Multiple-Locus Variable-Number Tandem-Repeat Analysis of 201 Mycoplasma pneumoniae Isolates from Beijing,China, from 2008 to 2011

A total of 201 Mycoplasma pneumoniae clinical isolates from Beijing, China, isolated from 2008 to 2011, were clustered into 16 multiple-locus variable-number tandem-repeat analysis (MLVA) types, of which 6 new MLVA types have never been reported previously. Type 1 isolates based on p1 gene genotyping were mainly MLVA types E, J, P, U, and X. There was no correlation between macrolide-resistant Mycoplasma pneumoniae and their MLVA type.     

Multiple-Locus Variable-Number Tandem-Repeat Analysis of Salmonella enterica Serovar Typhi

Multilocus variable-number tandem repeats (VNTRs) are widely used as molecular markers to differentiate isolates of homogenous pathogenic clones. We explored the genomes of Salmonella enterica serovar Typhi strains CT18 and Ty2 for potential VNTRs. Among the 43 potential VNTRs screened, 2 were found to be polymorphic. Together with seven polymorphic VNTRs from previous studies, they were used to type 73 global serovar Typhi isolates. A total of 70 multilocus VNTR analysis (MLVA) profiles were found, distinguishing all except three pairs of isolates into individual profiles. The discriminatory power was 0.999. Phylogenetic analysis showed that the MLVA profiles can be divided into seven clusters. However, except for the closely related isolates, the relationships derived were in conflict with those inferred from single nucleotide polymorphism (SNP) typing using 38 SNPs done previously. We concluded that MLVA can resolve the relationships only among closely related isolates. A combination of SNP typing and MLVA typing offers the best approach for local and global epidemiology and the evolutionary analysis of serovar Typhi. We suggest that seven of the nine most polymorphic VNTRs be used as a standardized typing scheme for epidemiological typing.Typhoid fever remains a devastating disease in developing countries and is prevalent in areas with inadequate sanitation and poor hygiene. It is a serious systemic disease, spread via the fecal-oral route. Annually, there are more than 16 million cases of typhoid fever with 600,000 deaths reported worldwide (www.who.int). The etiological agent of typhoid fever is Salmonella enterica serovar Typhi, which is highly homogenous (13, 33). The genetic homogeneity of serovar Typhi has significantly impeded the development of suitable typing methods to differentiate serovar Typhi isolates for both phylogenetic and epidemiological purposes.Single nucleotide polymorphisms (SNPs) have recently been shown to be useful markers for typing serovar Typhi isolates (23, 29). SNP typing can resolve the relationships among global serovar Typhi isolates and be more discriminating than widely accepted population genetic methods, including multilocus enzyme electrophoresis (28) and multilocus sequence typing (13). However, some haplotypes or SNP profiles contained many isolates which could not be further differentiated (23, 29). In the study of Roumagnac et al. (29), 88 SNPs differentiated 481 global serovar Typhi isolates into 85 haplotypes. The majority of the isolates belonged to H58 (35%), H50 (12%), and H52 (11%). In the study by Octavia and Lan (23), 38 SNPs distinguished 73 global serovar Typhi isolates into 23 SNP profiles, and the majority of these isolates had SNP profile 10 (32%) and SNP profile 2 (16%). Clearly, SNP typing still has limited discriminatory power.Variable-number tandem repeats (VNTRs) have the potential to be more discriminating than SNPs and also to be used to establish the evolutionary relationships of the isolates. VNTRs are short sequence repeats, which are unique DNA elements repeated in tandem. The polymorphisms in VNTRs are believed to be a result of slippage strand misalignment (17). Therefore, isolates may contain different copy numbers for a repeat locus, allowing differentiation between isolates. Multilocus VNTR analysis (MLVA) involves determination of the number of repeats at multiple VNTR loci, and the number of loci required varies depending on the diversity of the organism studied. MLVA has been particularly effective in typing homogenous clones including Yersinia pestis (1, 14, 21, 25), Bacillus anthracis (8, 11, 12, 34), and Mycobacterium tuberculosis (7, 16, 32, 35, 36). In S. enterica, a few serovars, including serovars Enteritidis, Typhimurium, and Typhi have been studied by MLVA (3, 4, 18-20, 27).Two MLVA studies of serovar Typhi showed different levels of variation of VNTR loci analyzed (20, 27). Liu et al. (20) found five potential VNTR loci designated TR1 to TR5, with the first three showing variation among 59 serovar Typhi isolates from several Asian countries studied. Ramisse et al. (27) found five new polymorphic VNTRs (SAL02, SAL06, SAL10, SAL15, and SAL20). Together with two markers from previous serovar Typhi and Typhimurium studies, TR1 (20) and STTR5/Sal16 (18), a total of seven VNTRs distinguished 27 serovar Typhi isolates from France into 25 MLVA profiles (27). In these two studies, VNTR PCR products were resolved on standard agarose gels. However, the resolution of agarose gels is known to be low, which makes it especially difficult to resolve short repeat units, such as SAL10 with a 2-bp repeat unit. In this study we used seven published VNTRs, including SAL02, SAL06, SAL10, SAL16, SAL20, TR1, and TR2, and two new VNTRs uncovered in this study as markers to explore their potential in studying the molecular evolution of global serovar Typhi isolates. Our MLVA assay employed universal M13 tail primer tagged with a different fluorescent dye to resolve the tandem repeats by capillary electrophoresis. We combined the more rapidly evolving VNTR markers with the slower evolving SNPs to achieve an optimal resolution for typing global serovar Typhi isolates.     

Comparison of Multiple-Locus Variable-Number Tandem-Repeat Analysis with Pulsed-Field Gel Electrophoresis Typing of Acinetobacter baumannii in China

A panel of seven variable-number tandem-repeat (VNTR) markers was selected for Acinetobacter baumannii typing analysis (MLVA-7). Compared with pulsed-field gel electrophoresis (PFGE), MLVA-7 provided greater discrimination. We modified the criteria for MLVA complex assignments proposed previously, and a remarkable congruence between MLVA-7- and PFGE-based strain clustering was observed.     

Rapid Variable-Number Tandem-Repeat Genotyping for Mycobacterium leprae Clinical Specimens

Mycobacterium leprae is the noncultivable pathogen of leprosy. Since the genome sequence of an isolate of M. leprae has become available, multiple-locus variable-number tandem-repeat (VNTR) analysis (MLVA) has been explored as a tool for strain typing and identification of chains of transmission of leprosy. In order to discover VNTRs and develop methods transferable to clinical samples, MLVA was applied to a global collection of M. leprae isolates derived from leprosy patients and propagated in armadillo hosts. PCR amplification, agarose gel electrophoresis, and sequencing methods were applied to DNA extracts from these infected armadillo tissues (n = 21). We identified polymorphisms in 15 out of 25 short-tandem-repeat (STR) loci previously selected by in silico analyses of the M. leprae genome. We then developed multiplex PCR for amplification of these 15 loci in four separate PCRs suitable for fluorescent fragment length analysis and demonstrated STR profiles highly concordant with those from the sequencing methods. Subsequently, we extended this method to DNA extracts from human clinical specimens, such as skin biopsy specimens (n = 30). With these techniques, mapping of multiple loci and differentiation of genotypes have been possible using total DNA extracts from limited amounts of clinical samples at a reduced cost and with less time. These practical methods are therefore available and applicable to answer focused epidemiological questions and to allow monitoring of the transmission of M. leprae in different countries where leprosy is endemic.The causative pathogen of leprosy is Mycobacterium leprae. A continued incidence, defying global campaigns to eliminate leprosy even after years of rigorous case finding and the availability of multidrug therapy regimens (28, 29, 30, 31), is attributed to subclinical human and environmental reservoirs of the pathogen (1, 8, 13). In recent years, molecular strain-typing methodologies have complemented conventional infectious disease epidemiology. With the publication in 2001 of the complete genome sequence of an isolate from Tamil Nadu, India, called the TN strain (4), selection of potential polymorphic genomic markers for strain typing was feasible. The first genetic markers that showed polymorphism were short tandem repeats (STRs) in the M. leprae genome. One was a 6-bp intragenic sequence in the rpoT gene, and the second, a trinucleotide (TTC) repeat element upstream of a pseudogene (17, 23). These sequences exhibit variable numbers of tandem repeats (VNTRs) when sequenced in different isolates. Based on these observations, we short-listed 44 loci (including the rpoT and TTC loci) by in silico analyses of the M. leprae genome and accomplished the screening of 11 STR loci, of which 9 were polymorphic when tested in a small panel of four human isolates derived from passage through armadillos (6). Five were minisatellites (6- to 50-bp repeat units), and four were microsatellites (1- to 5-bp repeat units). Since then, others have also shown that VNTR loci exist in M. leprae isolates (25, 33, 34). Three single-nucleotide polymorphisms have also been discovered by comparing sequences of a limited number of strains (20).The goal of our work has been to discover and apply DNA variation among M. leprae isolates to identify sources and chains of transmission of leprosy in regions of endemicity. There are, however, physiological and practical issues relevant to strain typing of M. leprae in the clinical setting, such as the long incubation period and low transmissibility of leprosy and the requirement for clinical specimens such as slit skin smears and skin biopsy specimens from leprosy patients due to the inability of M. leprae to grow in culture. During the course of the last 4 years, field studies in which STR mapping was implemented have been reported. Matsuoka et al. (16) applied the microsatellite locus (TTC)21 to type M. leprae strains obtained from nasal swabs and slit skin smears from patients grouped by village, dwelling, or household in Indonesia, while Young et al. (33) combined (AT)15, (GTA)9, and (TTC)21 VNTR loci for the identification of short- and long-range M. leprae transmission chains in areas within and surrounding the city of Hyderabad, India. Monot et al. mapped five M. leprae STR loci in patients from Mali, Africa (19). The results from those studies demonstrated heterogeneity in prevalent haplotypes, indicating that genotype mapping with a small panel of one to five microsatellite VNTR loci was insufficient to discern strain relatedness. However, within an intrafamilial case, three markers were congruent (33). The authors of those studies concluded that in these areas of endemicity, multiple rather than single dominant isolates are found and that additional genomic markers are necessary for strain typing.For these reasons, assays for the amplification and differentiation of multiple genomic loci are needed. When these requirements have been met, it becomes possible to undertake systematic strain-typing studies that include suitable sampling strategies and conventional epidemiology methods for monitoring transmission and detecting clusters of cases. In light of these laboratory, field, and clinical issues, we further explored multiple-locus VNTR analysis (MLVA) techniques. In this paper, we report the development and testing of multiplex-PCR methods for MLVA for reference armadillo-derived M. leprae isolates and clinical materials and address allelic properties of individual loci and the reproducibility and feasibility of the techniques. In a future paper, we will apply and extend these methods to the data from population-based studies in Cebu, the Philippines (R. M. Sakamuri, M. Kimura, W. Li, K. Madanahally, H.-C. Kim, H. Lee, M. Balagon, R. Gelber, W. C. Black, S.-N. Cho, P. J. Brennan, and V. Vissa, submitted for publication).     

Multiple-Locus Variable-Number Tandem-Repeat Analysis of the Swine Dysentery Pathogen,Brachyspira hyodysenteriae

The spirochete Brachyspira hyodysenteriae is the causative agent of swine dysentery, a severe colonic infection of pigs that has a considerable economic impact in many swine-producing countries. In spite of its importance, knowledge about the global epidemiology and population structure of B. hyodysenteriae is limited. Progress in this area has been hampered by the lack of a low-cost, portable, and discriminatory method for strain typing. The aim of the current study was to develop and test a multiple-locus variable-number tandem-repeat analysis (MLVA) method that could be used in basic veterinary diagnostic microbiology laboratories equipped with PCR technology or in more advanced laboratories with access to capillary electrophoresis. Based on eight loci, and when performed on isolates from different farms in different countries, as well as type and reference strains, the MLVA technique developed was highly discriminatory (Hunter and Gaston discriminatory index, 0.938 [95% confidence interval, 0.9175 to 0.9584]) while retaining a high phylogenetic value. Using the technique, the species was shown to be diverse (44 MLVA types from 172 isolates and strains), although isolates were stable in herds over time. The population structure appeared to be clonal. The finding of B. hyodysenteriae MLVA type 3 in piggeries in three European countries, as well as other, related, strains in different countries, suggests that spreading of the pathogen via carrier pigs is likely. MLVA overcame drawbacks associated with previous typing techniques for B. hyodysenteriae and was a powerful method for epidemiologic and population structure studies on this important pathogenic spirochete.Brachyspira hyodysenteriae is a Gram-negative, oxygen-tolerant, anaerobic spirochete that colonizes the porcine large intestine to cause swine dysentery. This condition is characterized by a severe mucohemorrhagic diarrhea that primarily affects animals during the growing-finishing period and has been reported from all major pig-rearing countries. The enzootic nature of swine dysentery increases the economic impact of the disease, which arises from decreased rates of growth, poor feed conversion, deaths, costs of medication and treatments, preventive measures, and restrictions on movements of stock (16, 17).Carrier pigs play a main role in the epidemiology of swine dysentery and are considered the major source of transmission between herds (16). Moreover, B. hyodysenteriae survives in the environment for long periods, especially in liquid feces contained in pits and lagoons, where it may remain infective for up to 60 days (16). This spirochete also can naturally colonize mice, rheas, chickens, and mallards (9, 30), and together with mechanical vectors or fomites, this increases the ways in which B. hyodysenteriae may be spread within and between herds.Different typing tools have been developed to discriminate between B. hyodysenteriae field isolates and provide a better understanding of the molecular epidemiology of the pathogen. The methods used have included serotyping (3), DNA restriction endonuclease analysis (REA) (6), random amplification of polymorphic DNA (RAPD) (8), restriction fragment length polymorphism of DNA (21), pulsed-field gel electrophoresis (PFGE) (2), multilocus enzyme electrophoresis (MLEE) (25), and multilocus sequence typing (MLST) (24). These techniques provide different levels of discrimination between isolates, and those that are highly discriminating present associated drawbacks such as difficulties in comparing results between laboratories (for example, RAPD and PFGE). On the other hand, MLEE is extremely time-consuming while MLST has high associated costs that are not compatible with routine use in veterinary clinical diagnostic laboratories. Hence, a highly discriminatory method that is time- and cost-effective and yields portable results which allow interlaboratory comparison is still lacking for the typing of B. hyodysenteriae isolates.In the last few years, multiple-locus variable-number tandem-repeat analysis (MLVA) has been developed as an important epidemiologic tool for strain typing of pathogenic microorganism (26). MLVA is based on PCR amplification of multiple loci of minisatellites called variable numbers of tandem repeats (VNTRs). This sort of minisatellite consists of unique direct head-to-tail DNA repeats which can be found in all bacterial genomes and can be used to define specific isolates of bacterial species (35). In addition, VNTRs have been used to infer the bacterial population structure and phylogeny of diverse bacteria species (22, 29, 33). MLVA has the potential to be a highly discriminatory typing technique, being fast, cost-effective, and easy to implement in laboratories with PCR technology. Moreover, multiplexing the PCR in combination with capillary electrophoresis of fluorescently labeled primers may allow a higher sample throughput.In this study, we aimed to develop a simple and reproducible MLVA typing method for use in veterinary clinical microbiology laboratories equipped with either basic PCR technology or more sophisticated capillary electrophoresis equipment. We then applied the method to analyze an international collection of isolates to provide new information about the molecular epidemiology and population structure of this important pathogenic spirochete.     

Multilocus Variable-Number Tandem-Repeat Analysis of Mycoplasma pneumoniae Clinical Isolates from 1962 to the Present: a Retrospective Study

In this study, we evaluated a recently developed multilocus variable-number tandem-repeat (VNTR) analysis (MLVA) method for the molecular typing of Mycoplasma pneumoniae. The method is based on GeneScan analysis of five VNTR loci throughout the genome which define a specific genotype based on the number of tandem repeats within each locus. A retrospective analysis of 154 M. pneumoniae clinical isolates collected over the last 50 years and a limited (n = 4) number of M. pneumoniae-positive primary specimens acquired by the CDC was performed using MLVA. Eighteen distinct VNTR types were identified, including two previously unidentified VNTR types. Isolates from several M. pneumoniae community outbreaks within the United States were also analyzed to examine clonality of a specific MLVA type. Observed in vitro variability of the Mpn1 VNTR locus prompted further analysis, which showed multiple insertions or deletions of tandem repeats within this locus for a number of specimens and isolates. To our knowledge, this is the first report showing variation within the Mpn1 locus, thus affecting precise and reliable classification using the current MLVA typing system. The superior discriminatory capability of MLVA provides a powerful tool for greater resolution of M. pneumoniae strains and could be useful during outbreaks and epidemiological investigations.     

Multiple-Locus Variable-Number Tandem-Repeat Analysis in Genotyping Yersinia enterocolitica Strains from Human and Porcine Origins

Sporadic and epidemiologically linked Yersinia enterocolitica strains (n = 379) isolated from fecal samples from human patients, tonsil or fecal samples from pigs collected at slaughterhouses, and pork samples collected at meat stores were genotyped using multiple-locus variable-number tandem-repeat analysis (MLVA) with six loci, i.e., V2A, V4, V5, V6, V7, and V9. In total, 312 different MLVA types were found. Similar types were detected (i) in fecal samples collected from human patients over 2 to 3 consecutive years, (ii) in samples from humans and pigs, and (iii) in samples from pigs that originated from the same farms. Among porcine strains, we found farm-specific MLVA profiles. Variations in the numbers of tandem repeats from one to four for variable-number tandem-repeat (VNTR) loci V2A, V5, V6, and V7 were observed within a farm. MLVA was applicable for serotypes O:3, O:5,27, and O:9 and appeared to be a highly discriminating tool for distinguishing sporadic and outbreak-related strains. With long-term use, interpretation of the results became more challenging due to variations in more-discriminating loci, as was observed for strains originating from pig farms. Additionally, we encountered unexpectedly short V2A VNTR fragments and sequenced them. According to the sequencing results, updated guidelines for interpreting V2A VNTR results were prepared.     

Improved Identification of Epidemiologically Related Strains of Salmonella enterica by use of a Fusion Algorithm Based on Pulsed-Field Gel Electrophoresis and Multiple-Locus Variable-Number Tandem-Repeat Analysis

Pulsed-field gel electrophoresis (PFGE) and multiple-locus variable-number tandem-repeat analysis (MLVA) are used to assess genetic similarity between bacterial strains. There are cases, however, when neither of these methods quantifies genetic variation at a level of resolution that is well suited for studying the molecular epidemiology of bacterial pathogens. To improve estimates based on these methods, we propose a fusion algorithm that combines the information obtained from both PFGE and MLVA assays to assess epidemiological relationships. This involves generating distance matrices for PFGE data (Dice coefficients) and MLVA data (single-step stepwise-mutation model) and modifying the relative distances using the two different data types. We applied the algorithm to a set of Salmonella enterica serovar Typhimurium isolates collected from a wide range of sampling dates, locations, and host species. All three classification methods (PFGE only, MLVA only, and fusion) produced a similar pattern of clustering relative to groupings of common phage types, with the fusion results being slightly better. We then examined a group of serovar Newport isolates collected over a limited geographic and temporal scale and showed that the fusion of PFGE and MLVA data produced the best discrimination of isolates relative to a collection site (farm). Our analysis shows that the fusion of PFGE and MLVA data provides an improved ability to discriminate epidemiologically related isolates but provides only minor improvement in the discrimination of less related isolates.Salmonellosis is one of the most common food-borne diseases in the United States (5). Consequently, it is important to understand how Salmonella strains disseminate within and between reservoirs and environments. Many molecular typing tools have been used for this purpose (11). Of these methods, pulsed-field gel electrophoresis (PFGE) is considered by many to be the gold standard for strain typing, and variable-number tandem-repeat (VNTR) assays are powerful alternative or complementary typing tools (3, 22). Both methods offer a high degree of genetic resolution for strain typing, depending on several factors.PFGE involves separating chromosomal DNA macro-restriction fragments by size, and strains are discriminated based on the resulting band pattern observed after electrophoresis has been completed. It is one of the most reproducible and highly discriminatory typing techniques and has been widely and successfully used for a variety of Salmonella enterica serovars (12, 15); for many situations, PFGE is capable of discriminating between closely related strains. In addition, the use of the assay to analyze different serovars does not require a great deal of modification, as might be required with procedures that are dependent on PCR. Difficulties arise when strains are very closely related (i.e., poor discrimination [18, 27]) or when bands comigrate in the gel or identically sized bands represent completely different fragments of chromosomal DNA and thereby produce spurious matches (6). These complications are more pronounced when a large number of bands are generated by the restriction digest (4). In addition, while band patterns convey a crude degree of genetic relatedness, a large number of independent restriction digests would be needed to infer an accurate phylogenetic relationship (6).Multiple-locus variable-number tandem-repeat analysis (MLVA) is a PCR-based technique that relies on the amplification of chromosomal or plasmid DNA that encompasses short tandem repeats of a DNA sequence. The tandem repeats are prone to higher-than-background mutation rates due to DNA strand slippage during replication (23), and thus, the amplified fragments will vary in length depending on the number of repeats harbored at a given locus. Different fragment lengths are tallied either as the total length (base pairs) or the estimated number of repeat units, and each discretely sized fragment is considered a unique “allele” for the locus under investigation. Because of the relatively high mutation rate, strains can accumulate distinctive allele patterns within a relatively short period of time (5). Furthermore, the technique can be multiplexed and automated and is conducive to rapid and relatively high-throughput strain typing. MLVA assays are relatively robust (5, 15-17) and, while not perfect, they can provide phylogenetic information even with a limited number of loci (13, 18). While access to a sequenced genome dramatically speeds the ability to establish new assays (3), it is not a requisite to assay development. The primary limitations of the technique include the potential need for a new set of loci for every species or serovar under investigation and the fact that some loci are very “unstable” and can “disappear” from some strains or lineages; this produces the equivalent of an uninformative “null” allele. Mutation rates can also vary between loci (5, 24, 25); if ignored, this factor can introduce bias into comparative analyses.Clearly, PFGE and MLVA offer different technical and interpretive advantages and disadvantages, but it is important to emphasize that the nature of the methodological and interpretive errors is independent between the techniques. For example, errors due to comigration of bands for PFGE are independent of band size estimation errors for MLVA because differences in MLVA band size are not detectable using PFGE and macro-restriction fragments are generally independent of tandem-repeat sequences. Provided that most of the experimental variation from these two methods is uncorrelated (i.e., independent), it is possible to combine results from the two methods to produce improved estimates (8), and this premise underlies the current study.Our objective was to determine whether combining the information obtained from both PFGE and MLVA assays produces more rigorous and discriminatory analyses of bacterial pathogens, such as Salmonella. Two sets of Salmonella enterica isolates were used in this study; one set included serovar Typhimurium isolates from a wide range of sampling dates, locations, and host species while the other set included a group of serovar Newport isolates collected over a limited geographic and temporal scale for a single host species. The results of the different typing methods were assessed by comparison with those of phage-typing assays (serovar Typhimurium) and with known epidemiological relationships (serovar Newport). To interpret the MLVA data, we employed a metric that incorporates a stepwise-mutation model, and to interpret the PFGE data, we employed Dice coefficients to construct distance matrices. Our analysis shows that the fusion of the two typing methods provides an improved ability to discriminate between isolates when PFGE and MLVA separately provide partial but incomplete discrimination between strains with a high degree of probable genetic similarity.     

Utilizing Rapid Multiple-Locus Variable-Number Tandem-Repeat Analysis Typing To Aid Control of Hospital-Acquired Clostridium difficile Infection: a Multicenter Study

The early identification of outbreaks is crucial for the control of Clostridium difficile infection. This study aimed to determine if the number of hospital-acquired C. difficile infections could be reduced by rapidly typing C. difficile strains using multiple-locus variable-number tandem-repeat analysis (MLVA) compared to typing using PCR ribotyping. A total of 16 hospitals were recruited to the study, and all periods of increased incidence (PIIs) of C. difficile infection were identified. The hospitals were randomized into two study arms, the test and the control, with all isolates typed in the test using MLVA and in the control using PCR ribotyping. Following a PII, each hospital received a structured questionnaire regarding control measures implemented or stopped prior to or following the typing results. During the study period, there were a total of 1,682 hospital-apportioned C. difficile toxin-positive cases, with 868 in the control and 814 in the test, with modeling demonstrating no differences between the two arms. A total of 245 PIIs occurred, involving 785 patients. There was a significant difference in the mean turnaround time between the ribotyping and MLVA typing (13.6 and 5.3 days, respectively [P < 0.001]). The discriminatory ability of MLVA was greater than ribotyping, with 85 outbreaks being confirmed by ribotyping and 62 by MLVA. In the test arm, 40.6% of respondents strongly agreed that the typing result had aided their management of clusters, as opposed to 9.9% in the control. The study demonstrated the utility of rapidly typing C. difficile strains, demonstrating that it aided the management of clusters, enabling effective targeting of infection control resources.     

Development of a Multiple-Locus Variable-Number Tandem-Repeat Typing Scheme for Genetic Fingerprinting of Burkholderia cenocepacia and Application to Nationwide Epidemiological Analysis

Organisms of the Burkholderia cepacia complex are especially important pathogens in cystic fibrosis (CF), with a propensity for patient-to-patient spread and long-term respiratory colonization. B. cenocepacia and Burkholderia multivorans account for the majority of infections in CF, and major epidemic clones have been recognized throughout the world. The aim of the present study was to develop and evaluate a multilocus variable-number tandem-repeat (VNTR) analysis (MLVA) scheme for B. cenocepacia. Potential VNTR loci were identified upon analysis of the annotated genome sequences of B. cenocepacia strains AU1054, J2315, and MCO-3, and 10 of them were selected on the basis of polymorphisms and size. A collection of 100 B. cenocepacia strains, including epidemiologically related and unrelated strains, as well as representatives of the major epidemic lineages, was used to evaluate typeability, epidemiological concordance, and the discriminatory power of MLVA-10 compared with those of pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Longitudinal stability was assessed by testing 39 successive isolates from 14 patients. Typeability ranged from 0.91 to 1, except for that of one marker, which was not amplified in 53% of the B. cenocepacia IIIA strains. The MLVA types were shown to be stable in chronically colonized patients and within outbreak-related strains, with excellent epidemiological concordance. Epidemic and/or globally distributed lineages (epidemic Edinburgh-Toronto electrophoretic type 12 [ET-12], sequence type 32 [ST-32], ST-122, ST-234, and ST-241) were successfully identified. Conversely, the discriminatory power of MLVA was lower than that of PFGE or MLST, although PFGE variations within the epidemic lineages sometimes masked their genetic relatedness. In conclusion, MLVA represents a promising cost-effective first-line tool in B. cenocepacia surveillance.     

Comparison of Two Multiple-Locus Variable-Number Tandem-Repeat Analysis Methods for Molecular Strain Typing of Human Brucella melitensis Isolates from the Middle East

Brucella species are highly monomorphic, with minimal genetic variation among species, hindering the development of reliable subtyping tools for epidemiologic and phylogenetic analyses. Our objective was to compare two distinct multiple-locus variable-number tandem-repeat analysis (MLVA) subtyping methods on a collection of 101 Brucella melitensis isolates from sporadic human cases of brucellosis in Egypt (n = 83), Qatar (n = 17), and Libya (n = 1). A gel-based MLVA technique, MLVA-15_IGM, was compared to an automated capillary electrophoresis-based method, MLVA-15_NAU, with each MLVA scheme examining a unique set of variable-number tandem repeats. Both the MLVA_IGM and MLVA_NAU methods were highly discriminatory, resolving 99 and 101 distinct genotypes, respectively, and were able to largely separate genotypes from Egypt and Qatar. The MLVA-15_NAU scheme presented higher strain-to-strain diversity in our test population than that observed with the MLVA-15_IGM assay. Both schemes were able to genetically correlate some strains originating from the same hospital or region within a country. In addition to comparing the genotyping abilities of these two schemes, we also compared the usability, limitations, and advantages of the two MLVA systems and their applications in the epidemiological genotyping of human B. melitensis strains.Brucellosis is a common zoonotic disease causing infections in economically important livestock, such as cattle, goats, sheep, and pigs (22). In humans, this highly diverse illness, also known as Malta or undulant fever, initially presents as a fever, malaise, and myalgia and may later develop into a chronic illness affecting various organs and tissues (21, 25). Brucellosis is usually transmitted to humans through consumption of contaminated and untreated milk products or by direct contact with infected animals. There are nine phenotypically recognized species in the Brucella genus: Brucella melitensis, B. abortus, B. suis, B. ovis, B. canis, and B. neotomae; two new marine species, B. ceti and B. pinnipedialis (11); and B. microti (27), isolated from the common vole. Each species has distinctive host preferences, pathogenicity, and epidemiology.Although some developed countries have eradicated B. abortus from cattle through vaccination campaigns, B. melitensis, B. abortus, and B. suis remain the principal causes of human brucellosis worldwide and are major public health problems, primarily in developing countries (7). Brucellosis is prevalent in the Mediterranean basin, the Middle East, Africa, Asia, and areas of Latin America where people are economically dependent on ruminant livestock (23, 28). Over the past decade, the global epidemiology of human brucellosis has changed, due in part to the implementation of national and international surveillance programs, animal vaccination campaigns, and socioeconomic changes (22).Current microbiological (4) and low-resolution molecular typing methods are useful for identifying Brucella isolates and determining species and biovar designations; however, they have limited value for epidemiological trace-back investigations (6, 15). High-resolution genetic subtyping tools that could provide important information about disease transmission patterns and the molecular epidemiology of Brucella have been difficult to develop and implement due to the genetically monomorphic nature of Brucella species (12). Since the genome sequencing of four Brucella strains, B. abortus 2308 (26), B. abortus 9-941 (14), B. suis 1330 (24), and B. melitensis 16M (9), multilocus sequence typing (30) and multiple-locus variable-number tandem-repeat analysis (MLVA) have been developed (16, 18, 29). Recent studies have shown that MLVA, targeting multiple repeat regions with higher mutation rates than other genomic markers, demonstrates higher genetic resolution when applied to Brucella species than assays targeting other, more monomorphic molecular markers, such as the outer membrane proteins (8, 10), the rpoB gene (19), and insertion sequence regions (6).In efforts to improve epidemiological surveillance and better evaluate the utility of MLVA as a genotyping tool for Brucella strains, the present study compared the discriminatory power of two distinct MLVA methods (16, 18) in their ability to distinguish geographic origin and resolve relationships within a group of 101 human B. melitensis isolates from Egypt, Qatar, and Libya. Each MLVA typing technique examined polymorphisms at 15 different tandem repeat loci and employed two different separation techniques. This study also compares the usability of the two MLVA systems with regard to resources, technological needs, scientific expertise, and time consumption.     

Coexistence of Multiple Multilocus Variable-Number Tandem-Repeat Analysis Subtypes of Clostridium difficile PCR Ribotype 027 Strains within Fecal Specimens

We investigated whether multilocus variable-number tandem-repeat analysis (MLVA) typing could identify different subtypes of Clostridium difficile ribotype 027 within the same feces specimen. Five of 39 specimens yielded at least one isolate with an MLVA profile different (more than five summed tandem repeat differences) from that of other isolates in the same specimen, thereby potentially obscuring epidemiological links between C. difficile infection cases.The incidence and severity of Clostridium difficile infection (CDI) have increased in recent years, possibly due to the emergence and spread of epidemic strain PCR ribotype 027 (also known as pulsed-field electrophoresis type NAP1) (9, 10, 12). Ribotype 027 is highly prevalent in the United Kingdom (2), making PCR ribotyping alone insufficient for investigating potential cases of cross infection or differentiating between epidemic outbreaks. Multilocus variable-number tandem-repeat analysis (MLVA) is a more discriminatory typing technique for C. difficile (11, 14) and has been used for several studies (1, 4-7), but as yet, no data on the subtyping of multiple isolates from the same specimen have been published.We investigated whether MLVA typing could identify different subtypes of ribotype 027 within the same specimen and considered the impact this may have on the utility of MLVA as a typing method for outbreak situations.(This work was presented in part as poster 525 at the European Congress of Clinical Microbiology and Infectious Diseases, 16 May 2009.)Thirty-nine feces samples (preselected by infection control teams on the basis of severity, clusters, or high CDI rates) submitted for PCR ribotyping and yielding a type 027 C. difficile isolate were arbitrarily selected. C. difficile was cultured from specimens using alcohol shock and inoculation onto cycloserine-cefoxitin-fructose agar. Five isolated colonies of C. difficile were picked from each culture and were all confirmed as C. difficile type 027 by PCR ribotyping (13), giving 195 study isolates.Six variable-number tandem-repeat (VNTR) loci (A6Cd, B7Cd, C6Cd, E7Cd, G8Cd, and CDR60) from published MLVA schemes (11, 14) were amplified by PCR from all isolates. Loci F3Cd and H9Cd (14) were not used, as they are invariant within PCR ribotype 027 isolates (6, 8, 14). Loci CDR5 and CD59 (11) were not used, as they were found to be variant by only one tandem repeat or invariant in diverse 027 isolates (data not shown). Primers were used as previously described (14), except for the G8Cd reverse primer (5′ AATCTAATAATCCAGTAATTTAAATT 3′), which was redesigned to improve the yield of G8Cd, and CDR60 primers (CDR60-Forward, 5′-AGTTTGTAGGGAAGTGTGTAAATAGAT-3′; CDR60-Reverse, 5′-CGCATTAAATTTCACTCCTCAT-3′), which were redesigned to minimize the PCR product size. Five-microliter volumes of DNA extracts were added to 20 μl of PCR mixture, giving (final concentrations) 0.2 μM each primer, 2.5 mM MgCl₂, 0.2 mM each deoxynucleoside triphosphate, 1× GeneAmp PCR Gold buffer, and 0.5 U of AmpliTaq Gold DNA polymerase (Applied Biosystems). Reaction mixtures underwent activation at 95°C for 5 min, followed by 35 cycles of 95°C for 1 min, 56°C for 1 min, and 72°C for 1 min with a final elongation at 72°C for 5 min. PCR products were electrophoresed on 3% MetaPhor agarose (Lonza) gels in 0.5× Tris-borate-EDTA buffer at 150 V for 5 h against a 20-bp molecular size standard (Sigma-Aldrich Company Ltd.). Gels were stained with ethidium bromide and photographed under UV light. PCR product sizes were determined using BioNumerics software (Applied Maths) by comparison with a standard curve generated from the 20-bp ladder. VNTR numbers were calculated from PCR product sizes. Tandem-repeat numbers from each VNTR locus were concatenated for each isolate to form MLVA profiles, which were compared using BioNumerics software (Applied Maths).The accuracy of determining VNTR numbers using the agarose gel method described was validated by sequencing 35 different VNTR PCR products using an ABI 3700 capillary sequencer to determine exact repeat numbers and then comparing them with numbers determined by the agarose gel method. A range of PCR product sizes from each locus including PCR products differing in size by one 6-bp repeat were included. The agarose gel method was accurate for 28 of 35 sequenced products with an error of plus or minus one repeat in the remaining seven. The impact of any such error was minimized by ensuring that PCR products from the same locus for isolates from the same specimen were electrophoresed in adjacent lanes of the gel, making the smallest 6-bp differences clearly visible. Thus, any error was unlikely to affect the calculated differences between isolates. Accurate size determination methods such as sequencing would be required for larger-scale comparisons.Studies using C. difficile MLVA (1, 4, 5, 7) have utilized the Manhattan coefficient to calculate a summed tandem-repeat difference (STRD) from all loci and associate MLVA types with the smallest STRDs. It has been suggested that C. difficile isolates with an STRD of two or fewer should be considered “clonal” (1, 4, 7, 14). We applied this method to compare MLVA profiles within each study specimen. Thirty-four specimens (87%) were found to contain isolates which were indistinguishable or had an STRD of no more than two from another isolate from the same specimen. Five specimens (13%) contained at least one isolate which had an STRD of five or more from the next most closely related isolate (Fig. ​(Fig.11).Open in a separate windowFIG. 1.MLVA profiles and minimum spanning trees for specimens yielding C. difficile PCR ribotype 027 isolates at least one of which had an STRD of five or more from the next most closely related isolate. For minimum spanning trees, circles represent unique MLVA profiles in the tree and are scaled by member count. Thick solid lines represent an STRD of one, thin solid lines represent an STRD of two, thick dashed lines represent an STRD of three, and thinner dashed lines represent an STRD of four or more. STRDs of more than four are indicated by numerals between the circles. Gray shading indicates complexes with a maximum neighbor distance of two tandem repeats and a minimum of two MLVA types.It is a disadvantage of the Manhattan coefficient that if several repeats at a locus are deleted or duplicated simultaneously, the resulting STRD is large and similarities are obscured.For this reason, we made alternative comparisons of isolate MLVA profiles within each specimen using the categorical coefficient which associates MLVA types with the smallest number of VNTR locus variants. This revealed that 5 (13%) out of 39 specimens contained isolates differing from each other at three out of six loci (Table ​(Table1).1). Two specimens (1 and 3) contain isolates that differ by both analyses.

TABLE 1.

MLVA profiles of specimens containing C. difficile PCR ribotype 027 isolates differing from each other at three out of six VNTR loci

Epidemiological and Phylogenetic Analysis of Spanish Human Brucella melitensis Strains by Multiple-Locus Variable-Number Tandem-Repeat Typing,Hypervariable Octameric Oligonucleotide Fingerprinting,and rpoB Typing

The severe morbidity of human brucellosis is one of the main reasons for using molecular typing in the epidemiological surveillance of this worldwide zoonosis. Multiple-locus variable-number repeat analysis (MLVA-16), hypervariable octameric oligonucleotide fingerprinting (HOOF-print), and the differences in the single nucleotide polymorphisms (SNPs) (codons 1249 and 1309) of the DNA-dependent RNA polymerase β subunit (rpoB) were used to type a human Brucella melitensis population (108 strains) collected from throughout Spain over 13 years. Eighty-six MLVA types (discriminatory index, 0.99) were detected, with a wide-ranging genetic similarity coefficient (37.2 to 93.7%). The population clustered into the following groups: American, with genotypes 47 (1 strain), 48 (13 strains), 53 (12 strains), 55 (2 strains), 80 (1 strain), and a new genotype (2 strains), Western Mediterranean, with genotype 51 (9 strains), and Eastern Mediterranean, with genotypes 42 (60 strains), 43 (4 strains), and 63 (4 strains). Two profession-related and two foodborne acquisitions were confirmed. Distributed throughout Spain, Eastern Mediterranean genotype 42 was the most common (55%). The low MLVA-16 allelic polymorphism (genetic similarity range, 75 to 94%) of the genotype 42 strains suggests that they recently evolved from a common ancestor. rpoB typing grouped the strains as rpoB type 1 (1249-ATG/1309-CTG; 28.7%), rpoB type 2 (1249-ATG/1309-CTA; 62.9%), and rpoB type 3 (1249-ATA/1309-CTG; 8.3%). According to the MLVA-16 results, the population clustered by rpoB type. Given the correlation between B. melitensis MLVA groups and rpoB types (American and rpoB type 1, Eastern Mediterranean and rpoB type 2, and Western Mediterranean and rpoB type 3), the rpoB type could be used as an initial marker for the epidemiological surveillance of brucellosis.Brucellosis is an anthropozoonosis with a worldwide distribution. Brucella spp. are responsible for considerable economic losses through their infection of livestock and cause severe morbidity in humans, involving multiple organs (7, 23, 24, 31). However, given the absence of specific signs and symptoms, the disease is commonly underdiagnosed (24, 31).Current global trends of brucellosis incidence show there to be nearly half a million new cases annually (31). Large differences are seen, however, between Spain and other European countries, with 3.17 cases/100,000 population in Greece and just 0.034/100,000 in France (http://www.oie.int/wahis/public.php) (33). Since 2005, the annual incidence of human brucellosis in Spain has decreased sharply (15, 16, 25), to 0.33/100,000 (151 estimated cases) in 2009 (Spanish Surveillance Net, Epidemiology National Centre).The reduction in human brucellosis in Europe has been attributed to effective preventive measures followed in livestock practices and veterinary medicine but also in food processing and public health monitoring (8). Certainly, typing techniques have been of great use in the epidemiological surveillance of human and animal disease. Based on tandem repeats, both hypervariable octameric oligonucleotide fingerprinting (HOOF-prints) (5) and multilocus variable-number tandem-repeat analysis (MLVA-16) (1, 18) have proven their discriminatory power in the study of Brucella species collected on a global scale (18, 19, 32). Recent studies have shown the latter technique to be useful in studies of different geographic and time sampling characteristics involving B. abortus (13) and B. melitensis (17, 21, 22, 28, 29).Spain is located in the Mediterranean basin, an acknowledged region of endemicity for brucellosis (24), where B. melitensis constitutes the major species responsible for human disease (30). This study examined a population of human B. melitensis strains from different areas of Spain collected over a period of 13 years (from 1997 to 2009). The aims of this work were the following: (i) to assess the usefulness of MLVA-16 in B. melitensis typing, (ii) to analyze the genotypes circulating in our country, (iii) to establish, via MLVA-16 and HOOF-print analysis, the occupational, laboratory, travel, and food origins of the disease in the patients, and (iv) to examine the potential of the DNA-dependent RNA polymerase β subunit (rpoB) for the identification and typing (21, 26) of Spanish B. melitensis strains.     

Isothermal Detection of Mycoplasma pneumoniae Directly from Respiratory Clinical Specimens

Mycoplasma pneumoniae is a leading cause of community-acquired pneumonia (CAP) across patient populations of all ages. We have developed a loop-mediated isothermal amplification (LAMP) assay that enables rapid, low-cost detection of M. pneumoniae from nucleic acid extracts and directly from various respiratory specimen types. The assay implements calcein to facilitate simple visual readout of positive results in approximately 1 h, making it ideal for use in primary care facilities and resource-poor settings. The analytical sensitivity of the assay was determined to be 100 fg by testing serial dilutions of target DNA ranging from 1 ng to 1 fg per reaction, and no cross-reactivity was observed against 17 other Mycoplasma species, 27 common respiratory agents, or human DNA. We demonstrated the utility of this assay by testing nucleic acid extracts (n = 252) and unextracted respiratory specimens (n = 72) collected during M. pneumoniae outbreaks and sporadic cases occurring in the United States from February 2010 to January 2014. The sensitivity of the LAMP assay was 88.5% tested on extracted nucleic acid and 82.1% evaluated on unextracted clinical specimens compared to a validated real-time PCR test. Further optimization and improvements to this method may lead to the availability of a rapid, cost-efficient laboratory test for M. pneumoniae detection that is more widely available to primary care facilities, ultimately facilitating prompt detection and appropriate responses to potential M. pneumoniae outbreaks and clusters within the community.     

Evaluation of Multiple-Locus Variable-Number Tandem-Repeat Analysis for Typing a Polyclonal Hospital-Acquired Methicillin-Resistant Staphylococcus aureus Population in an Area Where Such Infections Are Endemic

Multiple-locus variable-number tandem-repeat analysis (MLVA) was performed with 292 methicillin-resistant Staphylococcus aureus (MRSA) isolates previously characterized by pulsed-field gel electrophoresis, multilocus sequence typing, and staphylococcal cassette chromosome mec typing. Quantitative correspondence analyses showed the best correlation between data when an ≥80% cutoff was applied to MLVA. We confirmed the validity of MLVA for identification of related strains in a polyclonal MRSA population.The first methicillin-resistant Staphylococcus aureus (MRSA) isolate was detected in 1961 (8). Since then, MRSA has become one of the most worrisome pathogens worldwide. Many efforts to design an ideal method to type these bacteria and to control their dissemination have been employed (4). Up to now, the gold standard for short-term epidemiological surveillance of S. aureus has been pulsed-field gel electrophoresis (PFGE) (5, 6, 7). However, this method is demanding and time-consuming and needs expensive reagents. Multilocus sequence typing (MLST) is the ideal method for long-term epidemiological studies, but its routine application is very unfeasible in clinical laboratories. In 2003, a new method for typing S. aureus strains, multiple-locus variable-number tandem-repeat analysis (MLVA), was applied (18). This technique consists of simultaneous amplification of variable-number tandem repeats of different genes. Several works have tried to determine if MLVA provides enough information to be performed routinely instead of PFGE or MLST in clinical microbiology laboratories (20).Our aim was to determine if MLVA could predict MRSA clones present in the Hospital Universitario Nuestra Señora de Candelaria (HUNSC) that were previously characterized by PFGE, MLST, and staphylococcal cassette chromosome mec (SCCmec) typing (reported here as PFGE/MLST-SCCmec type) (16) and to establish possible criteria of clustering MLVA patterns, looking for high concordance levels. This study expects to validate MLVA to introduce it as a routine typing method in the HUNSC.The 292 MRSA isolates included in this study belonged to the clones included in Table ​Table2.2. MLVA was performed as previously described (18) but slightly modified to obtain optimal results and to accelerate the process. The PCR mixture was prepared with 1× reaction buffer, 1.5 mM MgCl₂, 0.2 mM deoxynucleoside triphosphates (dNTPs), 1.2 μM each of ClfA-F, ClfA-R, ClfB-F, ClfB-R, SdrCDE-F, and SdrCDE-R primers, 0.5 μM each of Spa-F and Spa-R primers, 1 μM each of Sspa-F and Sspa-R primers, and 0.05 U of Taq DNA polymerase (Bioline). Cycling conditions (MyCycler; Bio-Rad) were 94°C for 5 min, 20 cycles of 94°C for 30 s, 58.2°C for 45 s, and 72°C for 1.5 min, and finally 72°C for 5 min. To assess reproducibility, 10 randomly chosen isolates of different MLVA types were used for three independent MLVA experiments. The dendrogram obtained by Dice''s coefficient with a 1% tolerance value was analyzed using three different cutoffs. Simpson''s index of diversity, D (19), was employed to measure the discriminatory powers of MLVA and PFGE/MLST-SCCmec typing (9, 12), and concordance levels between these methods were quantified using two coefficients, adjusted Rand (AR) (11) and Wallace (W) (17, 22), as Carriço et al. suggested (2).

TABLE 2.

Classifications of different MRSA clones obtained by application of 80% and 70% cutoff criteria, indicating the MLVA types and subtypes

Multilocus Variable-Number Tandem-Repeat Analysis-Confirmed Emergence of a Macrolide Resistance-Associated Mutation in Mycoplasma pneumoniae during Macrolide Therapy for Interstitial Pneumonia in an Immunocompromised Child

A child with Job's syndrome was treated for pneumonia due to Mycoplasma pneumoniae. A mixed population of wild-type bacteria and an A2059G mutant was detected during josamycin treatment failure. The same multilocus variable-number tandem-repeat analysis (MLVA) type (MLVA type I) was isolated before and after treatment failure. The child recovered after ciprofloxacin treatment.     

Detection and Confirmation of Mycoplasma pneumoniae in Urogenital Specimens by PCR

Following the isolation of Mycoplasma pneumoniae from urogenital specimens (M. Goulet, R. Dular, J. G. Tully, G. Billows, and S. Kasatiya, J. Clin. Microbiol. 33:2823–2825, 1995), a study was undertaken to confirm the observations by PCR. Specific primers directed to the P1 adhesin gene of M. pneumoniae were used. A total of 300 genital specimens were tested for M. pneumoniae and Mycoplasma genitalium by culture and PCR. Of these, 15 were positive by culture and 17 were positive by PCR for M. pneumoniae. No M. genitalium was detected in any of the specimens by either method. The present study demonstrates that PCR is sensitive and rapid compared to cumbersome culture methods and can be used to detect M. pneumoniae in urogenital specimens in a routine diagnostic laboratory.