Polarity of heteroduplex formation promoted by Escherichia coli recA protein.

When recA protein pairs circular single strands with linear duplex DNA, the circular strand displaces its homolog from only one end of the duplex molecule and rapidly creates heteroduplex joints that are thousands of base pairs long [DasGupta, C., Shibata, T., Cunningham, R. P. & Radding, C. M. (1980) Cell 22, 437-446]. To examine this apparently polar reaction, we prepared chimeric duplex fragments of DNA that had M13 nucleotide sequences at one end and G4 sequences at the other. Circular single strands homologous to M13 DNA paired with a chimeric fragment when M13 sequences were located at the 3' end of the complementary strand but did not pair when the M13 sequences were located at the 5' end. Likewise circular single-stranded G4 DNA paired with chimeric fragments only when G4 sequences were located at the 3' end of the complementary strand. To confirm these observations, we prepared fd DNA labeled only at the 5' or 3' end of the plus strand, and we examined the susceptibility of these labeled ends to digestion by exonucleases when joint molecules were formed. Eighty percent of the 5' label in joint molecules became sensitive to exonuclease VII. Displacement of that 5' end by recA protein was concerted because it did not occur in the absence of single-stranded DNA or in the presence of heterologous single strands. By contrast, only a small fraction of the 3' label became sensitive to exonuclease VII or exonuclease I. These observations show that recA protein forms heteroduplex joints in a concerted and polarized way.     

Multiple initiation sites of DNA replication flanking the origin region of lambda dv genome.

Early replicative intermediates of lambda dv plasmid were prepared by an in vitro replication system in the presence of 2',3'-dideoxycytidine 5'-triphosphate, an inhibitor of DNA chain elongation. Short-chain DNAs produced from regions near the replication origin were purified from the intermediates. A fraction of the DNAs was covalently linked to primer RNA. The transition sites from primer RNA to DNA synthesis were mapped along the nucleotide sequence of the genome, by eliminating the RNA by alkaline hydrolysis and labeling the freshly exposed 5' ends of DNA with 32P. The transition sites were found to be located on both sides of the ori region, which includes four 19-base-pair repeats where one of the lambda specific initiator proteins, O, binds. No transition arose within the ori region. The transition sites are multiple on both sides of the ori region and are clustered in one of the two strands in such a way that DNA syntheses from the two sides converge. The frequency of the "leftward" DNA synthesis is several times higher than that of "rightward" synthesis, reflecting the asymmetric bidirectional replication of lambda dv DNA.     

RNA-Linked Short DNA Fragments During Polyoma Replication

During in vitro incubation, nuclei from polyoma-infected cells elongate the daughter strands of the replicative intermediate of polyoma DNA. This process is now shown to involve the transient formation of short fragments (4-5 S), a process that is stimulated by the addition of ribonucleoside triphosphates. The presence of stretches of RNA at the 5'-end of short DNA chains was determined from Cs(2)SO(4) equilibrium centrifugation and from the finding that isotope from alpha-(32)P-labeled deoxynucleoside triphosphates was recovered in 2'(3')-ribonucleotides after alkaline hydrolysis. Transfer occurred preferentially with [alpha-(32)P]dCTP as substrate. Starvation for deoxynucleotides by in vivo treatment with hydroxyurea resulted in the accumulation of short fragments that are deficient in RNA. Our results suggest that a late step during the discontinuous synthesis of polyoma DNA is selectively inhibited when deoxynucleotides are in short supply.     

RNA-Linked DNA Fragments In Vitro

RNA-linked DNA fragments are intermediates in DNA replication in Escherichia coli cells made permeable to nucleoside triphosphates by treatment with toluene. Covalent linkage of a short RNA stretch to the 5' end of the DNA is proved by transfer of (32)P from [alpha-(32)P]dNTP to ribonucleotides upon digestion with alkali or pancreatic RNase, and by a small decrease in the molecular size upon alkaline hydrolysis. The (32)P transfer experiments reveal a unique structure...p(rPy)p(rA)p(rU or rC)p(dC)p... at the RNA-DNA junction.     

MECHANISM OF DNA CHAIN GROWTH, IV. DIRECTION OF SYNTHESIS OF T4 SHORT DNA CHAINS AS REVEALED BY EXONUCLEOLYTIC DEGRADATION

T4 nascent short chains labeled at their growing ends with H(3)-thymidine and uniformly with C(14)-thymidine were prepared, separated into complementary strands, and degraded by E. coli exonuclease I in the 3' to 5' direction or by B. subtilis nuclease in the 5' to 3' direction. The kinetics of release of H(3) and C(14) labels by both enzymes was consistent with the conclusion that the H(3) label is at the 3' end of the nascent short chains of both strands and that the short chains are products of discontinuous synthesis in the 5' to 3' direction along the two template strands.     

Initiator tRNAs have a unique anticodon loop conformation.

Transfer RNA (tRNA) molecules have been labeled with 32P at the 5' end and subjected to S1 nuclease digestion. The products were analyzed by high-resolution gel electrophoresis. Three initiator tRNAs and six chain-elongating tRNAs were examined. S1 nuclease cleaved Escherichia coli tRNAfMet, yeast tRNAfMet, and mammalian tRNAfMet at the same two positions in the anticodon loop. In contrast, S1 nuclease cleaved the anticodon loop of E. coli tRNAmMet, yeast tRNAmMet, yeast tRNAPhe, Schizosaccharomyces pombe tRNAPhe, E. coli tRNA2Glu, and E. coli tRNATrp (su+) at four positions generally, except where a modified nucleotide in the wobble position inhibited the enzyme. The marked contrast between these cleavage patterns suggests a different conformation for the anticodon loops of these two classes of tRNA molecules. It is suggested that the specialized conformation in the anticodon loop of initiator tRNAs may be due to a special sequence of GC base pairs in the adjoining anticodon stem.     

The major 5' end of HIV type 1 RNA corresponds to G456

In the course of studies on HIV-1 RNA structure, we determined that the main 5' end of viral RNA from virions and virus producer cells corresponds to G456 in the proviral DNA sequence, one or two nucleotides down-stream from the reported ends that correspond to G454 and G455. We mapped 5' ends using the highly accurate RNA ligase-mediated rapid amplification of cDNA ends (RLM-RACE) method. The reactivity of the 5' ends indicates that they are mainly capped, although the presence of some uncapped (5'-triphosphorylated) RNA cannot formally be excluded. When we used a 5' mapping method susceptible to incorporating a cytosine at the 3' end of cDNA first strands, at a position templated by the 7-methylguanosine cap, 50% of clones derived from virion RNA had incorporated the additional cytosine. Reassignment of the 5' end has consequences for the design of short RNAs used to study HIV-1 RNA structural dynamics.     

Histones H3 and H4 interact with the ends of nucleosome DNA.

Isolated HeLa cell nucleosomes (core particles) were labeled at the 5'-termini of their DNA with 32P using [gamma-32P]ATP and polynucleotide kne by sequential methylation, depurination, Schiff base formation, and reduction with sodium borhydride. After digestion of the noncrosslinked DNA by DNase I and venom phosphodiesterase, histones were separated by gel electrophoresis and those crosslinked to the 5'-termini were identified by 32P-autoradiography. Histones H3 and H4 occur with equeal frequency as the nearest protein neighbors to the end of the DNA in nucleosomes. Histone arrangements within the core particle compatible with these results are discussed.     

Nucleotide sequence homology at the 3'' termini of RNA from vesicular stomatitis virus and its defective interfering particles.

Vesicular stomatitis virus (VSV) and defective interfering (DI) particle RNAs were labeled at their 3' ends by using RNA ligase and cytidine 3',5'-bis[32P]phosphate. The RNAs were subjected to partial digestion with alkali and analyzed by oligonucleotide fingerprinting in two dimensions. VSV and DI particle RNAs have complete sequence homology for the first eight bases from the 3' end. The following four positions contain three mismatched nucleotides in which guanosine residues in one strand are replaced by uridine residues in the other. There is again complete homology for the next five bases (positions 13-17). The locations of purine residues within the sequence were confirmed by partial digestion with RNase T1 and RNase U2 and separation by size on 20% acrylamide gels. The latter method also indicated that sequences of VSV and DI particle RNAs diverge beyond the 18th nucleotide from the 3' termini.     

DNA Nucleotide Sequence Restricted by the RI Endonuclease

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage lambda has been determined. The 5'-terminal nucleotide labeled with (32)P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in lambda DNA was deduced from these data and from the 3'-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5'-phosphoryls and short cohesive termini of four nucleotides, (p)A(p)A(p)T(p)T. The most striking feature of the sequence is its symmetry.     

Compact oligomers and nucleosome phasing.

Micrococcal nuclease (EC 3.1.4.7) digestion of histone H1- and H5-depleted chicken erythrocyte chromatin yields, in addition to 140-base-pair (bp) core particles, a series of nucleosome oligomers containing about 260 bp (compact dimer), 380 bp (compact trimer), etc. of DNA. These are postulated to represent members of a class of oligomers in which the DNA is tightly wound on stacked protein cores. The physical properties (melting, circular dichroism) as well as DNase I (EC 3.1.4.5) digestion patterns support this view. DNase I digestion of tight oligomers in which the 5' ends of the DNA have been labeled yields results consistent with this model and inconsistent with some other possible models. Several classes of such particles are postulated to exist, differing in DNA length by 10-bp increments. This may be an explanation of the 10-bp nucleosome "phasing" that has been observed in some nuclei.     

Nucleotide sequence at the termini of the DNA of Bacillus subtilis phage phi 29

Phage phi 29 DNA cannot be phosphorylated with polynucleotide kinase and [gamma-32P]ATP because of the presence of a viral protein covalently linked to the 5' termini. The 5' ends can, however, be made susceptible to phosphorylation by treatment with alkali and alkaline phosphatase. Restriction fragments Hpa II C and Hpa II F, corresponding to the right and left ends of phi 29 DNA, respectively, were labeled at the 5' ends with polynucleotide kinase and [gamma-32P]ATP or at the 3' ends with terminal transferase and [alpha-32P]ATP or [alpha-32P]cordycepin 5'-triphosphate. After a secondary cleavage of the labeled fragments, the sequence of the first 150-180 nucleotides at the termini of phi 29 DNA was determined by the method of Maxam and Gilbert. The ends of phi 29 DNA are flush, and a six-nucleotides-long inverted terminal repetition was found. The functional implications of the sequences determined are discussed.     

Covalent crosslinking of tRNA1Val to 16S RNA at the ribosomal P site: identification of crosslinked residues.

N-Acetylvalyl-tRNA1Val (AcVal-tRNA1Val) was bound to the P site of uniformly 32P-labeled 70S ribosomes from Escherichia coli and crosslinked to 16S RNA in the 30S ribosomal subunit by irradiation with light of 300-400 nm. To identify the crosslinked nucleotide in 16S RNA. AcVal-tRNA1Val-16S [32P]RNA was digested completely with RNase T1 and the band containing the covalently attached oligonucleotides from tRNA and rRNA was isolated by polyacrylamide gel electrophoresis. The crosslinked oligonucleotide, and the 32P-labeled rRNA moiety released from it by photoreversal of the crosslink at 254 nm, were then analyzed by secondary hydrolysis with pancreatic RNase A and RNase U2.The oligonucleotide derived from 16S RNA was found to be the evolutionarily conserved sequence, U-A-C-A-C-A-C-C-G1401, and the nucleotide crosslinked to tRNA1Val, C1400. The identity of the covalently attached residue in the tRNA was established by using AcVal-tRNA1Val-16S RNA prepared from unlabeled ribosomes. This complex was digested to completion with RNase T1 and the resulting RNA fragments were labeled at the 3' end with [5'-32P]pCp. The crosslinked T1 oligonucleotide isolated from the mixture yielded one major end-labeled component upon photoreversal. Chemical sequence analysis demonstrated that this product was derived from the anticodon-containing pentadecanucleotide of tRNA1Val, C-A-C-C-U-C-C-C-U-cmo5U-A-C-m6A-A-G39(cmo5U, 5-carboxymethoxyuridine). A similar study of the crosslinked oligonucleotide revealed that the residue covalently bound to 16S was cmo5U34, the 5' or wobble base of the anticodon. The adduct is believed to result from formation of a cyclobutane dimer between cmo5U34 of tRNA1Val and C1400 of the 16S RNA.     

Initiation of translation directed by 42S and 26S RNAs from Semliki Forest virus in vitro.

The proteins synthesized in vitro in response to 42S and 26S RNAs from Semliki Forest virus were labeled with formyl-[35S]methionine from initiator tRNA. One protein which comigrated with viral capsid protein was labeled under the direction of 26S RNA, and only one labeled peptide was detected after digestion with trypsin. Further digestion with pronase gave rise to the dipeptide fMet-AsN. Several labeled polypeptides were found in the 42S RNA directed product and these had molecular weights of up to 150,000. However, tryptic digestion of the product yielded only one formylmethionyl-labeled peptide, which had a different mobility from that directed by the 26S RNA. Further digestion with pronase gave a single dipeptide, fMet-Ala. This indicates that nonstructural proteins as large as 150,000 daltons are probably synthesized from one initiation site on the 42S RNA. Translation starting from the internal initiation site on the 42S RNA, which is equivalent to that on the 26S RNA, could not be detected under the conditions used. Internal initiation sites which are similarly inactive have also been detected in other viral RNAs (e.g., brome mosaic virus, tobacco mosaic virus, and polyoma 19S RNA) and this suggests that, although eukaryotic mRNAs can contain more than one initiation site for protein synthesis, only the site nearer the 5' terminus is active in vitro.     

Exonucleolytic degradation of double-stranded RNA by an activity in Xenopus laevis germinal vesicles

We have identified, in extracts from Xenopus laevis germinal vesicles, a 5' exonuclease activity that cleaves double-stranded RNA (dsRNA). Features of the 5' ends of dsRNAs determine whether the strands are symmetrically or asymmetrically degraded. The activity hydrolyzes in the 5' to 3' direction, releasing 5'-mononucleotides processively, favoring strands with 5'-monophosphate termini; molecules with capped ends are resistant to digestion. Because of its ability to processively digest dsRNA to mononucleotides, we have named the exonuclease Chipper, which could cooperate or compete with Dicer (an endonuclease that produces molecules with a 5'-phosphate) in the processing of dsRNA.     

Nucleotide sequence of 5'' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.

The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.     

A DNA fragment with an alpha-phosphorothioate nucleotide at one end is asymmetrically blocked from digestion by exonuclease III and can be replicated in vivo.

2'-Deoxyadenosine 5'-O-(1-thiotriphosphate) (dATP[alpha S]) was introduced into the 3' ends of DNA restriction fragments with Escherichia coli DNA polymerase I to give phosphorothioate internucleotide linkages. Such "capped" 3' ends were found to be resistant to exonuclease III digestion. Moreover, the resistance to digestion is great enough that, under conditions used by us, just one strand of a double helix is digested by exonuclease III when a cap is placed at only one end; when digestion is carried to completion, this results in production of intact single strands. When digestion with exonuclease III is limited and is followed by S1 nuclease treatment, double-stranded DNA fragments asymmetrically shortened from just one side are produced. In this was thousands of nucleotides can be selectively removed from one end of a restriction fragment. In vitro introduction of phosphorothioate linkages into one end of a linearized replicative plasmid, followed by exonuclease III and S1 nuclease treatments, gives rise to truncated forms that, upon circularization by blunt-end ligation, transform E. coli and replicate in vivo.