Identification and characterization of the human type II collagen gene (COL2A1).

The gene contained in the human cosmid clone CosHcol1, previously designated an alpha 1(I) collagen-like gene, has now been identified. CosHcol1 hybridizes strongly to a single 5.9-kilobase mRNA species present only in tissue in which type II collagen is expressed. DNA sequence analysis shows that this clone is highly homologous to the chicken alpha 1(II) collagen gene. These data together suggest that CosHcol1 contains the human alpha 1(II) collagen gene COL2A1. The clone appears to contain the whole gene (30 kilobases in length) and will be extremely useful in the study of cartilage development and for identifying those inherited chondrodystrophies in which defects occur in this gene.     

Identification of a retinoid receptor response element in the human aldehyde dehydrogenase-2 promoter

BACKGROUND: The human aldehyde dehydrogenase-2 promoter contains sites that bind members of the nuclear receptor family, and one (designated FP330-3') is predicted to bind retinoic acid receptors. METHODS: Binding of retinoid receptors to the FP330-3' oligonucleotide duplex and point mutations thereof was assayed using electrophoretic mobility shift assays. The function of the promoter element was determined in transfection assays. RESULTS: Heterodimers of retinoic acid receptor (RAR)alpha, beta, and gamma with retinoid X receptor (RXR)alpha bound the FP330-3' site. Mutagenesis of the FP330-3' site suggested that either the upstream DR-5 or downstream DR-1 could mediate binding of RAR/RXR. FP330-3' oligonucleotide duplexes were not bound by in vitro translated RXR homodimers but weakly competed with a synthetic DR-1 oligonucleotide duplex for binding by RXR. A reporter construct carrying four copies of the FP330-3' element was induced by cotransfection of rat hepatoma cells with a construct encoding RARalpha, when the RAR-specific ligand AM580 was present. Each of the three RXR isoforms alpha, beta, and gamma stimulated the expression of reporter constructs containing the FP330-3' sites in a 9-cis retinoic acid-dependent fashion in cells in culture. This was confirmed in the case of RXRalpha using the RXR-specific ligand methoprene. CONCLUSION: The human aldehyde dehydrogenase-2 promoter contains a retinoid response element, which may contribute to regulation of the gene.     

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.