range of disease activity. Colonic mucosal biopsies were collected from UC, CD, and control patients and embedded in glycol methacrylate. Two-micrometre-thick sections were cut and stained using immunohistochemistry for chemokine protein expression. Sections were analysed using a light microscope. Expression of all types of chemokine protein was detected in colonic mucosa from both control and IBD patients. Patterns of staining between IBD patients and controls differed significantly, but CD and UC patients demonstrated similar patterns of staining. Individual chemokine expression was found to be significantly up-regulated in IBD when patients were compared with the non-diseased group in all areas of the mucosal sections. Up-regulated chemokine expression correlated with increasing activity of the disease. It is concluded that human colonic chemokine expression is non-selectively up-regulated in IBD. The results supported the hypothesis that the degree of local inflammation and tissue damage in UC and CD is dependent on local expression of specific chemokines within IBD tissues.     

Incidence and Prevalence of Inflammatory Bowel Disease across Asia

Inflammatory bowel diseases (IBD), including ulcerative colitis (UC) and Crohn''s disease (CD), are chronic inflammatory disorders of the gastrointestinal tract caused by interactions between genetic, environmental, immunological, and microbial factors. While the incidence and prevalence of IBD in Asian populations were relatively lower than those in Western countries, they appear to be gradually increasing. A Westernized diet, high socioeconomic status, improvement of hygiene, and development of vaccination could affect the increases in IBD incidence and prevalence in Asian countries. This review describes the latest trends in the incidence and prevalence of IBD in Asia. Studying the epidemiology of IBD in Asia may unravel the etiopathogenesis of and risk factors for IBD.     

Investigation of the expression of IL-1beta converting enzyme and apoptosis in normal and inflammatory bowel disease (IBD) mucosal macrophages.

Activated mucosal macrophages are derived from circulating monocytes and appear to play a major role in the pathogenesis of IBD. We have recently shown that IBD, but not normal, mucosal macrophages express the active form of IL-1beta converting enzyme (ICE) and are therefore capable of releasing mature IL-1beta. ICE expression by other mucosal cell types is unknown. Active ICE expression has also been implicated in apoptosis. The aim of this study was to investigate ICE expression (using an antibody that recognizes both active and precursor forms) in normal and IBD mucosa and to determine whether ICE-expressing macrophages are undergoing apoptosis. Normal and active IBD mucosal cells, in tissue sections and after isolation, were studied by immunohistochemistry and flow cytometry. In the mucosa, macrophages were the predominant ICE-expressing cell type. In contrast to normal, most IBD mucosal macrophages expressed ICE. Of IBD colonic macrophages 11.8 +/- 3.2%, and of normal colonic macrophages 6.6 +/- 0.6% expressed Apo2.7, a marker for apoptotic cells. Similar data were obtained when annexin V was used to identify cells undergoing apoptosis. DNA fluorescence flow cytometric analysis of normal and IBD lamina propria cells showed the presence of only small hypodiploid DNA peaks. We conclude that in the human intestinal mucosa, macrophages are the predominant ICE-expressing cell type. Expression of the active form of ICE and macrophage apoptosis are not interdependent. One mechanism of loss of resident macrophages from normal mucosa and of recruited macrophages from IBD mucosa is by apoptosis.     

Met-enkephalins in patients with inflammatory bowel diseases

PurposeOpioid peptides provide a link between the neuroendocrine and immune systems. They modify the inflammatory process through their effect on the synthesis and secretion of cytokines and on the proliferation of leukocytes to the inflammatory lesion. The evaluation analyzed changes in free met-enkephalin concentration values in the serum and colon mucosal biopsy specimens of patients with inflammatory bowel disease (IBD).Material and MethodsIn serum and colon mucosal biopsy specimens, free met-enkephalin levels were determined in 43 patients with ulcerative colitis (UC) and 38 individuals with Crohn's disease (CD). The evaluation analyzed the effect of disease activity, inflammatory lesions of the colon and laboratory parameters, on the level of the investigated marker. The control group consisted of 45 healthy volunteers.ResultsSerum free met-enkephalin levels were depressed in patients with CD (85.4pg/ml) and UC (101.5pg/ml) as compared to the controls (119.4pg/ml). Met-enkephalin levels in colonic biopsies collected from inflammatory lesions in IBD patients were significantly higher as compared to sections without inflammatory lesions (6.59pg/mg vs. 2.89pg/mg, p < 0.01 in the CD group and 6.12pg/mg vs. 3.47pg/mg, p < 0.05 in the UC group) and their level correlated with disease activity.ConclusionsThe present investigation is the first study that demonstrates changes in free met-enkephalin levels in IBD that may play a role in the pathogenesis and course of the disease. Further studies are necessary to assess the anti-inflammatory effect of opioid peptides.     

Are anti-neutrophil cytoplasmic antibodies (ANCA) clinically useful in inflammatory bowel disease (IBD)?

Since the first detection of ANCA in IBD, numerous studies have dealt with their prevalence, antigenic specificities, clinical significance, pathophysiological role, and their induction. This review summarizes the information obtained from those studies and shows that ANCA are not directly useful as diagnostic and prognostic factors in IBD. ANCA were detected in 50-85% of patients with ulcerative colitis (UC) and 10-20% of patients with Crohn's disease (CD). Multiple target antigens are recognized by these autoantibodies, including both cytoplasmic and nuclear proteins. A pathophysiological role for ANCA in IBD is far from clear. On the one hand, it is suggested that ANCA are genetic markers of susceptibility for IBD, and on the other hand, the induction of ANCA in those diseases may just be an epiphenomenon of chronic inflammation. We discuss recent evidence that ANCA may be induced by a break-through of tolerance towards bacterial antigens.     

Cross-reactivity of yeast antigens in human colon and peripheral leukocytes

Elevation of the serum anti-Saccharomyces cerevisiae antibody (ASCA) level has been reported in patients with Crohn's disease. This study investigated the antigenic distribution of S. cerevisiae in human colon and peripheral leukocytes. ASCA was isolated from sera from patients with Crohn's disease using immuno-affinity chromatography and then biotinylated and assayed immunohistologically and immunocytologically to determine the distribution of antigens recognized by ASCA in human colon and peripheral leukocytes. Immunoblot analysis of yeast extract and human peripheral leukocytes was performed. Immunohistological study using biotinylated ASCA revealed the presence of yeast-like particles in the granulation tissue of inflamed colonic mucosa. Biotinylated ASCA also stained lymphocytes and polymorphonuclear cells infiltrating inflamed intestine. Monocytes in epithelioid granulomas of colon with Crohn's disease were also stained. Polymorphonuclear leukocytes in peripheral blood were also stained with biotinylated ASCA. The antigens reactive to ASCA among heat-extracted, non-heat-extracted yeast antigens, and human leukocyte extract differed. The findings of cross-reactivity of polymorphonuclear leukocytes with S. cerevisiae antigen and the presence of S. cerevisiae antigen in Crohn's disease granulomas suggest the possibility of involvement of S. cerevisiae in the pathogenesis of Crohn's disease.     

Changes in phenotypically distinct mucosal macrophage populations may be a prerequisite for the development of inflammatory bowel disease.

Previous studies have demonstrated the presence of much more marked macrophage heterogeneity in colonic mucosa affected by the idiopathic inflammatory bowel diseases (ulcerative colitis and Crohn's disease) than in normal mucosa. This study examines the morphology, distribution and phenotypic expression of mucosal macrophage-like cells in biopsies from patients with idiopathic inflammatory bowel disease in comparison with disease control samples from patients with colonic infection or ischaemia. Approximately 80% of macrophage-like cells in histologically normal mucosa co-express the antigens recognized by the monoclonal antibodies RFD1 (an interdigitating cell marker) and RFD7 (a marker for mature tissue macrophages). In idiopathic inflammatory bowel disease, the normal colonic macrophage population is partly replaced by cells staining positively with RFD7 alone, and, to a lesser extent, with RFD1+ dendritic cells. Sections from patients with infections and ischaemia exhibited epithelial HLA-DR positivity and infiltration of the lamina propria by a more heterogeneous population of macrophages than that seen in histologically normal mucosa. However, the displacement of the normal colonic macrophage phenotype by RFD7+ tissue macrophages occurred to a significantly greater extent in idiopathic inflammatory bowel disease than in disease control mucosa. A pathognomonic feature of the ulcerative colitis and Crohn's colitis sections was the clustering of RFD9+ epithelioid cells at the bases of disrupted crypts and adjacent to areas of mucosal damage. It is concluded that a degree of macrophage heterogeneity and macrophage infiltration can occur as a non-specific response to colonic mucosal damage. The distinctive feature of idiopathic inflammatory bowel disease mucosa is the almost complete replacement of the normal colonic mucosal macrophage population by tissue macrophages and epithelioid cells, and this phenomenon may be important in promoting the development of a chronic inflammatory state.     

Associations between TNFSF15 polymorphisms and susceptibility to ulcerative colitis and Crohn's disease: A meta-analysis

Abstract

Aims: Several polymorphisms have been identified in TNFSF15, while their roles in the incidence of ulcerative colitis (UC) and Crohn's disease (CD) are conflicting. This meta-analysis was aimed to clarify the impact of these polymorphisms on UC and CD risk. Method: Databases were searched until 31 January 2014 for eligible studies on TNFSF15 polymorphisms. Data were extracted, and pooled odd ratios (ORs) as well as 95% confidence intervals (95% CIs) were calculated. Results: Fifteen studies with 8903 CD patients, 4687 UC patients and 12?606 controls were included. Except for rs4263839 polymorphism, significant associations were found between the rest six TNFSF15 polymorphisms and CD risk (rs3810936: OR?=?2.10, 95% CI, 1.47–3.00; rs6478108: OR?=?2.19, 95% CI, 1.53–3.13; rs4979462: OR?=?1.89, 95% CI, 1.42–2.52; rs6478109: OR?=?2.00, 95% CI, 1.39–2.88; rs7848647: OR?=?1.54, 95% CI, 1.15–2.06; rs7869487: OR?=?1.51, 95% CI, 1.06–2.17). And we found rs3810936, rs6478108 and rs6478109 polymorphism were significantly associated with UC risk (rs3810936: OR?=?1.19, 95% CI, 1.06–1.34; rs6478108: OR?=?1.16, 95% CI, 1.06–1.26; rs6478109: OR?=?1.16, 95% CI, 1.03–1.32). According to the subgroup analysis by ethnicity, except for rs4263839 in Caucasian and rs4979462 in Asian, all the rest investigated TNFSF15 polymorphisms were associated with CD risk and rs3810936 and rs7848647 polymorphism in Asian as well as rs6478108 polymorphism in Caucasian were associated with UC risk. Conclusion: This meta-analysis indicated that most of the seven TNFSF15 polymorphisms (except for rs4263839) were risk factors contributed to CD and UC susceptibility. The differences in ethnicity did not influence the risk obviously.     

Enteric viral pathogens in children with inflammatory bowel disease

The causes of exacerbations of inflammatory bowel disease (IBD) are unknown. The presence of RNA of an enterovirus, norovirus GI, norovirus GII, rotavirus, astrovirus, and sapovirus was sought in stool samples of 50 children (median age 12.9 years) undergoing gastrointestinal endoscopies for IBD or its exclusion (Crohn's disease n = 18, ulcerative colitis n = 13, indeterminate colitis n = 2, non‐IBD n = 17). Viral RNA was found in three fecal samples (norovirus GII n = 2, sapovirus n = 1), all in children without IBD. Therefore, enteral viruses may play only a minor role in IBD. J. Med. Virol. 84:345–347, 2012. © 2011 Wiley Periodicals, Inc.     

Aberrant plasmacytoid dendritic cell distribution and function in patients with Crohn's disease and ulcerative colitis

Dendritic cell (DC) function is believed to be of critical importance for the pathogenesis of inflammatory bowel disease (IBD). To date, most research in animal models and the few human data available is restricted to myeloid DC, while plasmacytoid DC (pDC) capable of controlling both innate and adaptive immune responses have not yet been investigated systematically in human Crohn's disease (CD) or ulcerative colitis (UC). CD11c^‐, CD303⁺/CD304⁺ and CD123⁺ pDC from peripheral blood (n = 90), mucosal tissue (n = 28) or mesenteric lymph nodes (n = 40) (MLNs) of patients with UC and CD or controls were purified and cultured. Thereafter, pDC were enumerated, phenotyped and cytokine secretion measured by flow cytometry (FACS), immunohistochemistry and/or cytometric bead array, respectively. Interferon (IFN)‐α secretion following cytosine phosphatidyl guanine (CpG) A oligodeoxynucleotide (ODN) 2216 (5′‐GGGGGACGATCGTCGGGGGG‐3′) stimulation was assessed by enzyme‐linked immunosorbent assay (ELISA). We found a significantly higher frequency of pDC in the inflamed colonic mucosa and MLN of IBD patients. Moreover, the fraction of CD40 and CD86 expressing cultured peripheral blood pDC was significantly higher in flaring UC and CD patients and their secretion of tumour necrosis factor (TNF)‐α, interleukin (IL)‐6 and IL‐8 were increased significantly compared with controls. In contrast, the IFN‐α secretion of peripheral blood pDC isolated from flaring IBD, particularly in UC patients, was reduced significantly compared with controls. Our data suggest an aberrant distribution and function of pDC in IBD, contrary to their generally implicated role as inducers of tolerance. We speculate that the impaired IFN‐α secretion may relate to the hypothesized defect in innate immunity in IBD and could also impact upon the generation of regulatory T cells (T_reg).