Tracking chromosome dynamics in live yeast cells: coordinated movement of rDNA homologs and anaphase disassembly of the nucleolus during meiosis

A prerequisite for determination of chromosome dynamics in live cells is development of a method for staining or marking the chromosome of interest. We describe here a unique chromosome-tracking system that differentially marks two large chromosome segments from homologs in the budding yeast Saccharomyces cerevisiae. Using yeast genetics and the special features at the repetitive ribosomal RNA (rRNA) gene cluster, we incorporated arrays of the tet operator and the lac operator into each repeat of the two rDNA homologs by homologous recombination. Expression of tet repressor-fused green fluorescent protein and lac repressor-fused red fluorescent protein in engineered cells led to the differential labeling of rDNA homologs. Using live-cell three-dimensional fluorescence microscopy, we showed that homologs undergo contraction and expansion cycles in an actin-dependent manner during meiosis and that chromosome mobility appears to be correlated with nuclear positioning. Our observations further revealed that, in contrast to mitosis, in meiosis the yeast nucleolus, the site of rRNA processing, was disassembled upon anaphase onset, suggesting a differential regulation of the rDNA array during meiotic chromosome segregation. Because rRNA genes are highly conserved, a similar chromosome-engineering approach may be adaptable in other eukaryotes for functional assays of chromosome organization in live cells.     

Mapping of rRNA genes by integration of hybrid plasmids in Schizosaccharomyces pombe

Summary The major rRNA genes of the fission yeast Schizosaccharomyces pombe were mapped on chromosome III by plasmid integration. The integration vector YIp33 containing S. cerevisiae LEU2 gene was combined with the S. pombe rDNA. Since LEU2 complements S. pombe leu1 deficiency, it could be used as the genetic marker for integration. The 10.4 kb rDNA repeat contained ARS sequence, and therefore 2.4 kb and 0.7 kb subfragments not containing ARS were subcloned into YIp33 and transformed leu1 S. pombe cells to Leu⁺. Genetic analyses of the transformants indicated that the integrated rDNA resides in the long arm of the shortest chromosome III, tightly linked to ade5 (1.4 cM). This result is consistent with our previous finding that the DAPI-stained smallest chromosomes were associated with the nucleolus (Umesono et al. 1983).Abbreviations ARS autonomously replicating sequence - DAPI 4,6-diamidino-2-phenylindole - kb kilo base pairs - rDNA DNA segment containing ribosomal RNA genes - rRNA ribosomal RNA     

Organization of the ribosomal RNA genes in Schistosoma mansoni

The organization of the rRNA genes of Schistosoma mansoni has been determined by Southern blot analysis of genomic DNA digested with restriction enzymes, by isolation of the entire repeat on a single fragment of about 11 kilobase pairs from a genomic DNA library constructed in bacteriophage lambda and by characterization of three cloned EcoRI fragments which span the entire repeat. The segments encoding both the large and small rRNA subunits have been identified using specific cloned yeast rDNA fragments as probes and EcoRI, HindIII and BamHI restriction enzyme maps of the rRNA genes were constructed. The ends of the RNAs have been precisely mapped on the genomic DNA by S1 protection experiments. Our data indicate that the rRNA genes are present as a tight cluster. The total length of the rDNA repeat is about 10 kilobase pairs. There appears to be no variation in the size of transcribed and non-transcribed spacer DNA. At the RNA level we have characterized and mapped a small gap in the 28S RNA molecule. The interruption causes the RNA to dissociate into two equal sized fragments when analyzed under denaturing conditions.     

Ribosomal DNA and the nucleolus in the context of genome organization

The nucleolus constitutes a prominent nuclear compartment, a membraneless organelle that was first documented in the 1830s. The fact that specific chromosomal regions were present in the nucleolus was recognized by Barbara McClintock in the 1930s, and these regions were termed nucleolar organizing regions, or NORs. The primary function of ribosomal DNA (rDNA) is to produce RNA components of ribosomes. Yet, ribosomal DNA also plays a pivotal role in nuclear organization by assembling the nucleolus. This review is focused on the rDNA and associated proteins in the context of genome organization. Recent advances in understanding chromatin organization suggest that chromosomes are organized into topological domains by a DNA loop extrusion process. We discuss the perspective that rDNA may also be organized in topological domains constrained by structural maintenance of chromosome protein complexes such as cohesin and condensin. Moreover, biophysical studies indicate that the nucleolar compartment may be formed by active processes as well as phase separation, a perspective that lends further insight into nucleolar organization. The application of the latest perspectives and technologies to this organelle help further elucidate its role in nuclear structure and function.

     

Cloning and characterisation of the ribosomal RNA genes of the dimorphic yeast,Yarrowia lipolytica

Summary The ribosomal RNA genes of Yarrowia lipolytica have been identified, both in restriction digests of total genomic DNA and in a pBR322 gene bank, by hybridisation with cloned Saccharomyces cerevisiae rDNA. The Y. lipolytica rDNA repeat unit is 8.9 kb in size and contains the genes for the 25S and 18S, but not the 5S, rRNA species. The number of copies of these repeat units is approx. 50 per haploid genome. Several clones were found which did not conform to the standard restriction map due to differences outside the coding region. It appears that there is either heterogeneity of the spacer sequence within a strain or that the Y. lipolytica rDNA genes may be present as a number of separate clusters within this yeast's genome.     

The influence of B chromosomes on rDNA organization in rye interphase nuclei

Patterns of rye rDNA organization in interphase nuclei were studied through the use ofin situ hybridization in spreads of root meristem cells from plants with and without B chromosomes (Bs). In cells from plants without Bs each rDNA locus is organized as a single perinucleolar knob of condensed chromatin with decondensed chromatin inside the nucleolus. In plants with Bs there is a marked modification of the pattern, found in more than 23% of nuclei, which involves several regions of condensed chromatin interspersed with decondensed chromatin inside the nucleolus. This B-induced alteration in rDNA interphase organization suggests a change in expression of the rRNA genes located on the A chromosomes probably related to the reduction in nuclear RNA observed previously in plants with Bs. The influence of the Bs on the expression of A chromosome genes, through rearrangement of interphase chromatin, could provide the basis of an explanation for some of the known phenotypic effects of B chromosomes in rye.     

Location and expression of ribosomal RNA genes in grasshoppers: Abundance of silent and cryptic loci

We investigate regularities and restrictions in chromosome location of ribosomal RNA genes, analysed by fluorescent in situ hybridization (FISH), and their phenotypic expression assessed by nucleolus formation at first meiotic prophase cells, analysed by silver impregnation, in 49 grasshopper species. High variation was found for rDNA location between species within most genera analysed. The mean haploid number of rDNA loci detected by FISH was 2.47, but some species had up to 10 loci. Chromosome distribution of rDNA loci differed between the Gomphocerinae and Oedipodinae subfamilies, most loci being proximal to the centromere in the former and distal to it in the latter. Chromosomes 2, 3 and X frequently carried rDNA in Gomphocerinae species with 2n male symbol=17 chromosomes, whereas chromosomes 6 and 9 were the most frequent rDNA locations in the Oedipodinae. About 13% of the 126 rDNA loci detected by FISH were silent, although this figure might be even higher. The comparison of FISH and silver-impregnation results also suggested the existence of cryptic NORs, i.e. those forming small nucleoli with no apparent presence of rDNA revealed by FISH. This was especially clear after the same cells in two species were sequentially treated with both silver impregnation and FISH. The abundance of silent and cryptic loci might thus suggest that rDNA spreads through grasshopper genomes by the Dubcovsky and Dvorak mechanism-that is, the transposition of a few rRNA genes to new chromosome locations, their amplification giving rise to new NORs, and the elimination of the old NORs. The cryptic NORs might correspond to nascent NORs, i.e. a few rRNA gene copies moved to new locations, whereas the inactive rDNA loci might correspond to those being in the process of elimination.     

Cloning and characterization of the ribosomal RNA gene repeat from Ostertagia ostertagi.

Clones of the rRNA genes of Ostertagia ostertagi were selected from a library prepared from the genomic DNA of adult worms of strain LA-2. A 13.4-kb insert in a clone, lambda OOR78, is comprised of one complete 7.5-kb rDNA unit and portions of two adjacent units. The rDNA unit is directly repeated in a head-to-tail fashion and represents approximately 0.9% of the total genomic DNA. This repeating unit appears to be the only long tandemly repeated sequence in the genome. Restriction enzyme recognition sites in the rDNAs of four strains of O. ostertagi were fully conserved with the exception of one PstI site present in the large rRNA gene which was absent from a proportion of the genes of the LA-2 strain. The rDNA of O. ostertagi is more similar to that of Caenorhabditis elegans in unit length and arrangement than to parasitic helminths previously examined.     

Tandemly repeated DNA is a target for the partial replacement of thymine by beta-D-glucosyl-hydroxymethyluracil in Trypanosoma brucei

In the DNA of African trypanosomes a small fraction of thymine is replaced by the modified base beta-D-glucosyl-hydroxymethyluracil (J). The function of this large base is unknown. The presence of J in the silent variant surface glycoprotein gene expression sites and the lack of J in the transcribed expression site indicates that DNA modification might play a role in control of gene repression. However, the abundance of J in the long telomeric repeat tracts and in subtelomeric arrays of simple repeats suggests that J may also have specific functions in repetitive DNA. We have now analyzed chromosome-internal repetitive sequences in the genome of Trypanosoma brucei and found J in the minichromosomal 177-bp repeats, in the long arrays of 5S RNA gene repeats, and in the spliced-leader RNA gene repeats. No J was found in the rDNA locus or in dispersed repetitive transposon-like elements. Remarkably, the rDNA of T. brucei is not organized in long arrays of tandem repeats, as in many other eukaryotes. T. brucei contains only approximately 15-20 rDNA repeat units that are divided over six to seven chromosomes. Our results show that J is present in many tandemly repeated sequences, either at a telomere or chromosome internal. The presence of J might help to stabilize the long arrays of repeats in the genome.     

Amplification and abnormal chromosomal distribution of ribosomal genes (rDNA) in rat erythroleukemia cells

The ribosomal cistrons (rDNA)/genome ratio was measured in five cell lines derived from three chemically induced erythroblastic leukemias (D-1, D-2, and NE26) in the Long-Evans (LE) rat and compared with values in the normal liver, bone marrow, and fetus. The ratio was 20–42% higher in the leukemias than in normal tissues. The number of autoradiographic silver grains of ¹²⁵I-labeled rRNA hybridized in situ over three nucleolus organizer regions (NORs) of leukemia cells was determined and compared with that of the normal cells. Although the distribution of silver grains of normal cells averaged 44.6%, 25.9%, and 29.5% in NORs of chromosomes #3, #11, and #12, respectively, their distribution was abnormal in two of the leukemias examined; rDNA was amplified in chromosomes #12 of two sublines (K1DA and K1DB) of one leukemis (D-1), and in one chromosome #3 of two sublines (K2D and K3D) of another leukemia (D-2). We consider the possibility that these abnormal patterns of rDNA distribution are related to the increase in rDNA in leukemia cells.     

Classical and Molecular Cytogenetics of the Pufferfish Tetraodon Nigroviridis

Because of its highly compact genome, the pufferfish has become an important animal model in genome research. Although the small chromosome size renders chromosome analysis difficult, we have established both classical and molecular cytogenetics in the freshwater pufferfish Tetraodon nigroviridis (TNI). The karyotype of T. nigroviridis consists of 2n = 42 biarmed chromosomes, in contrast to the known 2n = 44 chromosomes of the Japanese pufferfish Fugu rubripes (FRU). RBA banding can identify homologous chromosomes in both species. TNI 1 corresponds to two smaller FRU chromosomes, explaining the difference in chromosome number. TNI 2 is homologous to FRU 1. Fluorescence in-situ hybridization (FISH) allows one to map single-copy sequences, i.e. the Huntingtin gene, on chromosomes of the species of origin and also on chromosomes of the heterologous pufferfish species. Hybridization of total genomic DNA shows large blocks of (species-specific) repetitive sequences in the pericentromeric region of all TNI and FRU chromosomes. Hybridization with cloned human rDNA and classical silver staining reveal two large and actively transcribed rRNA gene clusters. Similar to the situation in mammals, the highly compact pufferfish genome is endowed with considerable amounts of localized repeat DNAs.     

Lack of WDR36 leads to preimplantation embryonic lethality in mice and delays the formation of small subunit ribosomal RNA in human cells in vitro

Mutations in WD repeat domain 36 gene (WDR36) play a causative role in some forms of primary open-angle glaucoma, a leading cause of blindness worldwide. WDR36 is characterized by the presence of multiple WD40 repeats and shows homology to Utp21, an essential protein component of the yeast small subunit (SSU) processome required for maturation of 18S rRNA. To clarify the functional role of WDR36 in the mammalian organism, we generated and investigated mutant mice with a targeted deletion of Wdr36. In parallel experiments, we used RNA interference to deplete WDR36 mRNA in mouse embryos and cultured human trabecular meshwork (HTM-N) cells. Deletion of Wdr36 in the mouse caused preimplantation embryonic lethality, and essentially similar effects were observed when WDR36 mRNA was depleted in mouse embryos by RNA interference. Depletion of WDR36 mRNA in HTM-N cells caused apoptotic cell death and upregulation of mRNA for BAX, TP53 and CDKN1A. By immunocytochemistry, staining for WDR36 was observed in the nucleolus of cells, which co-localized with that of nucleolar proteins such as nucleophosmin and PWP2. In addition, recombinant and epitope-tagged WDR36 localized to the nucleolus of HTM-N cells. By northern blot analysis, a substantial decrease in 21S rRNA, the precursor of 18S rRNA, was observed following knockdown of WDR36. In addition, metabolic-labeling experiments consistently showed a delay of 18S rRNA maturation in WDR36-depleted cells. Our results provide evidence that WDR36 is an essential protein in mammalian cells which is involved in the nucleolar processing of SSU 18S rRNA.     

DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.