Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR

A two-tube real-time assay, developed in a LightCycler, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO(4)-3'), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 degrees C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85+/-0.5 and 56 degrees C determined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.     

Cytolethal distending toxin genes in Campylobacter jejuni and Campylobacter coli isolates: detection and analysis by PCR

Campylobacter jejuni produces a toxin called cytolethal distending toxin (CDT). Knowledge of the prevalence and homogeneity of Campylobacter sp. cdt genes is incomplete. In this work, we identified four PCR primer pairs that collectively amplified cdt genes in all of the C. jejuni and Campylobacter coli strains tested. Restriction analyses of the cdt PCR products showed clear differences between the cdt genes of these two species, yet there were few heterogeneities noted between members of the same species. Consequently, it may be possible to speciate C. jejuni and C. coli isolates on the basis of restriction patterns within their cdt genes.     

Association with HeLa cells of Campylobacter jejuni and Campylobacter coli isolated from human feces.

We developed a rapid in vitro test for determining the association of Campylobacter jejuni and C. coli with HeLa cells. Association was expressed as a weighted mean of the number of bacteria associated with one cell in an association index (AI). The reproducibility of the AI was checked by repeating the test six times, using four strains chosen at random. Means and standard deviations of the means were 7.3 +/- 1.2, 6.8 +/- 0.9, 1.8 +/- 1.2, and 0.1 +/- 0.2. The experimental conditions for which the results are reliable have been standardized. Among 42 strains from human feces, two groups appeared: for 22 nonassociative strains (52%), AI values ranged from 0.0 to 2.1 (mean +/- SD, 0.5 +/- 0.6); for 20 associative strains (48%), AI values ranged from 3.5 to 8.3 (mean +/- SD, 6.2 +/- 1.4). Of these 42 strains, 17 were clinically documented. Diarrhea occurred more frequently in patients infected with associative strains than in those infected with noninvasive strains (7/7 versus 3/10, P = 0.01). Fever also occurred more frequently in patients infected with associative strains (6/7 versus 2/10, P = 0.03). Transmission electron microscopy and viable counts made after killing of extracellular bacteria by gentamicin support the fact that associated Campylobacter spp. are adherent to the cell membrane and are internalized into cytoplasmic vacuoles. The described test seems to be a convenient and rapid method for estimating the pathogenicity of a given strain.     

PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples.

Three sets of primers were designed for PCR detection and differentiation of Campylobacter jejuni and Campylobacter coli. The first PCR assay was designed to coidentify C. jejuni and C. coli based on their 16S rRNA gene sequences. The second PCR assay, based on the hippuricase gene sequence, identified all tested reference strains of C. jejuni and also strains of that species which lack detectable hippuricase activity. The third PCR assay, based on the sequence of a cloned (putative) aspartokinase gene and the downstream open reading frame, identified all tested reference strains of C. coli. The assays will find immediate application in the rapid identification to species level of isolates. The assays combine with a protocol for purification of total DNA from fecal samples to allow reproducible PCR identification of campylobacters directly from stools. Of 20 clinical samples from which campylobacters had been cultured, we detected C. jejuni in 17, C. coli in 2, and coinfection of C. jejuni and Campylobacter hyointestinalis in 1. These results were concordant with culture and phenotypic identification to species level. Strain typing by PCR-restriction fragment length polymorphism of the flagellin (flaA) gene detected identical flaA types in fecal DNA and the corresponding campylobacter isolate. Twenty-five Campylobacter-negative stool samples gave no reaction with the PCR assays. These PCR assays can rapidly define the occurrence, species incidence, and flaA genotypes of enteropathogenic campylobacters.     

Use of an alkaline phosphatase-labeled synthetic oligonucleotide probe for detection of Campylobacter jejuni and Campylobacter coli.

A commercially available synthetic nucleic acid probe (SNAP) conjugated to alkaline phosphatase was compared with standard culture techniques for detecting Campylobacter species. The SNAP was able to detect either 5 ng of C. jejuni DNA or 10(5) CFU of bacteria. The SNAP could also detect DNA extracted from 10(5) CFU in mock-infected stool samples. The SNAP detected C. jejuni and C. coli but showed no reactivity with C. laridis, C. fetus subsp. fetus, C. fetus subsp. venerealis, C. fennelliae, "C. upsaliensis," C. cinaedii, C. fecalis, C. hyointestinalis, C. mucosalis, or Helicobacter (Campylobacter) pylori. The SNAP also showed no cross-reactivity with other enteric pathogens. When applied to pure cultures, the SNAP detected 55 clinical isolates of C. jejuni and 11 clinical isolates of C. coli, with an accuracy of 100%. When applied directly to clinical specimens, the SNAP detected Campylobacter spp. in 19 of 23 culture-positive stool specimens (sensitivity, 82.6%; specificity, 100%). Pure cultures of the Campylobacter strains isolated from the four probe-negative, culture-positive stool specimens gave positive reactions with the SNAP. While the SNAP had excellent sensitivity and specificity for isolated bacterial colony isolates, the main limitation to the Campylobacter probe detection kit may be the sensitivity limit on direct detection of Campylobacter organisms in stools.     

Evaluation of culture methods and a DNA probe-based PCR assay for detection of Campylobacter species in clinical specimens of feces

Campylobacter species are the leading agents of bacterial gastroenteritis in developed countries. In this study 320 specimens of feces from patients with symptoms of acute gastroenteritis were cultured for Campylobacter species by direct plating on modified charcoal cefoperazone deoxycholate agar and by enrichment in modified Preston broth, with or without blood added, for 48 h at 37 degrees C prior to plating. A 16S/23S PCR/DNA probe membrane-based colorimetric detection assay was evaluated on a subset of the feces (n = 127), including 18 culture-positive and 109 culture-negative specimens. DNA was extracted directly from the fecal specimens by using the QIAamp DNA stool Minikit for the DNA probe-based PCR assay (PCR/DNA probe assay). A second PCR/DNA probe assay based on the 16S rRNA gene in Campylobacter spp. was applied to all specimens that were culture negative, PCR/DNA positive on initial analysis. Campylobacter species were cultured in 20 of the 320 specimens. The 16S/23S PCR/DNA probe assay detected campylobacter DNA in 17 of 18 (94% sensitivity) culture-positive specimens and in 41 (38%) culture-negative specimens. The presence of campylobacter DNA in 35 of 41 culture-negative specimens was confirmed by the 16S PCR/DNA probe assay. DNA sequence analysis of seven 16S/23S PCR products and five 16S PCR products amplified from a selection of these specimens confirmed the presence of campylobacter DNA and more specifically Campylobacter jejuni, C. concisus, C. curvus, and C. gracilis DNA in these specimens. The molecular assays described in this study are rapid methods for the detection and identification of Campylobacter species in fecal specimens. The finding of Campylobacter spp. DNA in a large number of specimens of feces from patients with no other identified cause of diarrhea may suggest that Campylobacter spp. other than C. jejuni and C. coli may account for a proportion of cases of acute gastroenteritis in which no etiological agent is currently identified.     

Evaluation of 11 PCR assays for species-level identification of Campylobacter jejuni and Campylobacter coli

We examined the sensitivity and specificity of 11 PCR assays described for the species identification of Campylobacter jejuni and Campylobacter coli by using 111 type, reference, and field strains of C. jejuni, C. coli, and Campylobacter lari. For six assays, an additional 21 type strains representing related Campylobacter, Arcobacter, and Helicobacter species were also included. PCR tests were initially established in the laboratory by optimizing conditions with respect to five type and reference strains of C. jejuni, C. coli, and C. lari. One PCR test for C. coli failed to give appropriate results during this initial setup phase and was not evaluated further. The remaining 10 assays were used to examine heated lysate and purified DNA templates as appropriate of well-characterized type, reference, and field strains of C. jejuni (n = 62), C. coli (n = 34), and C. lari (n = 15). The tests varied considerably in their sensitivity and specificity for their respective target species. No assay was found to be 100% sensitive and/or specific for all C. jejuni strains tested, but four assays for C. coli gave appropriate responses for all strains examined. Between one and six strains of C. jejuni gave amplicons in four of seven C. jejuni PCR tests only where purified DNA was used as the template; corresponding results were seen with one strain of C. coli in each of three assays for the latter species. Our findings indicate that a polyphasic strategy for PCR-based identification should be used to identify C. jejuni and C. coli strains. The data may assist laboratories in selecting assays suited for their needs and in designing evaluations of future PCR tests aimed to identify these species.     

Blood-free selective medium for isolation of Campylobacter jejuni from feces

A blood-free selective agar is described which contains charcoal, ferrous sulfate, sodium pyruvate, casein hydrolysates, cefazolin, and sodium deoxycholate (CCD agar). CCD agar was compared with Preston medium for isolation of Campylobacter jejuni from human feces, and isolation rates were similar on both media, but CCD agar was less selective. Temperature studies at 37 and 42 degrees C confirmed that incubation of direct plates at 42 degrees C for 48 h was necessary for maximum isolation of C. jejuni.     

Evaluation of a PCR assay for the detection and identification of Campylobacter jejuni and Campylobacter coli in retail poultry products

A PCR-based method was applied to Campylobacter detection in poultry samples at the retail level. In total, 73 retail poultry samples purchased from supermarkets in the Basque Country area in the north of Spain were examined using both culture and molecular (alternative) methods. In our routine method, the worldwide ISO 10272:1995 standard of Preston broth incubated at 42 degrees C for conventional Campylobacter detection was adopted. The molecular method was comprised of a DNA extraction kit consisting of a single polypropylene spin column and PCR amplification of the Campylobacter 16S rRNA gene. A total of 54 raw samples were positive by either PCR or culture; among these, 50 were found to be positive by conventional plating and 54 by PCR. Concordant results, i.e., positive and negative in both methods, were found in 64 samples (94.1%). All positive samples by culture were also positive by PCR, resulting in 100% of positive concordance. Two samples (2.9%) positive after retesting by PCR were considered to be false-negatives. The detection limit of the PCR method was 5 CFUs that corresponded to 0.2 CFUs per 5 mul in the PCR mixture. The percentages of samples that required enrichment to prove Campylobacter presence were moderate, 18% by culture and 13% by PCR. Total analysis time was reduced to a few hours (within the working day) or 24 h when enrichment was required. Therefore, this PCR method proved to be useful as a routine diagnostic test for Campylobacter detection and confirmation of C. jejuni and C. coli in naturally contaminated poultry samples.     

Comparative performance of different PCR assays for the identification of Campylobacter jejuni and Campylobacter coli

The sensitivity and specificity of 7 PCR assays described for the identification of Campylobacter jejuni and Campylobacter coli were examined using alkaline cell lysates from a collection of 100 well characterized reference strains of C. jejuni, C. coli, Campylobacter lari and related Campylobacter, Helicobacter and Arcobacter species. Based on a preliminary evaluation, one multiplex test was excluded from further evaluation. The various assays differed considerably in sensitivity and specificity towards their target species. For C. coli, 4 of the 5 assays were 100% specific and sensitive, but for C. jejuni, none of the 5 assays were found to be 100% specific or sensitive. Subsequently, a statistically valid sample (n=263) was taken from a Belgian collection of 1906 human Campylobacter field isolates. This second collection was used to further evaluate two selected multiplex PCR assays. The present study indicates that PCR-based identification using each of the two selected multiplex PCR assays was highly reliable. The R-mPCR assay, followed by species-specific PCR assays or the ceu-oxr mPCR assay if necessary, is our current strategy of choice for the molecular identification of C. jejuni and C. coli. Results presented here should aid researchers in selecting a PCR assay suitable for their specific needs.     

Use of auxotyping for epidemiological studies of Campylobacter jejuni and Campylobacter coli infections.

A chemically defined medium developed for Neisseria gonorrhoeae was modified to support the growth of Campylobacter jejuni and Campylobacter coli. A total of 76 isolates of C. jejuni and 14 isolates of C. coli were tested on this medium, which was designated Campylobacter defined medium (CDM), over a 3-month period. Although none of the C. coli isolates appeared to require amino acids, 51% of the C. jejuni tested required one and 7% required multiple amino acids for growth. An analysis of isolates obtained from three household outbreaks of campylobacteriosis demonstrated that auxotyping identified the epidemic strain within each outbreak. Among 70 isolates of C. jejuni examined, no correlation could be drawn between a specific serotype and auxotype or between auxotype and plasmid profile.     

Monosaccharide composition of lipopolysaccharides from Campylobacter jejuni and Campylobacter coli

The monosaccharide composition of the LPS from 5 Campylobacter jejuni strains and 7 Campylobacter coli strains has been studied. All LPS's contained KDO, heptose, glucosamine, glucose, and (with one exception) galactose. All C. jejuni and 3 C. coli LPS's contained greater than 1% galactosamine. 3-Amino-3.6-dideoxyglucose was present in all but one C. coli LPS and in only one C. jejuni LPS.     

Campylobacter jejuni and Campylobacter coli serotypes isolated from chickens, cattle, and pigs

A total of 191 Campylobacter jejuni and 125 Campylobacter coli were isolated from the intestinal content of 398 chickens, 421 cattle, and 203 pigs. All 108 chicken isolates and 73 of 80 cattle isolates were C. jejuni, but 115 of the 118 pig isolates were C. coli. A total of 84% of the C. jejuni and 64% of the C. coli isolates were typed on the basis of thermostable antigens with 20 antisera prepared against frequently occurring serotypes in Campylobacter enteritis in man (15 C. jejuni, 6 C. coli serotypes). A total of 96% of the chicken isolates and 67% of the cattle isolates belonged to 11 C. jejuni serotypes that occur most frequently in human cases of enteritis (serotypes 1, 2, 3, 4, 5, 13/16, 18, 21, 23, 31, and 36). Serotype 8, a relatively common human isolate, was not recovered. The C. coli isolates from pigs belonged to serotypes uncommon among human isolates.     

Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting.

The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial repetitive intergenic consensus (ERIC) motifs generate isolate-specific DNA banding patterns. Analysis of these PCR fingerprints obtained for 33 isolates of Campylobacter jejuni, 30 isolates of Campylobacter coli, and 8 isolates of Campylobacter lari revealed that besides generation of isolate-specific fragments, species-specific DNA fragments of identical size were synthesized. It appeared that these DNA fragments could be used as species-specific probes, since they are unique for the pattern which they are deriving from. The probes do not cross-react with amplified DNA originating from a large panel of nonrelated microorganisms. Moreover, these probes displayed species specificity, as they reacted with a single restriction fragment on Southern blots containing DNA from C. jejuni, C. coli, and C. lari and other Campylobacter species. This combination of PCR fingerprinting and probe hybridization results in a highly specific identification assay and provides an example of specific test development without the prior need for DNA sequence information. The principle of the procedure holds great promise for the rapid isolation of DNA probes which, in combination with a general PCR assay, may lead to efficient typing and detection procedures for a multitude of medically important nonviral microorganisms.     

Computer-assisted analysis and epidemiological value of genotyping methods for Campylobacter jejuni and Campylobacter coli

For epidemiological tracing of the thermotolerant Campylobacter species C. jejuni and C. coli, reliable and highly discriminatory typing techniques are necessary. In this study the genotyping techniques of flagellin typing (flaA typing), pulsed-field gel electrophoresis (PFGE), automated ribotyping, and amplified fragment length polymorphism (AFLP) fingerprinting were compared. The following aspects were compared: computer-assisted analysis, discriminatory power, and use for epidemiological typing of campylobacters. A set of 50 campylobacter poultry isolates from The Netherlands and neighboring countries was analyzed. Computer-assisted analysis made cluster analysis possible and eased the designation of different genotypes. AFLP fingerprinting was the most discriminatory technique, identifying 41 distinct genotypes, while PFGE identified 38 different types, flaA typing discriminated 31 different types, and ribotyping discriminated 26 different types. Furthermore, AFLP analysis was the most suitable method for computer-assisted data analysis. In some cases combining the results of AFLP fingerprinting, PFGE, and flaA typing increased our ability to differentiate strains that appeared genetically related. We conclude that AFLP is a highly discriminatory typing method and well suited for computer-assisted data analysis; however, for optimal typing of campylobacters, a combination of multiple typing methods is needed.     

Inaccuracy of routine susceptibility tests for detection of erythromycin resistance of Campylobacter jejuni and Campylobacter coli

In The Netherlands, both an increase in and regional differences in erythromycin resistance of Campylobacter jejuni and Campylobacter coli have been reported. To determine the accuracy of routine tests for erythromycin resistance, 48 erythromycin-resistant isolates from various laboratories that participate in the Dutch surveillance of Campylobacter infections were reinvestigated. Initial susceptibility testing for erythromycin had been performed by disk diffusion in six and MIC-based methods in two laboratories. Reinvestigation was carried out using broth microdilution as a reference standard, as well as E -test and genetic resistance testing. Of 36 C. jejuni isolates reported by the initial laboratories as erythromycin-resistant, four (11%) and five (14%) were confirmed as erythromycin-resistant using broth microdilution according to CLSI and EUCAST resistance criteria, respectively. Erythromycin resistance was found in eight of 12 (67%) C. coli isolates according to both criteria. Results of E -tests were in accordance with these results in all isolates. Resistance-associated mutations in the 23S rRNA gene (A2059G and A2058T) were found in all isolates showing high-level resistance, whereas none were found in susceptible isolates. Routine determination of the erythromycin resistance of C. jejuni and C. coli shows unacceptable interlaboratory variation. In the absence of standardized protocols and interpretive criteria for disk diffusion, and while we await the development of easily applicable and reliable methods for molecular resistance testing, the use of broth microdilution remains the best method.     

Differentiation of Campylobacter coli, Campylobacter jejuni, Campylobacter lari, and Campylobacter upsaliensis by a multiplex PCR developed from the nucleotide sequence of the lipid A gene lpxA

We describe a multiplex PCR assay to identify and discriminate between isolates of Campylobacter coli, Campylobacter jejuni, Campylobacter lari, and Campylobacter upsaliensis. The C. jejuni isolate F38011 lpxA gene, encoding a UDP-N-acetylglucosamine acyltransferase, was identified by sequence analysis of an expression plasmid that restored wild-type lipopolysaccharide levels in Escherichia coli strain SM105 [lpxA(Ts)]. With oligonucleotide primers developed to the C. jejuni lpxA gene, nearly full-length lpxA amplicons were amplified from an additional 11 isolates of C. jejuni, 20 isolates of C. coli, 16 isolates of C. lari, and five isolates of C. upsaliensis. The nucleotide sequence of each amplicon was determined, and sequence alignment revealed a high level of species discrimination. Oligonucleotide primers were constructed to exploit species differences, and a multiplex PCR assay was developed to positively identify isolates of C. coli, C. jejuni, C. lari, and C. upsaliensis. We characterized an additional set of 41 thermotolerant isolates by partial nucleotide sequence analysis to further demonstrate the uniqueness of each species-specific region. The multiplex PCR assay was validated with 105 genetically defined isolates of C. coli, C. jejuni, C. lari, and C. upsaliensis, 34 strains representing 12 additional Campylobacter species, and 24 strains representing 19 non-Campylobacter species. Application of the multiplex PCR method to whole-cell lysates obtained from 108 clinical and environmental thermotolerant Campylobacter isolates resulted in 100% correlation with biochemical typing methods.     

Virulence of Campylobacter jejuni for chicken embryos.

The pathogenicity of Campylobacter jejuni was examined in chicken embryos. In this system, mortality data and histopathological findings induced by organisms and by bacterium-free filtered broth were identical. The absence in chicken embryo tissues both of organisms and of an inflammatory infiltrate suggests a toxin etiology.     

Specific detection of Campylobacter jejuni and Campylobacter coli by using polymerase chain reaction.

Development of a routine detection assay for Campylobacter jejuni and Campylobacter coli in clinical specimens was undertaken by using the polymerase chain reaction (PCR). An oligonucleotide primer pair from a conserved 5' region of the flaA gene of C. coli VC167 was used to amplify a 450-bp region by PCR. The primer pair specifically detected 4 strains of C. coli and 47 strains of C. jejuni; but it did not detect strains of Campylobacter fetus, Campylobacter lari, Campylobacter upsaliensis, Campylobacter cryaerophila, Campylobacter butzleri, Campylobacter hyointestinalis, Wolinella recta, Helicobacter pylori, Escherichia coli, Shigella spp., Salmonella spp., Vibrio cholerae, Citrobacter freundii, or Aeromonas spp. By using a nonradioactively labeled probe internal to the PCR product, the assay could detect as little as 0.0062 pg of purified C. coli DNA, or the equivalent of four bacteria. In stools seeded with C. coli cells, the probe could detect between 30 and 60 bacteria per PCR assay. The assay was also successfully used to detect C. coli in rectal swab specimens from experimentally infected rabbits and C. jejuni in human stool samples.