Comparative performance of different PCR assays for the identification of Campylobacter jejuni and Campylobacter coli

The sensitivity and specificity of 7 PCR assays described for the identification of Campylobacter jejuni and Campylobacter coli were examined using alkaline cell lysates from a collection of 100 well characterized reference strains of C. jejuni, C. coli, Campylobacter lari and related Campylobacter, Helicobacter and Arcobacter species. Based on a preliminary evaluation, one multiplex test was excluded from further evaluation. The various assays differed considerably in sensitivity and specificity towards their target species. For C. coli, 4 of the 5 assays were 100% specific and sensitive, but for C. jejuni, none of the 5 assays were found to be 100% specific or sensitive. Subsequently, a statistically valid sample (n=263) was taken from a Belgian collection of 1906 human Campylobacter field isolates. This second collection was used to further evaluate two selected multiplex PCR assays. The present study indicates that PCR-based identification using each of the two selected multiplex PCR assays was highly reliable. The R-mPCR assay, followed by species-specific PCR assays or the ceu-oxr mPCR assay if necessary, is our current strategy of choice for the molecular identification of C. jejuni and C. coli. Results presented here should aid researchers in selecting a PCR assay suitable for their specific needs.     

Evaluation of a PCR assay for the detection and identification of Campylobacter jejuni and Campylobacter coli in retail poultry products

A PCR-based method was applied to Campylobacter detection in poultry samples at the retail level. In total, 73 retail poultry samples purchased from supermarkets in the Basque Country area in the north of Spain were examined using both culture and molecular (alternative) methods. In our routine method, the worldwide ISO 10272:1995 standard of Preston broth incubated at 42 degrees C for conventional Campylobacter detection was adopted. The molecular method was comprised of a DNA extraction kit consisting of a single polypropylene spin column and PCR amplification of the Campylobacter 16S rRNA gene. A total of 54 raw samples were positive by either PCR or culture; among these, 50 were found to be positive by conventional plating and 54 by PCR. Concordant results, i.e., positive and negative in both methods, were found in 64 samples (94.1%). All positive samples by culture were also positive by PCR, resulting in 100% of positive concordance. Two samples (2.9%) positive after retesting by PCR were considered to be false-negatives. The detection limit of the PCR method was 5 CFUs that corresponded to 0.2 CFUs per 5 mul in the PCR mixture. The percentages of samples that required enrichment to prove Campylobacter presence were moderate, 18% by culture and 13% by PCR. Total analysis time was reduced to a few hours (within the working day) or 24 h when enrichment was required. Therefore, this PCR method proved to be useful as a routine diagnostic test for Campylobacter detection and confirmation of C. jejuni and C. coli in naturally contaminated poultry samples.     

Evaluation of three rapid assays for direct diagnosis of Campylobacter jejuni and C. coli from stools

Biological diagnosis of campylobacteriosis is increasingly necessary to confirm gastroenteritis infection. In this study, we reported the comparison of two new immunoenzymatic tests Ridascreen Campylobacter (r-biopharm^®), premier Campy (Méridian^®), and one immunochromatographic test, Immunocard Stat !Campy (Méridian^®) which allow the fast detection of C. jejuni and C. coli directly from stool specimens, and culture on selective medium. The study was performed on 30 specimens from children. The three tests had the same performance. The ImmunoCard Stat !Campy could be an advantageous alternative to conventional culture.     

Evaluation of a latex agglutination method for the rapid identification of Campylobacter jejuni/coli

A latex agglutination assay was developed to identify Campylobacter jejuni and Campylobacter coli. We evaluated the specificity, reproducibility and utility of the assay for clinical use and the following results were obtained. 1) To prepare standardized antigen, bacterial cells must be suspended to a density of 1 to 5 McFarland unit, and heated at 121 degrees C for 10 to 30 min. 2) Bacterial cells may be suspended either in the solution provided with the kit, or in physiological saline, without affecting the results. 3) Of C. jejuni, 94 strains, 6 of C. coli, and 3 of "Campylobacter upsaliensis", all tested positive without exception. All other Campylobacter species, encompassing 13 species and 80 strains, were negative. An additional 9 species and 30 strains, of non-Campylobacter gram negative bacteria, isolated on the Campylobacter selection agar medium, also were uniformly negative. Based on these results, we conclude that bacteria testing positive with the kit can be identified as C. jejuni/coli. Interestingly, "C. upsaliensis", although isolated very rarely from the clinical specimens, also tested positive.     

Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR

A two-tube real-time assay, developed in a LightCycler, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO(4)-3'), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 degrees C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85+/-0.5 and 56 degrees C determined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.     

PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples.

Three sets of primers were designed for PCR detection and differentiation of Campylobacter jejuni and Campylobacter coli. The first PCR assay was designed to coidentify C. jejuni and C. coli based on their 16S rRNA gene sequences. The second PCR assay, based on the hippuricase gene sequence, identified all tested reference strains of C. jejuni and also strains of that species which lack detectable hippuricase activity. The third PCR assay, based on the sequence of a cloned (putative) aspartokinase gene and the downstream open reading frame, identified all tested reference strains of C. coli. The assays will find immediate application in the rapid identification to species level of isolates. The assays combine with a protocol for purification of total DNA from fecal samples to allow reproducible PCR identification of campylobacters directly from stools. Of 20 clinical samples from which campylobacters had been cultured, we detected C. jejuni in 17, C. coli in 2, and coinfection of C. jejuni and Campylobacter hyointestinalis in 1. These results were concordant with culture and phenotypic identification to species level. Strain typing by PCR-restriction fragment length polymorphism of the flagellin (flaA) gene detected identical flaA types in fecal DNA and the corresponding campylobacter isolate. Twenty-five Campylobacter-negative stool samples gave no reaction with the PCR assays. These PCR assays can rapidly define the occurrence, species incidence, and flaA genotypes of enteropathogenic campylobacters.     

Evaluation of commercial antisera for serotyping heat-labile antigens of Campylobacter jejuni and Campylobacter coli.

Commercial antisera for serotyping 22 heat-labile antigens of Campylobacter jejuni and Campylobacter coli were evaluated by using 66 isolates from human and nonhuman sources. Test results were compared with results of tests using antisera produced at the Centers for Disease Control (CDC), Atlanta, Ga. All strains (three isolates of each of the 22 serotypes) were typeable with the CDC antisera. Of 66 test strains, 39 (59%) were typed as the same serotype with both sets of antisera. Twenty-four strains (36%), including two heat-labile serotype reference strains, were nonreactive with the commercial antisera, and three strains (4.5%) were typed as serotypes different from those obtained with CDC antisera. Five of the 22 commercial antisera correctly serotyped all homologous strains. Our study indicated that two polyvalent antiserum pools, 7 unabsorbed antisera, and 16 absorbed monovalent antisera are weak and need modification to enhance their antibody titers. Further studies are necessary to explain the antigenic change to a different serotype in three strains.     

Improved biotyping schemes for Campylobacter jejuni and Campylobacter coli.

Campylobacter jejuni (20 strains) and Campylobacter coli (12 strains) were assigned to four biovars for each species based on phenotypic tests that were easy to perform and interpret. The resulting biotyping schemes offer a greater degree of distinction among C. jejuni and C. coli strains than any of the other biotyping schemes previously described for these organisms.     

Fitness of macrolide resistant Campylobacter coli and Campylobacter jejuni

The aim of this study was to investigate the fitness of macrolide resistant Campylobacter coli and Campylobacter jejuni. The in vitro growth, the survival on food matrix, and the in vivo colonization of C. jejuni and C. coli susceptible isolates and their isogenic resistant mutants were studied. In vitro experiments demonstrated that macrolide resistance imposed a fitness cost when the susceptible strains and their isogenic resistant mutants were cultured in competition. When inoculated in food matrix, the resistant C. jejuni mutant was no longer detectable after 3 to 5 days but the susceptible strain remained detectable for over 18 days. No difference in survival in food matrix was observed between susceptible and resistant C. coli. When inoculated in vivo in chickens, the macrolide susceptible and resistant C. coli displayed similar levels of colonization, both in separated inoculations and during competitive assays. Strikingly, when mono-inoculated or co-inoculated into chickens, macrolide susceptible C. jejuni outcompeted the macrolide resistant population. However, a spontaneous mutant that evolved in vivo showed a colonization capacity similar to the susceptible strain. Our findings demonstrate the effect of macrolide resistance on the fitness of Campylobacter but suggest that evolved mutants may be as fit as susceptible strains.     

Cytolethal distending toxin genes in Campylobacter jejuni and Campylobacter coli isolates: detection and analysis by PCR

Campylobacter jejuni produces a toxin called cytolethal distending toxin (CDT). Knowledge of the prevalence and homogeneity of Campylobacter sp. cdt genes is incomplete. In this work, we identified four PCR primer pairs that collectively amplified cdt genes in all of the C. jejuni and Campylobacter coli strains tested. Restriction analyses of the cdt PCR products showed clear differences between the cdt genes of these two species, yet there were few heterogeneities noted between members of the same species. Consequently, it may be possible to speciate C. jejuni and C. coli isolates on the basis of restriction patterns within their cdt genes.     

Comparison of basal media for culturing Campylobacter jejuni and Campylobacter coli.

Four strains of Campylobacter jejuni and four strains of Campylobacter coli were used to compare the quantitative growth of Campylobacter cells on blood agar base no. 2 (Oxoid), brucella agar (BBL Microbiology Systems and Difco Laboratories), campylobacter agar base (Difco), Columbia blood agar base (Difco and Oxoid), and Mueller-Hinton agar (Difco and Oxoid). Columbia blood agar base and blood agar base no. 2 were inhibitory to most of the strains tested, as evidenced by reduced (10- to 1,000-fold) colony counts compared with other basal media. One of the brucella agars was inhibitory to two of the C. coli strains. The inhibitory effect of these media could be eliminated by addition of FBP (0.05% each ferrous sulfate hydrate, sodium metabisulfite, and sodium pyruvate) or 7% defibrinated sheep blood. However, addition of FBP or blood to brucella agar, campylobacter agar base, or Mueller-Hinton agar did not significantly affect the count, indicating that supplements are not required in these media for growth of Campylobacter in pure culture.     

Epidemiology of Campylobacter jejuni/coli

The authors describe the epidemic incidence of diseases caused by Campylobacter jejuni/coli. During the 5-week follow up period (June 1-July 1, 1988) a total of 74 subjects fell sick. In 31 instances the suspect factor of transmission was non-pasteurized cheese prepared from sheep's milk. In this group of patients a significant shift to higher age categories was noted, contrary to the other 43 diseases. It did not prove possible to isolate Campylobacter from cheese, smears from the cottage or from rectal swabs of the workers from the cottage. In an investigation focused on assessment of survival of Campylobacter jejuni/coli in sheep's milk and cheese long-term survival of the microorganism only in non-pasteurized milk was found. The authors assume that cheese becomes contaminated secondarily, by lack of adherence to hygienic rules.     

Naturally occurring auxotrophs of Campylobacter jejuni and Campylobacter coli.

The nutritional requirements for 439 Campylobacter jejuni isolates and 46 Campylobacter coli isolates were determined by using a previously described chemically defined medium, campylobacter defined medium. With this medium, 45% of both human and nonhuman C. jejuni isolates demonstrated auxotrophic requirements. None of the 46 C. coli isolates studied demonstrated requirements for amino acids on campylobacter defined medium. The most common auxotrophic requirement among C. jejuni isolates was for methionine, which was present as a single requirement or in combination with other markers in 21% of human and 28% of nonhuman isolates. There was no correlation between plasmid carriage and auxotype, and a comparison of the Lior serotypes of 472 of the strains showed a correlation only between proline auxotrophs and Lior serotype 11 for strains isolated in the Seattle-King County region.     

Monosaccharide composition of lipopolysaccharides from Campylobacter jejuni and Campylobacter coli

The monosaccharide composition of the LPS from 5 Campylobacter jejuni strains and 7 Campylobacter coli strains has been studied. All LPS's contained KDO, heptose, glucosamine, glucose, and (with one exception) galactose. All C. jejuni and 3 C. coli LPS's contained greater than 1% galactosamine. 3-Amino-3.6-dideoxyglucose was present in all but one C. coli LPS and in only one C. jejuni LPS.     

Confirmed identification and toxin profiling of Campylobacter jejuni using a thermostabilized multiplex PCR formulation

Cytolethal distending toxin (CDT) producing Campylobacter jejuni species are one of the leading causes of human gastroenteritis worldwide. The main intent of the study was to develop a multiplex PCR assay for the confirmed identification and toxin profiling of C. jejuni. The genes targeted were rpo B as genus specific, hip O for species; cdt A, cdt B, cdt C encoding respective subunit proteins of CDT with Internal Amplification Control (IAC). To enhance its application as a pre‐mixed ready‐to‐use format, the master mix of developed mPCR was dried by lyophilization and stability was assessed. Thermostabilized reagents showed stability of 1.5 months at room‐temperature and upto six months at 4 °C without any loss of functionality. The assay was evaluated on a number of presumptive Campylobacter isolates along with biochemical tests. Results obtained indicated the accurate identification of C. jejuni by developed mPCR format in contrast to misconception associated with biochemical assays. The assay was also tested on spiked samples for its real‐time utility. Altogether, the room‐temperature storable and ready‐to‐ use mPCR format developed in this study could be preferred for rapid detection and confirmed identification of toxigenic strains of C. jejuni in place of conventional biochemical assays.     

Use of culture, PCR analysis, and DNA microarrays for detection of Campylobacter jejuni and Campylobacter coli from chicken feces

A DNA microarray for detection of Campylobacter spp. was recently developed and applied to detect Campylobacter spp. directly from chicken feces. Sixty-five pooled chicken cloacal swab samples from 650 individual broiler chickens were included in the study. The results of Campylobacter sp. detection obtained with DNA microarrays were compared to those obtained by conventional culture and gel electrophoresis. By conventional culture, 60% of the samples were positive for either Campylobacter jejuni or Campylobacter coli. By PCR and capillary electrophoresis, 95% of the samples were positive for Campylobacter spp., whereas with DNA microarrays all samples were positive for Campylobacter spp. By application of DNA microarray analysis, the isolates in 4 samples (6%) could not be identified to the species level, whereas by PCR-capillary electrophoresis, the isolates in 12 samples (19%) remained unidentified. Interestingly, PCR-capillary electrophoresis analysis revealed that two (3%) of the samples were positive for both C. jejuni and C. coli, while DNA microarray analysis revealed that nine (14%) of the samples were positive for both species. Of 65 samples, 2 samples were identified to contain C. coli by conventional culture but were positive for C. jejuni by both PCR-capillary electrophoresis and DNA microarray analysis. The discrepancy between the methods is discussed.     

Development of a bacteriophage typing system for Campylobacter jejuni and Campylobacter coli.

A bacteriophage typing system for Campylobacter jejuni and Campylobacter coli was developed with phages isolated from poultry feces. Data for phage selection were generated from a set of isolates of C. jejuni and C. coli from humans in Illinois. Selection of 14 phages from the 47 phages available was assisted by determination of the Sneath-Jaccard similarity coefficients and subsequent unweighted pair-group arithmetic averaging cluster analysis. The typing set was reproducible and stable in the 255 isolates from Illinois. Of these isolates, 94.5% were typable, with 46% represented by the four most common phage patterns. In a set of 51 isolates from humans outside of Illinois, 88.1% of the C. jejuni isolates were typable. Phage typing for C. jejuni and C. coli has excellent epidemiologic potential and should serve as a useful adjunct or alternative to serotyping systems in current use.     

Fitness cost of fluoroquinolone resistance in Campylobacter coli and Campylobacter jejuni

In this study, the fitness cost of fluoroquinolone resistance was evaluated in vitro, on food matrices, and in vivo, using Campylobacter coli and Campylobacter jejuni in vitro selected mutants. In vitro, the growth rate of the susceptible (wild type) and resistant (mutant) strains did not differ when cultured separately. However, by conducting sequential passages of mixed cultures, the ratio of the resistant mutant to the susceptible strain decreased for C. coli but not for C. jejuni. When the wild type and the mutant were co-inoculated on food matrices, mutants were no longer detectable 3 to 5 days after artificial contamination, but the wild-type strains remained detectable for over 13 days. In mono-inoculated animals, no difference was observed between wild-type and mutant fecal titers. When co-inoculated into chickens, the susceptible strain outcompeted the resistant mutant for C. coli and for C. jejuni. However, for C. coli, if the resistant strain was already present in animals, it could persist at high titers in the digestive tract even in the presence of the wild-type strain. Together, these findings suggest that, depending on strain and study conditions, fluoroquinolone resistance can impose a fitness cost on Campylobacter.     

Serotyping of Campylobacter jejuni/coli.

Antisera were prepared from strains of Campylobacter jejuni/coli isolated from patients in six outbreaks of enteritis. Bactericidal antibodies, and agglutinating antibodies to heat-labile and heat-stable antigens, were demonstrated. These reactions were used to type a number of strains isolated from patients in each outbreak, and to distinguish 'epidemic' from 'non-epidemic' strains.