Mutational spectrum of the CTNS gene in Italy

Classic nephropathic or infantile cystinosis (NC) is an autosomal recessive disorder; the gene coding for the integral membrane protein cystinosin, which is responsible for membrane transport of cystine (CTNS), was cloned. Mutation analysis of the CTNS gene of Caucasian patients revealed a common 57-kb deletion, and several other mutations spread throughout the entire gene. In the present study, we report the CTNS mutations identified in 42 of 46 Italian families with NC. The percentage of mutations characterized in this study is 86%. The mutational spectrum of the Italian population is different from that of populations of North European origin: the 57-kb deletion is present in a lower percentage, while the splicing mutations represent 30% of mutation detected in our sample. In all, six novel mutations have been identified, and the origin of one recurrent mutation has been traced.     

Mutational spectrum of Korean patients with corneal dystrophy

Corneal dystrophy typically refers to a group of rare hereditary disorders with a heterogeneous genetic background. A comprehensive molecular genetic analysis was performed to characterize the genetic spectrum of corneal dystrophies in Korean patients. Patients with various corneal dystrophies underwent thorough ophthalmic examination, histopathologic examination, and Sanger sequencing. A total of 120 probands were included, with a mean age of 50 years (SD = 18 years) and 70% were female. A total of 26 mutations in five genes (14 clearly pathogenic and 12 likely pathogenic) were identified in 49 probands (41%). Epithelial–stromal TGFBI dystrophies, macular corneal dystrophy and Schnyder corneal dystrophy (SCD) showed 100% mutation detection rates, while endothelial corneal dystrophies showed lower detection rates of 3%. Twenty six non‐duplicate mutations including eight novel mutations were identified and mutations associated with SCD were identified genetically for the first time in this population. This study provides a comprehensive characterization of the genetic aberrations in Korean patients and also highlights the diagnostic value of molecular genetic analysis in corneal dystrophies.     

Mutational spectrum in German patients with phenylalanine hydroxylase deficiency

We report on the spectrum and frequency of mutations in the phenylalanine hydroxylase (PAH) gene in 226 German families with PAH deficiency, most of them from Southern Germany. A total of 88 mutations were identified in 428 out of 438 mutant PAH alleles including one novel stop mutation L293X (c.878T>A). In three families, two phenylketonuria (PKU) mutations were found in cis, and in one family a de novo mutation was observed. A comparison of the results from Southern Germany with those of other parts of Western Germany showed no obvious local mutation clustering. In addition we studied the genotypic spectrum of 39 Turkish families with PAH deficiency. Twenty-three mutations were identified in 73 out of 75 Turkish chromosomes including two novel mutations: E280A (c.839A>G) in Exon 7 and IVS10-7C>A (c.1066-7C>A) in Intron 10. A new polymorphism IVS4+47C/T (c.441+47C>T) was found in mutant and normal PAH alleles. Screening of 170 German and 150 Turkish individuals without family history of PAH deficiency revealed 10 and 12 heterozygotes, respectively, a higher frequency of carriers than expected. A novel mutations of uncertain functional relevance, R169H (c.506G>A) in Exon 5 was found in two Turkish heterozygotes. Most of the Turkish heterozygotes carried mild mutations, indicating that mild forms of PAH deficiency may be more common in that population than previously recognised.     

Mutational spectrum in the Ca(2+)--activated cation channel gene TRPM4 in patients with cardiac conductance disturbances

Very recently, mutations in the TRPM4 gene have been identified in four pedigrees as the cause of an autosomal dominant form of cardiac conduction disease. To determine the role of TRPM4 gene variations, the relative frequency of TRPM4 mutations and associated phenotypes was assessed in a cohort of 160 unrelated patients with various types of inherited cardiac arrhythmic syndromes. In eight probands with atrioventricular block or right bundle branch block--five familial cases and three sporadic cases--a total of six novel and two published TRPM4 mutations were identified. In patients with sinus node dysfunction, Brugada syndrome, or long-QT syndrome, no mutations were found. The novel mutations include six amino acid substitutions and appeared randomly distributed through predicted TRPM4 protein. In addition, eight polymorphic sites including two in-frame deletions were found. Mutations separated from polymorphisms by absence in control individuals and familial cosegregation in some families. In summary, TRPM4 gene mutations appear to play a major role in cardiac conduction disease but not for other related syndromes so far. The phenotypes are variable and clearly suggestive of additional factors modulating the disease phenotype in some patients.     

Mutational analysis of the NPHP4 gene in 250 patients with nephronophthisis

Nephronophthisis (NPH), a recessive cystic kidney disease, is the most frequent genetic cause for end-stage renal disease in the first two decades of life. Mutations in three genes (NPHP1, 2, and 3) were identified as causative. Extrarenal manifestations are known, such as retinitis pigmentosa (Senior-Loken syndrome, SLS) and ocular motor apraxia type Cogan. Recently, we identified a novel gene (NPHP4) as mutated in NPH. To date, a total of only 13 different NPHP4 mutations have been described. To determine the frequency of NPHP4 mutations, we performed mutational analysis by direct sequencing of all 30 NPHP4 exons in 250 different patients with isolated NPH, SLS, or Cogan syndrome ascertained worldwide over 14 years. We identified 23 novel NPHP4 sequence variants in 26/250 different patients (10%). Interestingly, we detected homozygous or compound heterozygous mutations of NPHP4 in only 6/250 different patients (2.4%), but only one heterozygous NPHP4 sequence variant in 20/250 different patients (8%). In the six patients with two NPHP4 mutations, 5/8 mutations (63%) were likely loss-of-function mutations, whereas in the 20 patients with only one sequence variant, only 1/20 (5%) was a likely loss-of-function (i.e., truncating) mutation. We conclude that: i) two recessive mutations in NPHP4 are a rare cause of nephronophthisis; ii) single heterozygous NPHP4 sequence variants are three times more prevalent than two recessive mutations; iii) there is no genotype/phenotype correlation; iv) there must exist further genes causing nephronophthisis, since in 224/250 (90%) patients, no sequence variants in either of the four NPH genes were detected.     

Mutational spectrum of type I collagen genes in Korean patients with osteogenesis imperfecta

Mutations in the type I collagen genes COL1A1 and COL1A2 are responsible for the dominantly inherited connective tissue disorder osteogenesis imperfecta (OI). The severity of OI is diverse, ranging from perinatal lethality to a very mild phenotype that is characterized by normal stature and the absence of deformities. Although there have been several studies on the mutational spectra of COL1A1 and/or COL1A2 in Western populations, very few cases have been reported from Asia. In this study, we investigated 67 unrelated Korean probands with OI and used nucleotide sequence analysis to detect COL1A1 and COL1A2 mutations. Thirty-five different mutations were identified in the two genes, including 24 novel mutations. Among the 35 kinds of detected mutations, 15 were glycine substitutions (seven in COL1A1 and eight in COL1A2), one was a nonsense mutation, four were frameshift mutations in COL1A1, three were in-frame duplications in COL1A2, and 12 were splice site mutations (seven in COL1A1 and five in COL1A2). Until now, mutations in the COL1A1 and COL1A2 genes known to cause OI were unique and rarely repeated in other families. Interestingly, the c.982G>A (p.Gly328Ser) mutation in COL1A2 was found recurrently and was the causative mutation in five independent OI probands. Haplotype analysis of the COL1A2 gene revealed that four probands from five independent OI probands with c.982G>A (p.Gly328Ser) had a common haplotype. Our clinical data showed the heterogeneity even within a specific genotype, which suggested the complex expression of this disease.     

Mutational analysis of the HGO gene in Finnish alkaptonuria patients

Alkaptonuria (AKU), the prototypic inborn error of metabolism, has recently been shown to be caused by loss of function mutations in the homogentisate-1,2-dioxygenase gene (HGO). So far 17 mutations have been characterised in AKU patients of different ethnic origin. We describe three novel mutations (R58fs, R330S, and H371R) and one common AKU mutation (M368V), detected by mutational and polymorphism analysis of the HGO gene in five Finnish AKU pedigrees. The three novel AKU mutations are most likely specific for the Finnish population and have originated recently.     

Mutational analysis of the tuberous sclerosis gene TSC2 in patients with pulmonary lymphangioleiomyomatosis

Pulmonary lymphangioleiomyomatosis (LAM) is a rare disorder limited almost exclusively to women of reproductive age. LAM affects about 5% of women with tuberous sclerosis complex (TSC). LAM also occurs in women who do not have TSC (sporadic LAM). TSC is a tumour suppressor gene syndrome characterised by seizures, mental retardation, and tumours in the brain, heart, and kidney. Angiomyolipomas, which are benign tumours with smooth muscle, fat, and dysplastic vascular components, are the most common renal tumour in TSC. Renal angiomyolipomas also occur in 63% of sporadic LAM patients. We recently found that 54% of these angiomyolipomas have TSC2 loss of heterozygosity, leading to the hypothesis that sporadic LAM is genetically related to TSC. In this study, we screened DNA from 21 women with sporadic LAM for mutations in all 41 exons of TSC2. Twelve of the patients had known renal angiomyolipomas. No TSC2 mutations were detected. We did find three silent TSC2 polymorphisms. We conclude that patients with sporadic LAM, including those with renal angiomyolipomas, do not have a high frequency of germline mutations in the coding region of TSC2.     

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.     

Mutational spectrum of the TSC1 gene in a cohort of 225 tuberous sclerosis complex patients: no evidence for genotype-phenotype correlation

Tuberous sclerosis complex is an inherited tumour suppressor syndrome, caused by a mutation in either the TSC1 or TSC2 gene. The disease is characterised by a broad phenotypic spectrum that can include seizures, mental retardation, renal dysfunction, and dermatological abnormalities. The TSC1 gene was recently identified and has 23 exons, spanning 45 kb of genomic DNA, and encoding an 8.6 kb mRNA. After screening all 21 coding exons in our collection of 225 unrelated patients, only 29 small mutations were detected, suggesting that TSC1 mutations are under-represented among TSC patients. Almost all TSC1 mutations were small changes leading to a truncated protein, except for a splice site mutation and two in frame deletions in exon 7 and exon 15. No clear difference was observed in the clinical phenotype of patients with an in frame deletion or a frameshift or nonsense mutation. We found the disease causing mutation in 13% of our unrelated set of TSC patients, with more than half of the mutations clustered in exons 15 and 17, and no obvious under-representation of mutations among sporadic cases. In conclusion, we find no support for a genotype-phenotype correlation for the group of TSC1 patients compared to the overall population of TSC patients.     

Mutational spectrum in Usher syndrome type II

Usher syndrome type II is an autosomal recessive disorder characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa (RP). We carried out a mutation screening of the USH2A gene in 88 probands with Usher syndrome type II to determine the frequency of USH2A mutations as a cause for USH2. Six mutations, including 2299delG, 921-922insCAGC, R334W, N346H, R626X, and N357T were identified, with 2299delG mutation being the most frequent (16.5% of alleles), accounting for 77.5% of the pathologic alleles. Thirty-five percent (31/88) of the probands had a USH2A mutation. Nine of them carried two pathogenic mutations: six cases were homozygotes and three were compound heterozygotes. Twenty-two probands (25%) were found to carry only single USH2A mutations. One new missense mutation (N357T) occuring within the laminin N-terminal (type VI) domain of usherin was identified. Eight polymorphisms were found, five of which are novel. Our data support the view that the 2299delG is the most common mutation in USH2A.     

Mutational screening of APP gene in patients with early-onset Alzheimer disease utilizing mismatched PCR-RFLP

To elucidate the frequency of mutations of the β/A4 amyloid protein precursor (APP) gene in early-onset Alzheimer disease, we designed a mismatched PCR-RFLP that can identify all kinds of missense mutations at codon 717 in addition to the seven kinds of known mutations at exon 17. When we screened mutations at exon 17 utilizing this method and the double missense mutations at exon 16 of the APP gene by PCR-RFLP, no cases revealed mutations of the APP gene among 13 familial and 54 sporadic cases, except one family (OS-1) that had previously been reported and used as a positive control of APP717(Val → Ile). Our results support the hypothesis that mutations in the APP gene are not major causes in early-onset Alzheimer disease.     

Mutational screening of the RB1 gene in Italian patients with retinoblastoma reveals 11 novel mutations

Retinoblastoma (RB, OMIM#180200) is the most common intraocular tumour in infancy and early childhood. Constituent mutations in the RB1 gene predispose individuals to RB development. We performed a mutational screening of the RB1 gene in Italian patients affected by RB referred to the Medical Genetics of the University of Siena. In 35 unrelated patients, we identified germline RB1 mutations in 6 out of 9 familial cases (66%) and in 7 out of 26 with no family history of RB (27%). Using the single-strand conformational polymorphism (SSCP) technique, 11 novel mutations were detected, including 3 nonsense, 5 frameshift and 4 splice-site mutations. Only two of these mutations (1 splice site and 1 missense) were previously reported. The mutation spectrum reflects the published literature, encompassing predominately nonsense or frameshift and splicing mutations. RB1 germline mutation was detected in 37% of our cases. Gross rearrangements outside the investigated region, altered DNA methylation, or mutations in non-coding regions, may be the cause of disease in the remainder of the patients. Some cases, e.g. a case of incomplete penetrance, or variable expressivity ranging from retinoma to multiple tumours, are discussed in detail. In addition, a case of pre-conception genetic counselling resolved by rescue of banked cordonal blood of the affected deceased child is described.