A phylogenetic comparison of urease-positive thermophilic Campylobacter (UPTC) and urease-negative (UN) C. lari

In the present study, the reliability of full-length gene sequence information for several genes including 16S rRNA was examined, for the discrimination of the two representative Campylobacter lari taxa, namely urease-negative (UN) C. lari and urease-positive thermophilic Campylobacter (UPTC). As previously described, 16S rRNA gene sequence are not reliable for the molecular discrimination of UN C. lari from UPTC organisms employing both the unweighted pair group method using arithmetic means analysis (UPGMA) and neighbor joining (NJ) methods. In addition, three composite full-length gene sequences (ciaB, flaC and vacJ) out of seven gene loci examined were reliable for discrimination employing dendrograms constructed by the UPGMA method. In addition, all the dendrograms of the NJ phylogenetic trees constructed based on the nine gene information were not reliable for the discrimination. Three composite full-length gene sequences (ciaB, flaC and vacJ) were reliable for the molecular discrimination between UN C. lari and UPTC organisms employing the UPGMA method, as well as among four thermophilic Campylobacter species.     

Reliability of a multiplex PCR assay for the identification of the major Campylobacter taxa

The primer pair (C412F/C1228R) constructed previously for the polymerase chain reaction (PCR) identification of the genus Campylobacter using an approximate 800 base pair (bp) 16S rRNA gene target segment proved to be useful for the identification of a total of 49 Campylobacter lari isolates including urease-positive thermophilic Campylobacter (UPTC) organisms (n=25). When the primer pair (CLF/R) developed previously for the PCR identification of C. lari species using an approximate 250 bp glyA segment was employed, 27 C. lari isolates, including all the UPTC isolates, were identified to be PCR-negative (55%). Therefore, this PCR procedure developed for the molecular identification of C. lari was shown to be unreliable for C. lari identification. Nucleotide sequencing analysis clarified the reason(s) why PCR-negative examples occurred in many C. lari isolates, including UPTC isolates. The primer pair target sequences in the C. lari-specific PCR-negative isolates apparently varied at the 3' end region, as compared with C. lari-specific PCR-positive isolates. Thus, the multiplex PCR assay developed previously was shown to be unreliable for the molecular identification of C. lari subspecies organisms.     

Molecular cloning, nucleotide sequencing and characterization of the flagellin gene from isolates of urease-positive thermophilic Campylobacter

A primer pair which was expected to generate an amplicon of the estimated size (approximately 1700 base pair (bp)) of the flaA gene for Campylobacter jejuni amplified products of approximately 1450 bp for 33 of the 44 isolates of urease-positive thermophilic Campylobacter (UPTC). The primer pair, however, failed to amplify fragments for 11 isolates of UPTC, for all of the 12 isolates of urease-negative C. lari and for one isolate of C. coli. Nevertheless, it successfully amplified fragments of approximately 1700 bp for five isolates of C. jejuni and for nine isolates of C. coli. Thus, the fragments of the flaA gene of UPTC were shorter than those of C. jejuni and C. coli. After PCR amplification and nucleotide sequencing of the flaA genes from five UPTC NCTC isolates, the putative open reading frames (ORFs) were found to range from 1461 to 1479 bp. The amino acid and nucleotide sequence alignments demonstrated that the PCR clones contained the flaA gene; however, our data indicated that this locus was markedly shorter in the UPTC organisms examined, as they were approximately 85 amino acid residues shorter, mainly corresponding to approximate residue numbers 390-470 of the large variable region of C. jejuni 81116. Heterogeneity was indicated in the molecular mass of the flagellin purified from the isolates examined. Flagellin of UPTC was demonstrated to be genotypically and phenotypically smaller than those of C. jejuni.     

Uneven distribution of the luxS gene within the genus Campylobacter

Polymerase chain reaction (PCR) amplification was performed on 20 isolates of five Campylobacter species using a degenerate primer pair designed in silico to generate a product of the luxS gene or its homologue from Campylobacter organisms. Although the primer pair successfully amplified products of approximately 500 base pairs (bp) with the eight isolates of C. jejuni and C. coli and some of C. upsaliensis and C. fetus, it failed to amplify fragments with all four isolates of C. lari (two urease-negative C. lari; two urease-positive thermophilic campylobacters). When Southern blot hybridisation analysis was carried using the mixed luxS gene fragments prepared from the C. jejuni, C. coli, C. upsaliensis and C. fetus strains as a probe, all C. jejuni, C. coli, C. upsaliensis and C. fetus isolates gave positive signals, but no positive signal was detected with any C. lari isolate. These results clearly indicate that C. jejuni, C. coli, C. upsaliensis and C. fetus carry the luxS gene or its homologue. However, no luxS gene or its homologue was identified to occur in the C. lari genome. Although autoinducer-2 assays were positive in C. jejuni, C. coli, C. upsaliensis and C. fetus isolates, it was negative with all the C. lari isolates examined. In addition, a biofilm formation assay demonstrated that biofilm formation in the C. lari species does not appear to correlate with the occurrence of the luxS gene because biofilm formation occurred among some isolates of C. lari.     

Differentiation of Campylobacter coli, Campylobacter jejuni, Campylobacter lari, and Campylobacter upsaliensis by a multiplex PCR developed from the nucleotide sequence of the lipid A gene lpxA

We describe a multiplex PCR assay to identify and discriminate between isolates of Campylobacter coli, Campylobacter jejuni, Campylobacter lari, and Campylobacter upsaliensis. The C. jejuni isolate F38011 lpxA gene, encoding a UDP-N-acetylglucosamine acyltransferase, was identified by sequence analysis of an expression plasmid that restored wild-type lipopolysaccharide levels in Escherichia coli strain SM105 [lpxA(Ts)]. With oligonucleotide primers developed to the C. jejuni lpxA gene, nearly full-length lpxA amplicons were amplified from an additional 11 isolates of C. jejuni, 20 isolates of C. coli, 16 isolates of C. lari, and five isolates of C. upsaliensis. The nucleotide sequence of each amplicon was determined, and sequence alignment revealed a high level of species discrimination. Oligonucleotide primers were constructed to exploit species differences, and a multiplex PCR assay was developed to positively identify isolates of C. coli, C. jejuni, C. lari, and C. upsaliensis. We characterized an additional set of 41 thermotolerant isolates by partial nucleotide sequence analysis to further demonstrate the uniqueness of each species-specific region. The multiplex PCR assay was validated with 105 genetically defined isolates of C. coli, C. jejuni, C. lari, and C. upsaliensis, 34 strains representing 12 additional Campylobacter species, and 24 strains representing 19 non-Campylobacter species. Application of the multiplex PCR method to whole-cell lysates obtained from 108 clinical and environmental thermotolerant Campylobacter isolates resulted in 100% correlation with biochemical typing methods.     

Demonstration of the absence of intervening sequences within 23S rRNA genes from Campylobacter lari

Cloning, sequencing and characterization of nearly full‐length 23S rRNA genes in 12 urease‐positive thermophilic Campylobacter (UPTC) isolates were carried out using two novel PCR primer pairs. Nucleotide sequences of the 23S rRNA genes from the 12 isolates were first shown not to carry any intervening sequences (IVSs) in both the 25 and 45 helix regions. Then, two PCR primer sets were designed in silico for amplification of the helix 25 and 45 regions within 23S rRNA gene sequences from Campylobacter lari. No IVSs were identified within the 23S rRNA genes among a total of 53 isolates of C. lari, following PCR amplification, TA cloning and sequencing procedures. Intact 23S rRNA was identified in all 65 C. lari isolates, resulting in no production of the fragmented 23S rRNA. These data suggest that C. lari may not have any opportunity to interact with any other source of IVSs until now, or has been unable to integrate IVSs into their own genomes. (© 2009 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim)     

Discrimination among thermophilic Campylobacter species by polymerase chain reaction amplification of 23S rRNA gene fragments.

By comparing nucleic acid sequences determined for one of the most variable areas of 23S rRNA genes of 23 Campylobacter strains, we were able to identify regions specific for thermophilic Campylobacter strains. Oligonucleotide primers corresponding to these unique regions were synthesized and used in the polymerase chain reaction. One primer pair selectively detected all thermophilic Campylobacter species, while four other primer pairs allowed discrimination among the thermophilic species Campylobacter coli, Campylobacter jejuni subsp. jejuni, Campylobacter lari, and Campylobacter upsaliensis. All primer sets were tested successfully on a large number of clinical isolates.     

Microarray-based identification of thermophilic Campylobacter jejuni,C. coli,C. lari,and C. upsaliensis

DNA microarrays are an excellent potential tool for clinical microbiology, since this technology allows relatively rapid identification and characterization of microbial and viral pathogens. In the present study, an oligonucleotide microarray was developed and used for the analysis of thermophilic Campylobacter spp., the primary food-borne pathogen in the United States. We analyzed four Campylobacter species: Campylobacter jejuni, C. coli, C. lari, and C. upsaliensis. Our assay relies on the PCR amplification of specific regions in five target genes (fur, glyA, cdtABC, ceuB-C, and fliY) as a first step, followed by microarray-based analysis of amplified DNAs. Alleles of two genes, fur and glyA, which are found in all tested thermophilic Campylobacter spp., were used for identification and discrimination among four bacterial species, the ceuB-C gene was used for discrimination between C. jejuni and C. coli, and the fliY and cdt genes were used as additional genetic markers specific either for C. upsaliensis and C. lari or for C. jejuni. The array was developed and validated by using 51 previously characterized Campylobacter isolates. All isolates were unambiguously identified on the basis of hybridization patterns with 72 individual species-specific oligoprobes. Microarray identification of C. jejuni and C. coli was confirmed by PCR amplification of other genes used for identification (hipO and ask). Our results demonstrate that oligonucleotide microarrays are suitable for rapid and accurate simultaneous differentiation among C. jejuni, C. coli, C. lari, and C. upsaliensis.     

Rapid Identification of Thermotolerant Campylobacter jejuni, Campylobacter coli, Campylobacter lari, and Campylobacter upsaliensis from Various Geographic Locations by a GTPase-Based PCR-Reverse Hybridization Assay

Recently, a gene from Campylobacter jejuni encoding a putative GTPase was identified. Based on two semiconserved GTP-binding sites encoded within this gene, PCR primers were selected that allow amplification of a 153-bp fragment from C. jejuni, C. coli, C. lari, and C. upsaliensis. Sequence analysis of these PCR products revealed consistent interspecies variation, which allowed the definition of species-specific probes for each of the four thermotolerant Campylobacter species. Multiple probes were used to develop a line probe assay (LiPA) that permits analysis of PCR products by a single reverse hybridization step. A total of 320 reference strains and clinical isolates from various geographic origins were tested by the GTP-based PCR-LiPA. The PCR-LiPA is highly specific in comparison with conventional identification methods, including biochemical and whole-cell protein analyses. In conclusion, a simple method has been developed for rapid and highly specific identification of thermotolerant Campylobacter species.     

Biochemical characterisation of urease from urease-positive thermophilic campylobacter (UPTC)

This study aims to characterise biochemically urease from an atypical Campylobacter lari, namely urease-positive thermophilic Campylobacter (UPTC). Urease was purified from cells of a Japanese UPTC isolate (CF89-12) using phenyl-Sepharose chromatography. Two protein components (estimates molecular masses 24 kDa and 61 kDa) were obtained that appeared to be structural proteins of urease (subunits A and B), and these were fractionated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (PAGE). The native molecular weight for the final purified UPTC urease was estimated to be approximately 186,000 Da which is close to the calculated molecular weight (182,738 Da) based on all six open reading frames of UPTC CF89-12 urease genes (ureA, B, E, F, G and H), as described previously. Moreover, an active band was observed on phenol red staining after a nondenaturing native PAGE of the crude extract from the UPTC cells. In addition, the purified urease of UPTC CF8912 showed enzyme activity over a broad pH range (pH 6-10), with maximal activity at pH 8.0. The urease was also stable against heat treatment, with almost no loss of enzyme activity seen following 60-min incubation at temperatures of 20-60 degrees C. Urease subunits A and B were identified immunologically by Western blot analysis with rabbit anti-urease alpha (A) and beta (B) raised against Helicobacter pylori.     

Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR

A two-tube real-time assay, developed in a LightCycler, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO(4)-3'), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 degrees C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85+/-0.5 and 56 degrees C determined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.     

Phenotypic characterisation of flagellin and flagella of urease-positive thermophilic campylobacters

In this study, flagellin is purified biochemically from eight urease-positive thermophilic camplylobacters (UPTC) isolated from river water, sea water and mussels, and purified also from two isolates of Campylobacter jejuni and C. coli and fractionated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Results showed that no flagellin components were detected in the two Japanese UPTC isolates (CF89-12 and CF89-14) and the two UPTC NCTC strains (NCTC12893 and NCTC12894). Flagellin components, each consisting of a single peptide, with a heterogeneous molecular mass of approximately 52-63 kDa were demonstrated in the other four UPTC isolates (NCTC12892, NCTC12895, NCTC12896 and NI15F [from Northern Ireland]) and the two Japanese isolates of C. jejuni (JCM2013 and C. coli 27). The approximate molecular mass of flagellin from the flagellin-positive UPTC isolates was smaller than those of C. jejuni and C. coli. Flagella were not detected by electron microscopy in the four flagellin-negative UPTC isolates but they were detected in the four flagellin-positive UPTC isolates and the two isolates of C. jejuni and C. coli. Thus, significant phenotypic diversity for flagellin, which must be due to genotypic variations, was demonstrated among the UPTC isolates.