Chlamydia trachomatis Serovar Distribution and Neisseria gonorrhoeae Coinfection in Male Patients with Urethritis in Greece

The distribution of Chlamydia trachomatis serovars and Neisseria gonorrhoeae coinfection was studied in a group of 100 C. trachomatis-positive males with urethritis in Greece. The serovar distribution revealed that apart from the predominant worldwide types E and F, the relatively uncommon type G is also prevalent. Gonococcal coinfection was frequent (30%) and was associated with genovariant Ja (75%, P = 0.008).Chlamydia trachomatis is the leading cause of bacterial sexually transmitted diseases (STDs) in industrialized countries, producing infections of the upper and lower genital tract in males and females, including urethritis, epididymitis, and proctitis in males (7, 9, 14, 19). Currently, more than 18 different serovars of the organism have been identified based on conventional serotyping, while more than 29 variants have been recognized by employing monoclonal antibodies or genotypic methods (1, 15).The knowledge of the distribution profile of C. trachomatis urogenital serovars has been the focus of several studies in different regions worldwide, since it provides valuable information about their epidemiology and pathogenicity that contributes to the implementation of sufficient STD control measures. The most common serovar detected worldwide is E (up to 22 to 49% of cases) followed by serovars F and D (17 to 22% and 9 to 19%, respectively), while other serovars are less frequently identified (1, 10, 12, 15, 16, 17).No data are available in Southern European countries, such as Greece, about the circulating C. trachomatis serovars among either general or specific populations, apart from a previous study in Italy that examined the C. trachomatis serovar distribution in a group of male patients with urethritis (4). The C. trachomatis serovars D through K, including the serovars Da and Ia and the genovariant Ja, are related to genital tract disease (2). Moreover, on a worldwide basis, although concomitant infection with Neisseria gonorrhoeae and C. trachomatis is well established and frequent according to epidemiological data (3, 5, 11, 20), very little is known about the molecular biology-based identification of N. gonorrhoeae coexisting infection and its association with C. trachomatis serovars.The objectives of this study were to provide novel data regarding the C. trachomatis serovar distribution in this specific geographical area, by examining a specific group of symptomatic male patients with C. trachomatis urethritis living in Greece, and also to investigate the presence of N. gonorrhoeae coinfection by employing molecular methods and to discover any possible links of N. gonorrhoeae coinfection with particular C. trachomatis serovars.(This study was presented in part at the 18th European Congress of Clinical Microbiology and Infectious Diseases, Barcelona, Spain, 19 to 22 April 2008.)The first 100 C. trachomatis-infected males who consecutively presented at the outpatient clinic of the Andreas Sygros Hospital for Skin and Venereal Diseases in Athens during the period 2006-2007 were included in the study. All of them presented clinical signs and symptoms of acute urethritis defined as follows: presence of urethral discharge and/or dysuria in combination with the detection of five or more polymorphonuclear leukocytes per high-power field on the intraurethral swab specimen. Primary demographic, epidemiological, and clinical data were recorded for each patient. The protocol of the study was reviewed and approved by the ethics committee of the hospital.Conventional detection of N. gonorrhoeae on intraurethral swabs was performed using Gram staining and culture on Thayer-Martin medium. Molecular detection of both C. trachomatis and N. gonorrhoeae on intraurethral swabs was performed using the C. trachomatis/N. gonorrhoeae Cobas Amplicor system (Roche Inc., Branchburg, NJ).Chlamydial serovar assignment was performed after PCR amplification and DNA sequencing of the C. trachomatis omp1 gene, as previously described (2). PCR products were purified using the GFX PCR DNA and gel band purification kit (Amersham Biosciences UK Ltd., Little Chalfont, Buckinghamshire, United Kingdom), and sequencing was performed with the internal primers in an ABI 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA). Partial sequences were aligned using the DAMBE 4.2 software (21); a consensus sequence for the whole omp1 gene of each strain was obtained and compared with available sequences in GenBank.Statistical analysis was performed using the SPSS 13.0 statistical software. Chi-square and Fisher''s exact tests were used for the comparisons of proportions. A P value of ≤0.05 was considered to be statistically significant. A multiple logistic regression analysis was conducted in order to estimate the independent risk factors associated with N. gonorrhoeae coinfection.The main demographic and epidemiological data of the total participants are presented in Table ​Table1.1. Types E and G were the most common, being detected in 37% and 23% of the participants, respectively. Types F, Ja, and D were identified in lower percentages of the patients (14%, 12%, and 10%, respectively), while 4% of patients had an infection due to type B. Mixed C. trachomatis infections were not identified. No differences in demographic, epidemiological, and clinical characteristics were established among patients infected by different C. trachomatis serovars.

TABLE 1.

Primary demographic, epidemiological, and clinical data for the 100 patients diagnosed with C. trachomatis urethritis

Evaluation of the New Vitek 2 ANC Card for Identification of Medically Relevant Anaerobic Bacteria

Of 261 anaerobic clinical isolates tested with the new Vitek 2 ANC card, 257 (98.5%) were correctly identified at the genus level. Among the 251 strains for which identification at the species level is possible with regard to the ANC database, 217 (86.5%) were correctly identified at the species level. Two strains (0.8%) were not identified, and eight were misidentified (3.1%). Of the 21 strains (8.1%) with low-level discrimination results, 14 were correctly identified at the species level by using the recommended additional tests. This system is a satisfactory new automated tool for the rapid identification of most anaerobic bacteria isolated in clinical laboratories.Accurate identification of numerous bacterial species is nowadays possible with highly automated systems that are increasingly used in clinical laboratories because of their cost effectiveness, practicability, and ability to provide rapid turnaround time. It is now well established that anaerobes may be involved in numerous infections, including severe infections (8, 12). Until recently, however, identification of anaerobes in clinical laboratories relied mainly on the use of time-consuming and labor-intensive conventional methods or of manual commercial systems, the performances of which are quite variable at the species level (3, 5, 7, 10, 13, 14).bioMérieux (Marcy, France) has recently developed a new colorimetric identification card (ANC card) which, in conjunction with the Vitek 2 system, permits this automated and widely distributed identification system to identify 63 taxa, including 49 taxa of anaerobic bacteria belonging to the genera Actinomyces, Bacteroides, Bifidobacterium, Clostridium, Collinsella, Eggerthella, Eubacterium, Finegoldia, Fusobacterium, Parabacteroides, Parvimonas, Peptoniphilus, Peptostreptococcus, Prevotella, Propionibacterium, and Veillonella. It is noteworthy that this system identifies Bifidobacterium spp. and Veillonella spp. only at the genus level. In the present study, the ANC card was evaluated for the identification of anaerobes in a routine clinical laboratory.A total of 261 nonconsecutive clinical isolates belonging to 43 medically relevant taxa included in the ANC database and collected over a 1-year period in our laboratory were used. Strains were selected to represent the distribution of anaerobic isolates recovered annually in our laboratory. These organisms have been previously identified using conventional reference identification methods (6). The sources of the isolates included blood (n = 102), central nervous system samples (n = 9), pleuropulmonary samples (n = 11), intra-abdominal samples (n = 54), soft tissue samples (n = 29), osteoarticular samples (n = 14), urogenital samples (n = 11), stool samples (n = 20), and various other samples (n = 11). Actinomyces israelii ATCC 12102, Propionibacterium acnes ATCC 6919, and Clostridium difficile ATCC 9689 were also investigated. Bacteroides ovatus ATCC BAA-1296, Bacteroides vulgatus ATCC 8482, Parabacteroides distasonis ATCC BAA-1295, Clostridium septicum ATCC 12464, and Clostridium sordellii ATCC 9714 were used as quality controls and checked every month during the evaluation. Isolates were stored frozen, except for the available clinical isolates that were recovered directly from clinical specimens. Prior to testing, strains were subcultured twice onto Columbia sheep blood agar (bioMérieux) in an anaerobic atmosphere at 35°C. Inoculum preparation, incubation (approximately 6 h), and reading of the test panels were performed according to the manufacturer''s instructions. Data were analyzed using the Vitek 2 ANC system software, which permits categorization of the results into four groups: correct identification (i.e., unambiguous identification [given as excellent, very good, good, or acceptable] to the species level or to the genus level for Bifidobacterium spp. and Veillonella spp. strains), low level of discrimination (low level of discrimination between two or more species, including the correct species, requiring additional tests), misidentification (the genus or the species identified with the ANC card was different from that identified using the reference methods), and no identification (strains without results). In the case of discrepancy between the identification obtained with the routine method and that obtained with the Vitek 2 system, 16S rRNA gene sequencing was used for genetic identification (1).The quality control strains were always correctly identified, with the test results being reproducible and in accordance with those expected from the database previously established by bioMérieux. The other three reference strains tested were correctly identified at the species level. Among the 261 routine clinical isolates tested, 257 (including all Bifidobacterium spp. and Veillonella spp. strains [n = 10], which can only be identified at the genus level with the ANC card) of 261 (98.5%) were correctly identified at the genus level and 217 of 251 (86.5%) at the species level without performing additional tests (Table ​(Table1).1). Two strains (0.8%) were not identified, and eight (3.1%) were misidentified (Table ​(Table2).2). Of the 121 gram-negative strains, 114 (94.3%) were correctly identified without further testing and 3 (2.5%), which gave low-level discrimination results, were identified with additional tests (Table ​(Table3).3). Among the 140 gram-positive isolates, 80.7% (100% of the cocci, 95.7% of the nonsporeforming bacilli, and 64.3% of the clostridia) were correctly identified at the species level without further testing. Of the 21 Clostridium species that gave low-level-discrimination identifications, 14 were correctly identified by using recommended additional tests, while 7 (5 C. butyricum and 2 C. difficile) could be easily identified by using other supplementary tests (Table ​(Table3).3). Indeed, a simple Gram stain permitted us to differentiate C. butyricum (gram-positive straight rod with subterminal spore) from C. clostridioforme (cigar-shaped gram-negative rod), while C. difficile could be differentiated from C. subterminale by determining the fermentation of glucose and mannitol. Thus, the use of additional tests other than those recommended by the manufacturer permitted an increase in the rate of correct identification of clostridia from 84.3% to 94.3%.

TABLE 1.

Identification of 261 clinical anaerobic isolates with the Vitek 2 ANC card

Potency of Anidulafungin Compared to Nine Other Antifungal Agents Tested against Candida spp., Cryptococcus spp., and Aspergillus spp.: Results from the Global SENTRY Antimicrobial Surveillance Program (2008)

The SENTRY Antimicrobial Surveillance Program regularly monitors global susceptibility rates for a spectrum of both novel and established antifungal agents. Anidulafungin and the other echinocandins displayed sustained, excellent activity against Candida spp. and Aspergillus fumigatus, with ≥98% of MIC results at ≤2 μg/ml. Six yeast isolates (all Candida glabrata) showing caspofungin MIC values of ≥0.5 μg/ml were further analyzed for potential fks hot spot (HS) mutations; three isolates had confirmed mutations in the fks1 HS1 region (S645P), and three exhibited mutations in the fks2 HS1 region (S645F and S645P).Opportunistic fungal infections are increasing in incidence (18) and are associated with high rates of morbidity and mortality (1, 11, 13). The rise in prevalence of individuals with short-term neutropenia (cancer patients undergoing chemotherapy regimens), long-term immunosuppression (organ transplant patients), immune system disorders (patients with HIV/AIDS), or central venous catheters has coincided with the increased occurrence of problematic opportunistic fungal infections (11). At this time, only a limited number of azole and echinocandin antifungal agents are available for therapeutic intervention against these infections.Anidulafungin (9, 14-17) is a novel semisynthetic agent that targets cell wall structural integrity via noncompetitive inhibition of β-1,3-d-glucan synthesis, resulting in cell rupture and death. Excellent broad-spectrum in vitro and in vivo activities against a variety of fungal pathogens have been demonstrated (16). We present here contemporary data (2008) from the global SENTRY Antimicrobial Surveillance Program comparing the activity of anidulafungin to those of nine additional antifungal agents by use of reference methods (5-7).A collection of 1,201 clinical yeasts from bloodstream infections (BSI) and 79 molds from pneumonias (lower respiratory tract infections [LRTI]) in the United States, Europe, Latin America, and the Asia-Pacific region (APAC) was processed by Clinical and Laboratory Standards Institute (CLSI) methods and included (in rank order) Candida albicans (587 isolates), C. glabrata (218), C. parapsilosis (196), C. tropicalis (126), C. krusei (24), C. lusitaniae (19), C. dubliniensis (12), C. guilliermondii (4), C. kefyr (4), C. famata (3), C. rugosa (2), C. haemulonii (1), C. inconspicua (1), C. lambica (1), C. norvegensis (1), C. pelliculosa (1), and C. sake (1). The collection also included Cryptococcus neoformans (43 isolates), Aspergillus fumigatus (60), and 19 other molds (data not shown: Aspergillus flavus [3], Aspergillus niger [3], Fusarium spp. [4], Penicillium spp. [3], Rhizopus spp. [2], Bipolaris sp. [1], and Mucor sp. [1], as well as 2 molds not identified to the species level). Laboratories were instructed to submit unique BSI and LRTI isolates obtained in consecutive order, allowing prevalence of the fungal isolates in participating centers to be determined.All fungal isolates were identified at the participant''s medical center by established laboratory methods in use at each institution and confirmed at the central reference laboratory (JMI Laboratories, North Liberty, IA) using Vitek (bioMerieux, Hazelwood, MO) and conventional reference procedures (12, 19). All yeasts were tested by broth microdilution using the CLSI M27-A3 (5) standardized reference method. Preparation of inocula for molds followed procedures described in the CLSI M38-A2 reference method for filamentous fungi (7). Quality control (QC) isolates C. krusei ATCC 6258 and C. parapsilosis ATCC 22019 were used, and all QC results were within published ranges (6).Anidulafungin and voriconazole (Pfizer, Inc., New York, NY), amphotericin B, fluconazole, itraconazole, ketoconazole, and flucytosine (Sigma Chemical Co., St. Louis, MO), caspofungin (Merck Research Laboratories, Rahway, NJ), micafungin (Astellas Toyama Co., Ltd., Toyama, Japan), and posaconazole (Schering-Plough Research Institute, Kenilworth, NJ) were obtained as standard powders and prepared according to CLSI guidelines (5-7). The final concentration ranges (in μg/ml) were as follows: for anidulafungin, 0.001 to 32; for caspofungin and micafungin, 0.008 to 16; for amphotericin B, 0.12 to 8; for flucytosine and fluconazole, 0.5 to 64; for itraconazole, 0.015 to 2; and for posaconazole, voriconazole, and ketoconazole, 0.06 to 8. Antifungal dilution testing ranges were selected for maximal capture of MIC₅₀ and MIC₉₀ wild-type and mutant populations, including expanded ranges for newer and investigational agents to detect organism populations exhibiting potential resistance to these compounds. MIC values (yeasts and molds) and 90% minimal effective concentrations (MEC₉₀) (echinocandins, molds only) were determined as described in the CLSI reference methods (5, 7).Table ​Table11 displays the in vitro activities of 10 antifungal agents tested against yeast BSI isolates collected from the 2008 SENTRY Program. Anidulafungin was the most active agent against (MIC₉₀ in μg/ml) C. albicans (0.06), C. glabrata (0.12), C. tropicalis (0.06), and C. krusei (0.12) and was less potent against C. parapsilosis (MIC₉₀, 2 μg/ml) and C. guilliermondii (data not shown). The echinocandin potency against A. fumigatus was greatest for anidulafungin (MEC₉₀, 0.002 μg/ml) and caspofungin (MEC₉₀, 0.008 μg/ml) (Table ​(Table1).1). The results demonstrate the expanded utility of these agents against the most common mold species identified in lower respiratory tract infections.

TABLE 1.

In vitro activities of anidulafungin and nine other selected antifungal agents tested against yeast BSI isolates and mold LRTI isolates from the 2008 SENTRY Antimicrobial Surveillance Program (North America, Latin America, Europe, and Asia-Pacific region)

Activity of Contemporary Antifungal Agents,Including the Novel Echinocandin Anidulafungin,Tested against Candida spp., Cryptococcus spp., and Aspergillus spp.: Report from the SENTRY Antimicrobial Surveillance Program (2006 to 2007)

Results from the SENTRY international fungal surveillance program for 2006 to 2007 are presented. A total of 1,448 Candida sp., 49 Aspergillus fumigatus, and 33 Cryptococcus neoformans isolates were obtained from infected sterile-site sources in patients on five continents. Reference susceptibility was determined for anidulafungin, caspofungin, 5-flucytosine, fluconazole, itraconazole, posaconazole, voriconazole, and amphotericin B by CLSI methods.The implementation of standardized antifungal testing methods for Candida spp. and Cryptococcus spp.(1, 2) and the recent development of testing methods for the filamentous fungi (3, 4) have facilitated the generation of meaningful data to detect and assess resistance to the current clinical armamentarium of antifungal agents. The use of these methods in global longitudinal surveillance programs has been useful in detecting emerging, rarely encountered yeast or mold organisms displaying decreased susceptibility to contemporary antifungal compounds (12, 16) and for monitoring the distribution of yeast and mold species with innate resistance profiles.We summarize here the results of the global SENTRY Antimicrobial Surveillance Program (2006 to 2007) comparing the activities of eight currently marketed antifungal agents tested against clinical isolates from North America, Europe, Latin America, and the Asia-Pacific (APAC) region, with susceptibilities interpreted by using established CLSI breakpoint criteria, where available (1, 3).The collection of yeasts included Candida albicans (771 isolates), C. parapsilosis (238 isolates), C. glabrata (202 isolates), C. tropicalis (157 isolates), C. krusei (29 isolates), C. lusitaniae (14 isolates), C. guilliermondii (9 isolates), C. dubliniensis (7 isolates), C. famata (6 isolates), C. kefyr (5 isolates), and C. pelliculosa (4 isolates). The collection also included C. neoformans (33 isolates), and of the 61 molds, only Aspergillus fumigatus (49 isolates) is represented. All yeast and mold isolates were identified at the participating medical centers by the established methods in use at each institution. Isolates were requested to be from bloodstream infections, taken in consecutive order, and limited to one isolate per patient. The rates of occurrence in participating laboratories could then be detected by a prevalence mode. Confirmation of species identification was performed at the central reference laboratory by using Vitek (bioMérieux, St. Louis, MO) and by conventional reference methods (5, 17).Anidulafungin (4, 6, 7, 9, 10, 12, 14; Eraxis package insert [Pfizer, Inc., New York, NY, 2007]), voriconazole (Pfizer, Inc., New York, NY), amphotericin B, fluconazole, itraconazole, and 5-flucytosine (5-FC) (Sigma Chemical Co., St. Louis, MO) were obtained as standard powders. Caspofungin (Merck Research Laboratories, Rahway, NJ), and posaconazole (Schering-Plough Research Institute, Kenilworth, NJ) were prepared according to CLSI guidelines at TREK Diagnostics (Cleveland, OH) (1, 3). The final concentration ranges were as follows: anidulafungin, 0.001 to 32 μg/ml; caspofungin, 0.008 to 16 μg/ml; amphotericin B, 0.12 to 8 μg/ml; 5-FC, 0.5 to 64 μg/ml; fluconazole, 0.5 to 64 μg/ml; itraconazole, 0.015 to 2 μg/ml; posaconazole, 0.06 to 8 μg/ml; voriconazole, 0.06 to 8 μg/ml. The dilution scheme was selected to maximize capture of the MIC₅₀ (MIC for 50% of the strains tested) and MIC₉₀ for wild-type and resistant mutant populations and varied by agent. Further, the ranges of newer or investigational agents were expanded in order to identify populations resistant to these newer agents. Micafungin powder was not yet available from the manufacturer at the commencement of testing. The absence of micafungin in comparison with the other available echinocandins is a limitation of this study.Broth microdilution testing for yeasts followed standardized procedures described in the CLSI M27-A3 reference method (1, 2). All of the filamentous fungi were tested under conditions described for the CLSI M38-A2 reference method (3, 4). Quality control isolates C. krusei ATCC 6258, C. parapsilosis ATCC 22019, and C. tropicalis ATCC 750 from the American Type Culture Collection were used as recommended (CLSI), and all results were observed within previously published ranges (1-3, 4, 7). All panels were incubated in enclosed, humid containers at 35°C and visualized with a reading mirror at 24 h (echinocandins) and 48 h (all other agents). The MICs of anidulafungin, caspofungin, 5-FC, fluconazole, itraconazole, and voriconazole were read as the lowest concentration at which a significant decrease in turbidity (≥50%) was discerned compared to that of the growth control. Amphotericin B MICs were determined as the lowest concentration at which no visible growth was detected (1). The interpretive breakpoints for susceptibility to anidulafungin and caspofungin (susceptible [S], ≤2 mg/liter; nonsusceptible [NS], >2 mg/liter), fluconazole (S, ≤8 mg/liter; susceptible dose dependent [SDD], 16 to 32 mg/liter; resistant [R], ≥64 mg/liter), 5-FC (S, ≤4 mg/liter; intermediate [I], 8 to 16 mg/liter; R, ≥32 mg/liter), itraconazole (S, ≤0.125 mg/liter; SDD, 0.25 to 0.5 mg/liter; R, ≥1 mg/liter), and voriconazole S, ≤1 mg/liter; SDD, 2 mg/liter; R, ≥4 mg/liter) were those published by the CLSI (2). Interpretive criteria for amphotericin B and posaconazole have not been established, but for comparison, isolates inhibited by amphotericin B at ≤1 μg/ml were considered susceptible.Mold testing panels were aerobically incubated at 35°C in an enclosed container and visualized with a reading mirror at 24 h (echinocandins) and 48 h (all other agents) under a biosafety hood. MICs of amphotericin B, itraconazole, posaconazole, and voriconazole were determined as the concentration at which no discernible growth was detected. MICs of 5-FC were determined as the lowest concentration at which a prominent decrease in growth (≥50%) was visualized compared to the growth control (3, 4). As described for anidulafungin (10) and caspofungin (11), minimal effective concentrations (MECs) were determined as the lowest concentration at which a pronounced morphological change from filamentous growth to nonfilamentous growth was observed.The rank order of the 1,448 Candida sp. isolates collected during the 2006 to 2007 SENTRY Program surveillance period (Table ​(Table1)1) from all geographic regions was C. albicans (53.2%) C. parapsilosis (16.4%), C. glabrata (13.9%), C. tropicalis (10.8%), C. krusei (2.0%), and other Candida spp. (3.5%). The species distribution was consistent with Candida spp. collected in prior SENTRY Program monitoring periods (1997 to 1999, 2003) (8, 9, 13). The antifungal activities (MIC₅₀s and MIC₉₀s, percent categorical interpretation) of the eight compounds tested against Candida spp. and C. neoformans are summarized in Table ​Table1.1. The CLSI has not established breakpoints for agents in use against C. neoformans. However, posaconazole demonstrated the greatest activity (MIC₉₀, 0.12 μg/ml) against this species.

TABLE 1.

In vitro antifungal agent susceptibilities of Candida and Cryptococcus isolates collected by the SENTRY Program in 2006 to 2007

Carriage Rate of Enterocytozoon bieneusi in an Orphanage in Bangkok,Thailand

This study was performed to evaluate the incidence of and risk factors for Enterocytozoon bieneusi carriage in an orphanage in Bangkok, Thailand. E. bieneusi has been identified by PCR every 2 consecutive months since June 2003. The incidence ranged between 0.6 and 4.7/100 person-months. Person-to-person transmission was indicated by risk factor analysis and genotyping information.Enterocytozoon bieneusi, the most common microsporidial organism infecting humans, causes chronic diarrhea, especially in AIDS patients (4, 12). It can also cause diarrhea in immunocompetent individuals (15, 17). In Thailand, E. bieneusi is one of the most common causes of diarrhea in both adults and children with AIDS (9, 24, 25). It is assumed that E. bieneusi is transmitted by the fecal-oral route; however, the sources of infection and the modes of transmission remain unclear (3). Recently, knowledge about this infection has been increased because of PCR-based detection methods which have higher sensitivity and can identify the organisms'' species and genotypes (16, 19). Genotyping of E. bieneusi is determined based on the polymorphic sequences of the internal transcribed spacer (ITS) of the rRNA gene (2, 11, 18). Recent epidemiological studies have indicated the transmission modes of E. bieneusi including person-to-person, zoonotic, waterborne, and food-borne routes (2, 5-7, 10).We previously reported that ∼4% of human immunodeficiency virus (HIV)-negative children in an orphanage in Bangkok were positive for E. bieneusi (10). To develop effective control strategies, it is essential to understand the epidemiology of this infection. Thus, we conducted a 1-year longitudinal study of E. bieneusi infection in this orphanage. This study was approved by the Ethical Committee, Royal Thai Army Medical Department. A total of 540 orphans and 81 child care workers were enrolled in the study during June 2003 to April 2004. The orphanage consisted of 12 rooms (10 rooms for orphans and 2 rooms for milk and food preparation). Orphans within specific groups were assigned to 10 different rooms (Table ​(Table1).1). Each room accommodated 30 to 40 orphans with 3 child care workers. The child care workers in each room were asked to collect stool samples and complete standardized questionnaires for the orphans for whom they were responsible every 2 months from June 2003 to April 2004. The information, including age, sex, weight, height, HIV status, and present illness, was recorded. The numbers of enrolled subjects during each consecutive round of survey were 338, 337, 321, 286, 340, and 306, respectively. Of 540 orphans, 318 (58.9%) were males. The median age of the orphans was 13 months (0.26 months to 11 years). Seventy-seven orphans (14.3%) were HIV positive (47 males and 30 females). Information on CD4⁺ T-lymphocyte count was not available. All HIV-positive orphans were prescribed antiretroviral therapy (i.e., zidovudine and didanosine). Child care workers who participated in this study had a median age of 38 years (19 to 55 years).

TABLE 1.

Characteristics of 75 orphans with intestinal microsporidiosis

Rapid Drug Susceptibility Testing with a Molecular Beacon Assay Is Associated with Earlier Diagnosis and Treatment of Multidrug-Resistant Tuberculosis in California

To assess the clinical impact of a molecular beacon (MB) assay that detects multidrug-resistant tuberculosis (MDR TB), we retrospectively reviewed records of 127 MDR TB patients with and without MB testing between 2004 and 2007. Use of the MB assay reduced the time to detection and treatment of MDR TB.The emergence and spread of multidrug-resistant tuberculosis (MDR TB) threatens TB control worldwide. MDR TB is resistant to the most effective first-line agents, isoniazid (INH) and rifampin (RIF). The cornerstone of MDR TB diagnosis is culture and drug susceptibility testing (DST) of Mycobacterium tuberculosis isolates. Conventional methods for culture and first-line DST require weeks, causing delays in MDR TB diagnosis and treatment, which in turn are associated with advanced disease (6, 8), treatment failure (4), and transmission. Rapid molecular methods have been developed for the detection of mutations that confer drug resistance (3, 5, 7), and several public health organizations have endorsed molecular DST for TB (2, 9).The California Department of Public Health has been performing a molecular beacon (MB) assay in which real-time PCR is performed on acid-fast bacilli (AFB) smear-positive sputa or M. tuberculosis cultures to detect mutations conferring resistance to INH and RIF. TB providers in California are encouraged to submit specimens for MB testing from patients in whom drug-resistant TB is suspected (i.e., patients with a history of prior TB treatment, patients born in nations with high rates of resistant TB, patients failing TB treatment, and those who are known contacts to MDR TB cases). The assay is not FDA approved but is highly sensitive and specific (5), detects silent mutations infrequently, and shows >95% agreement with phenotypic DST results after testing on nearly 200 unique samples (unpublished). We performed a retrospective cohort study among MDR TB patients to assess the clinical impact of the MB assay in a public health setting in California.This study used deidentified demographic and clinical data that were collected by the California Department of Public Health for TB surveillance. Standard TB treatment was defined as any regimen containing at least 3 drugs, including INH and RIF. MDR treatment was defined as any regimen containing at least 4 drugs and including at least 2 second-line anti-TB medications (e.g., a fluoroquinolone, injectable agent [amikacin, kanamycin, capreomycin], para-aminosalicylic acid, cycloserine, ethionamide, or linezolid) (1, 10). The time to sputum culture conversion was defined as the interval between the collection dates of the first positive sputum culture and the first consistently negative sputum culture. Median times were compared using Wilcoxon''s two-sample test. Proportions were tested using chi-square testing or Fisher''s exact test. The MB assay was performed as previously described (5).Of 139 culture-positive MDR TB cases reported in California from 2004 through 2007, 12 cases were excluded because the MDR TB treatment start date could not be determined. Among the remaining 127 MDR TB cases, 27 (21%) had specimens tested by MB with confirmatory phenotypic DST, while 100 (79%) had phenotypic DST alone. In the MB group, 19 (70%) had a concentrated sputum specimen tested, and 8 (30%) had an M. tuberculosis isolate tested.In both groups, the majority of patients were foreign-born and of Asian ethnicity. Patients with MB testing were more likely to be female (70% versus 43%; P = 0.0116), reside in rural jurisdictions (51.9% versus 27%; P = 0.0143), have a history of previous TB (62% versus 24%; P = 0.0003), have a positive sputum smear (82% versus 60%; P = 0.0404), and have a cavity on their chest radiograph (48% versus 24%; P = 0.0166) compared to patients tested by phenotypic DST only (Table ​(Table1).1). In the MB group, all patients had pulmonary TB, while in the non-MB group, 80% had pulmonary disease and 20% had either extrapulmonary or both pulmonary and extrapulmonary disease.

TABLE 1.

Characteristics of MDR TB patients with and without MB testing

Prevalence and Characteristics of the O122 Pathogenicity Island in Typical and Atypical Enteropathogenic Escherichia coli Strains

The presence of the pathogenicity island (PAI) O122 genes, efa1 (lifA), sen, pagC, nleB, and nleE, in typical and atypical enteropathogenic Escherichia coli (EPEC) strains was investigated. The simultaneous occurrence of all genes was statistically associated with diarrhea due to atypical EPEC. Detection of the complete PAI O122 could aid in the identification of potential pathogenic strains of atypical EPEC.Enteropathogenic Escherichia coli (EPEC) and Shiga toxin (Stx)-producing E. coli (STEC) are important human enteropathogens (9). EPEC is further subgrouped into typical (tEPEC) and atypical (aEPEC) EPEC (8, 21). tEPEC strains are major causative agents of acute diarrhea in infants in developing countries, whereas aEPEC strains affect children and adults worldwide (5, 7, 9, 21). The main difference between tEPEC and aEPEC is the presence of the EPEC adherence factor (EAF) plasmid in tEPEC (8, 21). This plasmid encodes the bundle-forming pilus (BFP), which mediates localized adherence to intestinal cells (9), which is an essential property to differentiate tEPEC from aEPEC strains (1, 7, 21).Formation of the attaching-and-effacing (AE) lesion is the major virulence mechanism of EPEC and an additional virulence property of enterohemorrhagic E. coli (EHEC) strains, a subset of STEC strains (9). This lesion consists of intimate bacterial adherence to the intestinal epithelial cells, cytoskeleton remodeling, and microvillus effacement (9). The genes encoding the AE lesion are located in a pathogenicity island (PAI) known as the locus of enterocyte effacement (LEE) (9). Despite the recognized importance of AE lesion formation, other putative virulence genes among AE-producing E. coli strains have been described.Efa1 (EHEC factor for adherence) is an adhesin originally described in some EHEC strains (16). The efa1 gene is almost identical to lifA, an EPEC gene encoding lymphostatin (LifA) (13). LifA inhibits the proliferation of mitogen-activated lymphocytes and the synthesis of proinflammatory cytokines (13). Efa1/LifA contributes to EPEC adherence to epithelial cells and is critical for intestinal colonization by Citrobacter rodentium, which is an AE lesion-producing bacterial pathogen of mice (12). Although, in the prototype EHEC O157:H7 strain EDL933, efa1 (lifA) lacks the 3′ region (efaC), the adherence ability of this strain is preserved (20).efa1 (lifA) is outside the LEE and inside PAI O122 (16). This island also harbors genes which are very similar to pagC of Salmonella enterica serovar Typhimurium, sen of Shigella flexneri, and two C. rodentium non-LEE genes, nleB and nleE. PagC is required for bacterial survival within macrophages and is immunogenic to humans, while sen encodes an S. flexneri enterotoxin (10). NleB is linked to colonization and disease in mice (11), and NleE induces polymorphonuclear (PMN) transepithelial migration and is involved in the blockage of NF-κB activation (15, 24). Afset et al. (2) found that, of 182 virulence genes searched for among aEPEC strains, 12 were statistically associated with diarrhea, including efa1 (lifA) (having the strongest association with the disease), nleB, and nleE.In STEC the association of LEE, efa1 (lifA), sen, and pagC was strongly correlated with virulence and disease severity (10). As the presence of PAI O122 genes have been searched for in only a limited number of tEPEC serotypes and in a few aEPEC strains (2, 4, 10, 14, 16), in this study we investigated the presence of efa1 (lifA) and its location in PAI O122 as well as the presence of sen, pagC, nleB, and nleE among well-characterized tEPEC and aEPEC strains isolated from diarrheic and nondiarrheic patients.A total of 152 strains (45 tEPEC and 107 aEPEC strains) of various serotypes were studied. These strains were isolated from diarrheic (114 strains) and nondiarrheic (38 strains) patients (5, 6, 22). Prototype tEPEC strain E2348/69 and EHEC strain EDL933 were used as positive controls, and E. coli HB101 was used as a negative control.The presence of efa1 (lifA) was screened by colony blot hybridization assays under stringent conditions (18). The efaⁱ and efa5′ DNA probes were fragments amplified from strain E2348/69 with primers described elsewhere (16) corresponding to both the internal and the 5′ regions of the efa1 (lifA) gene, respectively.For better characterization of PAI O122 and the efa1 (lifA) gene, PCR schemes and primers described previously were used (2, 3, 10, 14) to search for the presence of the efa 3′ region, sen, pagC, nleB, and nleE using Mastermix (Promega, Madison, WI). Localization of efa1 (lifA) in PAI O122 was investigated with Elongase (Invitrogen Life Technologies, Carlsbad, CA).The efa1 (lifA) gene was found in 60 (39.5%) out of 152 strains studied and was more prevalent among tEPEC strains than aEPEC strains (62.2% versus 30.0%, respectively). Among all the strains analyzed only one (aEPEC) presented a truncated efa1 (lifA) gene, like EHEC strain EDL933, as evidenced by lack of amplification with primers annealing to the 3′ region (efaC) of efa1 (lifA) (3) (Tables ​(Tables11 and ​and2).2). This strain was isolated from a diarrheic patient and belonged to serotype O145:nonmotile, thus corroborating a previous finding of a truncated efa1 (lifA) gene in an EHEC strain of the same serogroup (14).

TABLE 1.

Serotypes and origin of tEPEC and aEPEC strains with complete^a PAI O122

Disappearance of Vaccine-Type Invasive Pneumococcal Disease and Emergence of Serotype 19A in a Minority Population with a High Prevalence of Human Immunodeficiency Virus and Low Childhood Immunization Rates

We analyzed the epidemiology of invasive pneumococcal disease (IPD) following introduction of pneumococcal conjugated vaccine in an urban population with a 2% human immunodeficiency virus (HIV) prevalence and history of low childhood immunization rates. We observed near-elimination of vaccine-type IPD. Substantial disease remains due to non-vaccine-type pneumococci, highlighting the need to increase pneumococcal immunization among HIV-infected adults.Following the introduction of 7-valent pneumococcal conjugate vaccine (PCV7) in mid-2000, declines in invasive pneumococcal disease (IPD) were documented across all age groups in the United States (1, 4, 20) and in vulnerable populations (4, 7, 17). Subsequently, increases in IPD caused by nonvaccine serotypes, particularly 19A, were observed (4, 7, 8, 9, 13, 14, 17).Newark, NJ, is a mid-sized U.S. city with a predominantly black and Hispanic population (19), a high human immunodeficiency virus (HIV)/AIDS prevalence (2%) (11), and a history of low childhood immunization rates (2). Potential PCV7-related direct and indirect effects in such populations have not been fully studied. Statewide, passive surveillance of IPD began in mid-2003. We previously described a single Newark medical center''s experience with IPD (18). In the current study, we conducted active, population-based surveillance to complement these efforts and to better understand the contemporary epidemiology of IPD in Newark, specifically, PCV7''s impact and the roles of HIV/AIDS and race/ethnicity in IPD incidence.Multicenter, active surveillance of all Newark IPD cases was conducted from 1 December 2007 through 30 November 2008. Cases were identified at the clinical microbiology laboratories of the four major hospitals serving Newark residents. Case ascertainment was augmented by comparisons with passive reports to New Jersey''s Communicable Disease Reporting and Surveillance System. A case was defined as any Newark resident during the study period with Streptococcus pneumoniae isolated from either blood or cerebrospinal fluid (CSF).Patient demographics and medical information were abstracted from hospital medical charts. Collected isolates were serotyped with sequential multiplex PCR molecular methods developed by the Centers for Disease Control and Prevention (3, 12). DNA sequencing was used for resolution of serotypes 6A, 6B, and 6C. Vaccine serotypes (VT) were defined as those included in PCV7: 4, 6B, 9V, 14, 18C, 19F, and 23F. All others, including vaccine-related serotypes, were defined as nonvaccine serotypes (NVT). We separately considered the additional serotypes included in the 10- and 13-valent vaccines currently under development (6, 21).Race/ethnicity was dichotomized as black, not Hispanic (abbreviated as “black”) versus “all others.” The “all others” category included “Hispanic, all races,” “not Hispanic, white,” “not Hispanic, other,” and “unknown.” HIV status was categorized as either HIV infected or HIV uninfected/status unknown. For most incidence analyses, results are presented using the age intervals in the U.S. Census 2000 (19): <5, 5 to 17, 18 to 44, 45 to 64, and 65 years or older. For HIV-stratified analyses, results are presented using the age intervals in Newark''s HIV/AIDS prevalence reports (11): <13, 13 to 54, and 55 years or older. The χ² test of independence and Fisher''s exact test were used, as appropriate, in univariate analyses (16).During the study period 87 cases of IPD were identified among Newark residents. A total of 81 (93%) occurred at study centers, of which 72 (89%) were collected for serotyping and are described in detail in this report. Three isolates had no extractable DNA, and of the remaining 69, 5 were nontypeable. Ten cases that had not been reported through passive surveillance were identified using the study''s active surveillance methods.Considering all 87 cases during the study period, the reported 1-year incidence of IPD per 100,000 in Newark was 32 (95% confidence interval [CI], 25 to 38). The age distribution was bimodal with peaks in the under-5-years age group and the 45- to 64-years age group (Fig. ​(Fig.1).1). Considering the 72 cases for which full data were available, the relative risk (RR) of IPD for black cases versus all other cases was 2.2 (95% CI, 1.4 to 3.7) and was highest among persons 18 to 44 years old (6.4; 95% CI, 1.4 to 29) (Fig. ​(Fig.1).1). The RR of IPD for HIV-infected patients was 24 (95% CI, 15 to 38), with an incidence of 414 per 100,000 (95% CI, 268 to 611) among HIV-infected patients versus 18 (95% CI, 13 to 24) among HIV-uninfected/status unknown cases and was highest among persons 18 to 54 years old (RR, 47; 95% CI, 25 to 89). The RRs for HIV infected versus HIV uninfected/status unknown, stratified by black and all other race/ethnicity groups, were 19 (95% CI, 11 to 33) and 31 (95% CI, 12 to 85), respectively.Open in a separate windowFIG. 1.Age distribution of invasive pneumococcal disease incidence (per 100,000) by race/ethnicity, Newark, NJ, December 2007 to November 2008. Age- and race-stratified incidences were calculated based on the 72 cases for which full data were available.Table ​Table11 describes the demographic and clinical characteristics of the 72 collected cases. Of the adult cases, 25/63 (40%) were known to be HIV infected. There were no documented HIV-infected pediatric cases. The case fatality ratio was 19% (12/63) in adults and 11% (1/9) in children. Among HIV-infected adults for whom vaccination status was known, 13/21 (62%) had received the 23-valent pneumococcal polysaccharide vaccine (PPV23). Among children whose PCV7 status was known, 3/5 (60%) were up-to-date with PCV7.

TABLE 1.

Demographic and clinical characteristics of Newark IPD cases by HIV status

Rapid Identification of Biothreat and Other Clinically Relevant Bacterial Species by Use of Universal PCR Coupled with High-Resolution Melting Analysis

A rapid assay for eubacterial species identification is described using high-resolution melt analysis to characterize PCR products. Unique melt profiles generated from multiple hypervariable regions of the 16S rRNA gene for 100 clinically relevant bacterial pathogens, including category A and B biothreat agents and their surrogates, allowed highly specific species identification.Rapid and accurate diagnostic tools are critical for infectious disease surveillance and early diagnosis of disease (8, 12). A simple platform which could deliver broad-based screening and specific pathogen identification would be invaluable for the timely recognition of emerging and biothreat (BT) outbreaks, as well as commonly encountered clinical infections (2, 7, 9, 11, 12).We previously reported a probe-based PCR assay, which utilizes conserved and variable 16S rRNA gene sequences for initial broad-based eubacterial detection and subsequent identification of specific bacterial agents (11). The assay demonstrated high analytical sensitivity but was limited by an inability to differentiate closely related pathogens due to decreased specificity of the TaqMan probe chemistry and high sequence homology within selected hypervariable regions of the 16S rRNA gene. Probe-based amplicon characterization accordingly limits testing to a finite number of anticipated pathogens. Alternative strategies for amplicon analysis, such as sequencing and mass spectrometry, allow broader-scale product characterization but are costly, time-consuming, and lacking in throughput (1, 6). High-resolution melt analysis (HRMA) offers a simple, low-cost, closed-tube approach to amplicon analysis with the capacity for single-nucleotide discrimination and easy integration with PCR analysis (10). We report a unique strategy for the rapid, highly specific identification of BT- related and non-BT-related bacterial pathogens which couples eubacterial PCR with HRMA.Three hypervariable regions (V1, V3, and V6), each flanked by highly conserved sequences within the 16S rRNA gene, were selected for primer design (3). Sequence data for clinically or BT-relevant bacteria were obtained from GenBank and aligned using ClustalW (www.ebi.ac.uk/clustalw/) to determine sequence variability. Primer pairs used to target hypervariable regions were as follows: V1-F (5′-GYGGCGNACGGGTGAGTAA-3′) and V1-R (5′-TTACCCCACCAACTAGC-3′), V3-F (5′-CCAGACTCCTACGGGAGGCAG-3′) and V3-R (5′-CGTATTACCGCGGCTGCTG-3′), and V6-F (5′-TGGAGCATGTGGTTTAATTCGA-3′) and V6-R (5′-AGCTGACGACANCCATGCA-3′).One hundred common, BT-related, and BT-surrogate organisms composed of 58 different bacterial species of American Type Culture Collection (ATCC) strains, clinical isolates, or inactivated or nonpathogenic strains were used for analysis (Table ​(Table1).1). Ten to 15 colonies of each bacterial organism were inoculated in to 200 μl of molecular-grade water (Roche Molecular Diagnostics, Indianapolis, IN), and DNA was extracted using a Roche MAGNA Pure instrument (Roche Molecular Corporation, Indianapolis, IN). Archived DNA extracted as previously described from 40 archived clinical synovial fluid (14) and cerebral spinal fluid samples collected from patients suspected of having septic arthritis or bacterial meningitis, respectively, were also used for blinded analyses.

TABLE 1.

Melting analysis of non-BT-related and BT-related organisms

Prevalence and Associations of tcpC,a Gene Encoding a Toll/Interleukin-1 Receptor Domain-Containing Protein,among Escherichia coli Urinary Tract Infection,Skin and Soft Tissue Infection,and Commensal Isolates

TcpC, a new Toll/interleukin-1 receptor domain-containing protein of uropathogenic Escherichia coli involved in the suppression of innate immunity, was found in 2008. The aim of the present study was to determine the prevalence of tcpC and its association with virulence factors and phylogenetic groups among strains from a collection of 212 E. coli isolates from urinary tract and skin and soft tissue infections and 90 commensal E. coli strains.Pathogenic microbes avoid host defenses using a wide array of virulence factors. Escherichia coli strains, even though they are common bacteria of the gut microbiota, can be important pathogens due to the possession of virulence factors (5). Recently, Cirl et al. (1) reported that they found TcpC, a new Toll/interleukin-1 receptor (TIR) domain-containing protein of uropathogenic E. coli that inhibits Toll-like receptor (TLR) and MyD88-specific signaling, thus impairing the innate immune response. They further reported that tcpC homologous sequences were present in about 40% of E. coli isolates from individuals with pyelonephritis, 21% of isolates from individuals with cystitis, 16% of isolates from individuals with asymptomatic bacteriuria, and only 8% of commensal isolates. Their results suggested that TcpC increases the severity of urinary tract infections (UTIs) in humans and provided the first unambiguous evidence that bacterial pathogens interfere with TLR signaling to survive and spread in the human host.The aim of our study was to determine the prevalence of tcpC among 212 extraintestinal E. coli isolates: 100 E. coli isolates from individuals with symptomatic UTIs, 10 E. coli isolates from individuals with asymptomatic UTIs, 102 E. coli isolates from isolates from individuals with skin and soft tissue infections (SSTIs), and 90 E. coli commensal isolates. In addition, we investigated the association of tcpC with the phylogenetic group (groups A, B1, B2, and D; E. coli strains causing extraintestinal infections are known to mainly belong to group B2 and, to a lesser extent, group D, while commensal E. coli strains belong to groups A and B1), as well as with other well-known virulence factors of extraintestinal pathogenic E. coli (ExPEC) strains (cytotoxic necrotizing factor 1 [cnf1], hemolysin [hlyA], P-fimbrial adhesins [papGIII and papGII], S fimbriae [sfaDE], Afa/Dr adhesins [afa/draBC], aerobactin [iucD], and uropathogenic strain-specific protein [usp]). To our knowledge, this is the first investigation of the prevalence of tcpC among E. coli strains causing SSTIs and of the association of tcpC with phylogenetic group as well as virulence factor genes among UTI, SSTI, and commensal E. coli isolates.The extraintestinal E. coli isolates examined in this study were from our previous studies of UTIs (10, 12-14) and SSTIs (9), while the 90 E. coli commensal isolates were isolated for the purposes of this study. The commensal E. coli isolates were isolated as lactose-positive colonies on MacConkey agar plates from the feces of healthy individuals. Indole, methyl red, Voges-Proskauer, and citrate tests were performed to ascertain that the species detected were E. coli. The strains investigated were cultivated in Luria-Bertani medium or agar. Cell lysates of all 302 E. coli isolates were prepared (7) and used in the PCRs. Amplifications were performed in an automated thermal cycler (UNOII; Biometra, Göttingen, Germany) in a 25-μl reaction mixture containing template DNA (5 μl of boiled lysate), 10 pmol of forward and reverse primers (Table ​(Table1),1), 0.2 mM deoxynucleoside triphosphate mixture, 0.625 U Taq DNA polymerase, and 2.5 mM MgCl₂ in 1× PCR buffer (Fermentas, Vilnius, Lithuania). The amplification schemes were based on previous amplification protocols (Table ​(Table1).1). For amplification of the tcpC sequence, the following amplification scheme was employed: 1 cycle of denaturation at 94°C for 4.5 min, followed by 25 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and elongation at 72°C for 1 min. The amplification was concluded with an extension program of one cycle at 72°C for 5 min. Fisher''s exact test (two-tailed; http://www.langsrud.com/fisher.htm) and the Bonferroni correction were used to analyze the data. The threshold for statistical significance after the Bonferroni correction was set at a P value of <0.05. The PCR revealed that 49 (23%) of the pathogenic strains studied harbored the tcpC sequence: 23 (21%) of our UTI E. coli isolates (21 isolates [21%] from individuals with symptomatic UTIs and 2 isolates [20%] from individuals with asymptomatic UTIs) and 26 (25%) of our SSTI E. coli isolates. The prevalence of tcpC was much lower among commensal E. coli isolates, only 7 (8%), as was found in a recent study by Cirl et al. (1). Comparison of the prevalence of tcpC among the UTI isolates of the two studies was not possible, as we could not obtain data on the type of symptomatic UTI (cystitis, pyelonephritis), and furthermore, the number of asymptomatic UTI isolates was too small (n = 10) to be statistically relevant. As seen from Table ​Table2,2, strong statistical correlations were found between the presence of tcpC and the B2 phylogenetic group, as well as between the presence of tcpC and the presence of cnf1, hlyA, papGIII, sfaDE, and usp among UTI isolates, as well as commensal strains. Among the SSTI isolates, statistically significant associations were found only between the presence of tcpC and the presence of cnf1, hlyA, and usp. As ExPEC strains mainly belong to the B2 phylogenetic group, these correlations and the higher virulence scores of the tcpC-encoding strains are not surprising. Interestingly, when the UTI and SSTI isolates were compared, major differences were observed. While the prevalence rates of tcpC sequences were similar in both groups, 21% among UTI isolates and 25% among SSTI isolates, suggesting an important role of TcpC in UTIs as well as in SSTIs, P values establishing significant correlations were higher among UTI isolates than among SSTI isolates. The differences between the UTI and SSTI E. coli strains observed are most likely due to differences in pathogenic mechanisms; nevertheless, the possession of TcpC seems to be an important factor in establishing UTIs and SSTIs. As the bowel flora is a reservoir of ExPEC, it is not surprising that tcpC was also found to be significantly associated with the B2 phylogenetic group among commensal strains. Our results suggest that even though E. coli strains able to induce disease outside the gastrointestinal tract are collectively designated ExPEC (11), it could be worthwhile to consider strains from different sites or syndrome-specific pathotypes separately.

TABLE 1.

Sequences of primers used in this study

Streptococcus gallolyticus Subspecies pasteurianus (Biotype II/2), a Newly Reported Cause of Adult Meningitis

We report the first case of adult meningitis confirmed to be due to Streptococcus gallolyticus subsp. pasteurianus. Phenotypically reported as Streptococcus bovis biotype II/2, 16S rRNA sequencing revealed S. gallolyticus subsp. pasteurianus. Because of taxonomic uncertainties, S. gallolyticus subsp. pasteurianus may be an underrecognized agent of systemic infections.The group D nonenterococcal streptococci include Streptococcus bovis, with two biotypes (I and II) that cause human infections. Biotype I (Streptococcus gallolyticus) is associated with colonic carcinoma and endocarditis (20). Biotype II/1 (Streptococcus infantarius) has been associated with noncolonic cancers (5). These clinical implications make accurate species identification critical. However, the S. bovis group is genetically diverse, and organisms previously classified as S. bovis now represent multiple species with unique clinical manifestations (8, 9, 22). S. gallolyticus subsp. pasteurianus, also named Streptococcus pasteurianus, was proposed to replace S. bovis II/2 (19, 22). Clinicians and laboratory staff do not recognize this taxonomy and its associated clinical implications. We report a case of S. gallolyticus subsp. pasteurianus meningitis.A 75-year-old man presented to the emergency room 2 days after the onset of headache, fever, and photophobia. He had a history of prostate cancer 8 years previously, which was treated with pelvic irradiation, with subsequent radiation proctitis. He denied intravenous drug abuse. Physical exam revealed a temperature of 38.3°C, photophobia, and nuchal rigidity. His peripheral white blood cell count (WBC) was 11,400/mm³ (with 65% neutrophils, 15% bands, and 10% lymphocytes), and his glucose was 160 mg/dl. The patient was given 1 g ceftriaxone, and 2 hours later lumbar puncture showed clear, colorless cerebrospinal fluid (CSF), with a WBC of 112/mm³ (62% neutrophils), glucose of 38 mg/dl, and protein of 282 mg/dl; no organisms were seen on Gram stain. HIV testing and three stool specimens for ova and parasites were negative.The patient was treated for bacterial meningitis with ampicillin, vancomycin, ceftriaxone, and dexamethasone (0.15 mg/kg of body weight). A group D nonenterococcal streptococcus was identified from blood and CSF cultures. The API Rapid Strep kit (bioMérieux, Marcy l''Etoile, France) identified the organism as S. bovis biotype II/2, and RapID Strep (Remel, Lenexa, KS) identified it as S. bovis variant group D (also known as biotype II). As the cultures were sensitive to ceftriaxone, clindamycin, erythromycin, levofloxacin, linezolid, penicillin, and vancomycin, both ampicillin and vancomycin were discontinued. A transesophageal echocardiogram showed no evidence of endocarditis, and colonoscopy was negative. He received intravenous antibiotics for 10 days, and as of January 2010 has not had recurrence of illness after 54 months of follow-up.After incubation on tryptic soy blood agar (TSBA) plates, colonies were tested for catalase production and failed growth in 6.5% NaCl. Lancefield typing was determined by using Streptex (Remel). Carbohydrate fermentation analysis was performed using the API 20 Strep (ID 7650450; bioMérieux) and RapID Strep (ID 22301; Remel) kits. See Table ​Table11 for the results of phenotypic testing.

TABLE 1.

Phenotypic characteristics of S. bovis biotype II/2 (S. gallolyticus subsp. pasteurianus)

Characterization of Atypical Isolates of Yersinia intermedia and Definition of Two New Biotypes

The species Yersinia intermedia is a member of the genus Yersinia which belongs to the Enterobacteriaceae family. This species is divided into eight biotypes, according to Brenner''s biotyping scheme. This scheme relies on five tests (utilization of Simmons citrate and acid production from d-melibiose, d-raffinose, α-methyl-d-glucoside [αMG], and l-rhamnose). The collection of the French Yersinia Reference Laboratory (Institut Pasteur, Paris, France) contained 44 strains that were originally identified as Y. intermedia but whose characteristics did not fit into the biotyping scheme. These 44 strains were separated into two biochemical groups: variant 1 (positive for acid production from l-rhamnose and αMG and positive for Simmons citrate utlization) and variant 2 (positive for acid production from l-rhamnose and αMG). These atypical strains could correspond to new biotypes of Y. intermedia, to Y. frederiksenii strains having the atypical property of fermenting αMG, or to new Yersinia species. These strains did not exhibit growth or phenotypic properties different from those of Y. intermedia and Y. frederiksenii and did not harbor any of the virulence traits usually found in pathogenic species. DNA-DNA hybridizations performed between one strain each of variants 1 and 2 and the Y. intermedia and Y. frederiksenii type strains demonstrated that these variants do belong to the Y. intermedia species. We thus propose that Brenner''s biotyping scheme be updated by adding two new biotypes: 9 (for variant 1) and 10 (for variant 2) to the species Y. intermedia.The genus Yersinia belongs to the Enterobacteriaceae family and is composed of 12 species: Yersinia enterocolitica, Y. pestis, Y. pseudotuberculosis, Y. aleksiciae, Y. aldovae, Y. bercovieri, Y. frederiksenii, Y. intermedia, Y. kristensenii, Y. mollaretii, Y. rohdei, and Y. ruckeri (26). It has recently been proposed that three new species be added to this genus: Y. aleksiciae (20), Y. similis (21), and Y. massiliensis (14).Y. intermedia was separated from Y. enterocolitica and defined as a new species by Brenner and colleagues in 1980 (6). Bacteria belonging to this species have been isolated from the environment (freshwater, sewage), various animals (fish, oysters, shrimps, snails, wild and domestic animals), food (milk, cream, meat), and sometimes, healthy and sick humans, mainly from their stools. This new species was named Y. intermedia because it has properties intermediate between those of Y. pseudotuberculosis and Y. enterocolitica. Indeed, this species shares with Y. pseudotuberculosis 45 to 55% DNA relatedness as well as the ability to ferment rhamnose and melibiose, but it also exhibits some of the biochemical characteristics of Y. enterocolitica (sucrose and cellobiose fermentation). Y. intermedia also shares several O antigens with Y. enterocolitica (27), of which O:4 and O:17 appear to be the prevailing serotypes. This species can further be subdivided into eight biotypes, on the basis of Simmons citrate utilization and acid production from α-methyl-D-glucoside (αMG), d-melibiose (Mel), d-raffinose (Raf), and l-rhamnose (Rha) (6).Y. frederiksenii was also differentiated from Y. enterocolitica in 1980 (24). Y. frederiksenii and Y. intermedia have similar ecological niches, and they are phenotypically very close. Actually, the distinction between the two species relies on the simultaneous absence of acid production from Mel, αMG, and Raf in Y. frederiksenii, while at least one of these three sugars is acidified by the various biotypes of Y. intermedia (Table ​(Table1)1) .

TABLE 1.

Scheme used to biotype Y. intermedia and compare the phenotypic characteristics of the two variants and Y. frederiksenii^a

Prevalence of Protective Measles Virus Antibody Levels in Umbilical Cord Blood Samples in Catalonia,Spain

The prevalence of protective antibody levels (>160 mIU/ml) in neonates was 98.5%. The mean measles virus antibody level was 3,406 mIU/ml and increased with maternal age. Measles vaccination was reported by 42% of pregnant women and decreased with age.Catalonia, a region in the northeast of Spain, began administration of one dose of the measles, mumps, and rubella (MMR) vaccine at 12 months of age in the routine vaccination schedule in 1980 (5). In 1987, administration of the first dose was shifted to 15 months of age, and in 1988, a second dose of MMR vaccine was added at 11 years of age to replace the rubella vaccine administered to girls. In 1998, administration of the second dose was shifted to 4 years of age to ensure that more than 95% of children <10 years of age were immune to measles (5).Immunization has reduced the incidence of measles in Catalonia and the rest of Spain. The incidence of measles in Spain has decreased from 427 per 100,000 persons in 1997 to 0.37 per 100,000 persons in 2000, and by the year 2000, indigenous measles virus transmission was interrupted in four Spanish regions (Asturias, Cantabria, Catalonia, and Navarra) (2, 17). In 2005, there were no reported cases of measles in 10 Spanish regions (3). Nevertheless, in 2006, a measles outbreak affecting 381 people occurred in Catalonia (7). Analysis of the epidemiological characteristics of the outbreak showed that that 76% of the cases occurred among individuals aged <25 years, 50% occurred among children aged ≤15 months, and 89% occurred among nonvaccinated individuals (7). The measles outbreak occurred possibly because children aged ≤15 years had low measles virus antibody levels and the prevalence of protection among individuals aged <25 years was lower than the herd immunity threshold (16).In pregnant women, measles can be a serious disease if complications occur or the infection is transmitted to the fetus (18). In Catalonia, measles immunity and measles virus IgG antibody levels are not studied routinely in women of childbearing age, although this assessment may be necessary to immunize unprotected women. The objective of this study was to investigate measles virus antibody levels and the prevalence of protective levels in umbilical cord blood samples of neonates from a representative sample of pregnant women in Catalonia.A representative sample of pregnant women in Catalonia was obtained from 27 hospitals between August and December 2003. The sample size, calculated taking into account a prevalence of protective antibody levels of 98% in women aged 25 to 34 years (6), an alpha error of 5%, and a precision of ±0.007, was 1,536. Informed consent to obtain umbilical cord blood samples and study variable data were obtained from all pregnant women. The sociodemographic variables assessed were age, place of birth, urban or rural habitat, and social class. An immigrant woman was defined as a woman not born in Catalonia or another Spanish region. Social class was determined by occupation using the English classification (I to III, IV and V, and VI) (14). Medical variables included history of vaccination and diseases. Measles virus immunoglobulin G (IgG) levels were measured in umbilical cord blood by enzyme-linked immunosorbent assay (Enzygnost; Behring) according to the manufacturer''s instructions. Measles virus IgG antibody levels of >160 mIU/ml in umbilical cord samples were considered indicative of immune protection (Enzygnost; Behring).Statistical analysis was carried out using the SPSS program (version 17; SPSS Inc.). Mean measles virus IgG antibody levels, prevalence of protective antibody levels, and their 95% confidence intervals (CIs) were determined in different sociodemographic groups. The t test was used to compare mean antibody levels, and the chi-square test was used to compare prevalences, considering a P value of <0.05 statistically significant. Correlation between mean antibody levels and study variables was assessed using Pearson''s correlation coefficient (r), considering a P value of <0.05 statistically significant. A multiple linear regression equation to explain measles virus antibody levels was developed using the stepwise method to select variables. The possible association between sociodemographic variables and measles vaccination in pregnant woman was analyzed by calculating the crude and adjusted odds ratios (ORs). Multiple logistic regression analysis was used to adjust significant ORs.The composition of the sample (n = 1,498) of pregnant women included in the study according to sociodemographic variables was similar to that of the population of Catalonia (10). The prevalence of protective measles virus antibody levels (>160 mIU/ml) in neonates was 98.5% (Table ​(Table1).1). The prevalence of protective measles virus antibody levels was >95% in all sociodemographic groups. The measles virus antibody levels were <1,000 mIU/ml in 172 (11.5%) samples, between 1,000 and 10,000 mIU/ml in 1,315 (87.8%) samples, and >10,000 mIU/ml in 11 (0.7%) samples.

TABLE 1.

Measles virus IgG antibody levels and prevalence of protective (>160 mIU/ml) measles virus antibody levels in umbilical cord blood samples by maternal sociodemographic variables in Catalonia, Spain, 2003

CagA and VacA Polymorphisms Are Associated with Distinct Pathological Features in Helicobacter pylori-Infected Adults with Peptic Ulcer and Non-Peptic Ulcer Disease

Polymorphic variability in Helicobacter pylori factors CagA and VacA contributes to bacterial virulence. The presence of one CagA EPIYA-C site is an independent risk factor for gastroduodenal ulceration (odds ratio [OR], 4.647; 95% confidence interval [CI], 2.037 to 10.602), while the presence of the vacA i1 allele is a risk factor for increased activity (OR, 5.310; 95% CI, 2.295 to 12.287) and severity of gastritis (OR, 3.862; 95% CI, 1.728 to 8.632).Helicobacter pylori, colonizing the gastric mucosa of 35 to 70% of people worldwide, is the etiologic factor for peptic ulcer development and increases the risk for gastric cancer. H. pylori pathogenesis is exerted via distinct virulent factors such as the secreted cytotoxin VacA (vacuolating cytotoxin A), the cag pathogenicity island (cagPAI) encoding the type IV secretion system (T4SS), and the cytotoxin-associated gene A (CagA) protein (6). We analyzed H. pylori clinical isolates from the antrum of 144 Greek adults (mean age ± standard deviation [SD], 52.6 ± 13.7 years; 78 male) diagnosed with peptic ulcer (gastric, n = 21; duodenal, n = 44) and non-peptic ulcer disease (nonulcer dyspepsia, n = 61; esophagitis, n = 18) on the basis of functional CagA EPIYA motifs as well as vacA alleles for signal, intermediate, and middle regions, as described previously (13, 15), and assessed putative associations with disease parameters and gastric inflammatory response.Approximately 27% of the strains were found to be cagA negative with complete absence of the cagPAI. Among the 96 cagA-positive isolates, 15 (10.4%) lacked a functional T4SS as they induced minimal interleukin-8 (IL-8) levels (Fig. ​(Fig.1A1A ), and no phosphorylated CagA was detected (Fig. ​(Fig.1B)1B) following infection of gastric epithelial AGS cells (15). Infection with strains possessing a functional T4SS led to significantly higher IL-8 secretion, irrespective of the number of EPIYA-C sites, and to CagA phosphorylation (Fig. 1A and B). Hence, for univariate and multivariate logistic regression analysis, cagA-positive isolates with a nonfunctional T4SS were grouped together with cagA-negative cases, comprising the “None” category. In single H. pylori strain infections, the majority of isolates (n = 59, 41.0%) were of the ABC EPIYA type (15), with a second EPIYA-C repeat observed in 19 (13.2%) strains, while ABCCC strains were also identified (n = 2, 1.4%). In 11 cases (7.7%), the presence of mixed infection by isogenic strains differing solely with regard to the number of EPIYA-C repeats was identified as shown before (13).Open in a separate windowFIG. 1.(A) Levels of secreted IL-8 following infection of gastric epithelial AGS cells with H. pylori clinical strains (1, cagA negative; 2, cagPAI defective; 3, 1 EPIYA-C repeat; 4, ≥2 EPIYA-C repeats). No difference was observed between cagA-negative and cagPAI-defective strains (U = 32.500 and P = 0.201 by the Mann-Whitney U test). cagA- and cagPAI-positive strains induced higher levels of IL-8 than cagPAI-defective strains (U = 0.000 and P < 0.0001 by the Mann-Whitney U test), irrespective of the number of EPIYA-C sites (U = 224.500 and P = 0.627 by the Mann-Whitney U test). (B) Tyrosine phosphorylation and expression patterns of CagA protein following infection of AGS cells with representative H. pylori clinical strains. CagA tyrosine phosphorylation was detected by immunoblotting (IB) following immunoprecipitation (IP) with PY20 antiphosphotyrosine antibody. The expression of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was utilized as a total protein loading control. Lanes: 1, CagA-negative clinical isolate; 2 to 5, CagA-positive isolates with functional cagPAI harboring 2 (AB), 3 (ABC), 4 (ABCC), and 5 (ABCCC) motifs in CagA, respectively; 6 and 7, CagA-positive H. pylori strains carrying 3 (ABC) and 4 (ABCC) EPIYA motifs with defective cagPAI, respectively, as depicted by the absence of phosphorylated CagA; 8 and 9, CagA-positive strains with 5 (ABCCC) EPIYA motifs.The dominant vacA polymorphisms for the signal, intermediate, and middle regions were s1, i1, and m2, respectively, as reported for Western-type H. pylori strains (5, 17). More specifically, 102 (70.8%) isolates were identified as vacA s1, with 57 (39.6%) carrying the vacA m1 allele simultaneously. No strain with vacA s2/m1 was recorded. Of the 91 vacA i1 strains, 54 (59.3%) were also typed as vacA s1/m1, whereas 38/53 (71.7%) vacA i2 strains were s2/m2 (P < 0.001). Depending on the vacA genotype, strains were further classified into three categories (7, 14), namely, nonvacuolation (s2/i2/m2, s1/i2/m1, s1/i2/m2, and s2/i1/m2), low vacuolation (s1/i1/m2), and high vacuolation (s1/i1/m1). Vacuolating vacA s1/i1/m1 or s1/i1/m2 types were present in strains harboring functional CagA variants with more EPIYA-C phosphorylation repeats, with frequencies reaching approximately 90% in cases of multiple infections, whereas cagPAI-defective strains were almost exclusively related to a nonvacuolating vacA genotype (P < 0.001).vacA s1 and i1 polymorphisms were found to be associated with marked chronic inflammatory infiltration and activity of chronic gastritis in the antrum (Table ​(Table1).1). No association was observed with the density of H. pylori colonization or the presence of gastric atrophy and intestinal metaplasia (IM), even though in 41/57 (71.9%) of recorded IM the strain carried the vacA i1 allele (P = 0.111). However, the risk for IM development increased 2-fold upon infection with vacA m1 strains (odds ratio [OR], 2.182; 95% confidence interval [CI], 1.098 to 4.338; P = 0.026). Heavy H. pylori colonization (OR of 6.866 and 95% CI of 3.072 to 15.344 [P < 0.001] and OR of 8.476 and 95% CI of 3.633 to 19.777 [P < 0.001], respectively) and infection with vacA i1 strains (OR of 3.862 and 95% CI of 1.728 to 8.632 [P = 0.001] and OR of 5.310 and 95% CI of 2.295 to 12.287 [P = 0.001], respectively) were recognized as independent risk factors for the development of severe chronic inflammatory infiltration and marked activity of chronic gastritis in the antrum. This is the first report associating vacA intermediate region polymorphisms with increased activity of antral gastritis. vacA s1 strains of Western origin have previously been associated with more-severe gastric inflammation (5, 11, 16). The only reports relating specific cagA polymorphisms with histological lesions involve strains of East Asian origin carrying the ABD EPIYA sites, which present distinct biological properties compared to Western-type ABC EPIYA motifs (4).

TABLE 1.

Univariate logistic regression analysis showing association of vacA and cagA polymorphisms with severity and activity of chronic gastritis in the antrum of 144 Greek adults

Coexistence of Multiple Multilocus Variable-Number Tandem-Repeat Analysis Subtypes of Clostridium difficile PCR Ribotype 027 Strains within Fecal Specimens

We investigated whether multilocus variable-number tandem-repeat analysis (MLVA) typing could identify different subtypes of Clostridium difficile ribotype 027 within the same feces specimen. Five of 39 specimens yielded at least one isolate with an MLVA profile different (more than five summed tandem repeat differences) from that of other isolates in the same specimen, thereby potentially obscuring epidemiological links between C. difficile infection cases.The incidence and severity of Clostridium difficile infection (CDI) have increased in recent years, possibly due to the emergence and spread of epidemic strain PCR ribotype 027 (also known as pulsed-field electrophoresis type NAP1) (9, 10, 12). Ribotype 027 is highly prevalent in the United Kingdom (2), making PCR ribotyping alone insufficient for investigating potential cases of cross infection or differentiating between epidemic outbreaks. Multilocus variable-number tandem-repeat analysis (MLVA) is a more discriminatory typing technique for C. difficile (11, 14) and has been used for several studies (1, 4-7), but as yet, no data on the subtyping of multiple isolates from the same specimen have been published.We investigated whether MLVA typing could identify different subtypes of ribotype 027 within the same specimen and considered the impact this may have on the utility of MLVA as a typing method for outbreak situations.(This work was presented in part as poster 525 at the European Congress of Clinical Microbiology and Infectious Diseases, 16 May 2009.)Thirty-nine feces samples (preselected by infection control teams on the basis of severity, clusters, or high CDI rates) submitted for PCR ribotyping and yielding a type 027 C. difficile isolate were arbitrarily selected. C. difficile was cultured from specimens using alcohol shock and inoculation onto cycloserine-cefoxitin-fructose agar. Five isolated colonies of C. difficile were picked from each culture and were all confirmed as C. difficile type 027 by PCR ribotyping (13), giving 195 study isolates.Six variable-number tandem-repeat (VNTR) loci (A6Cd, B7Cd, C6Cd, E7Cd, G8Cd, and CDR60) from published MLVA schemes (11, 14) were amplified by PCR from all isolates. Loci F3Cd and H9Cd (14) were not used, as they are invariant within PCR ribotype 027 isolates (6, 8, 14). Loci CDR5 and CD59 (11) were not used, as they were found to be variant by only one tandem repeat or invariant in diverse 027 isolates (data not shown). Primers were used as previously described (14), except for the G8Cd reverse primer (5′ AATCTAATAATCCAGTAATTTAAATT 3′), which was redesigned to improve the yield of G8Cd, and CDR60 primers (CDR60-Forward, 5′-AGTTTGTAGGGAAGTGTGTAAATAGAT-3′; CDR60-Reverse, 5′-CGCATTAAATTTCACTCCTCAT-3′), which were redesigned to minimize the PCR product size. Five-microliter volumes of DNA extracts were added to 20 μl of PCR mixture, giving (final concentrations) 0.2 μM each primer, 2.5 mM MgCl₂, 0.2 mM each deoxynucleoside triphosphate, 1× GeneAmp PCR Gold buffer, and 0.5 U of AmpliTaq Gold DNA polymerase (Applied Biosystems). Reaction mixtures underwent activation at 95°C for 5 min, followed by 35 cycles of 95°C for 1 min, 56°C for 1 min, and 72°C for 1 min with a final elongation at 72°C for 5 min. PCR products were electrophoresed on 3% MetaPhor agarose (Lonza) gels in 0.5× Tris-borate-EDTA buffer at 150 V for 5 h against a 20-bp molecular size standard (Sigma-Aldrich Company Ltd.). Gels were stained with ethidium bromide and photographed under UV light. PCR product sizes were determined using BioNumerics software (Applied Maths) by comparison with a standard curve generated from the 20-bp ladder. VNTR numbers were calculated from PCR product sizes. Tandem-repeat numbers from each VNTR locus were concatenated for each isolate to form MLVA profiles, which were compared using BioNumerics software (Applied Maths).The accuracy of determining VNTR numbers using the agarose gel method described was validated by sequencing 35 different VNTR PCR products using an ABI 3700 capillary sequencer to determine exact repeat numbers and then comparing them with numbers determined by the agarose gel method. A range of PCR product sizes from each locus including PCR products differing in size by one 6-bp repeat were included. The agarose gel method was accurate for 28 of 35 sequenced products with an error of plus or minus one repeat in the remaining seven. The impact of any such error was minimized by ensuring that PCR products from the same locus for isolates from the same specimen were electrophoresed in adjacent lanes of the gel, making the smallest 6-bp differences clearly visible. Thus, any error was unlikely to affect the calculated differences between isolates. Accurate size determination methods such as sequencing would be required for larger-scale comparisons.Studies using C. difficile MLVA (1, 4, 5, 7) have utilized the Manhattan coefficient to calculate a summed tandem-repeat difference (STRD) from all loci and associate MLVA types with the smallest STRDs. It has been suggested that C. difficile isolates with an STRD of two or fewer should be considered “clonal” (1, 4, 7, 14). We applied this method to compare MLVA profiles within each study specimen. Thirty-four specimens (87%) were found to contain isolates which were indistinguishable or had an STRD of no more than two from another isolate from the same specimen. Five specimens (13%) contained at least one isolate which had an STRD of five or more from the next most closely related isolate (Fig. ​(Fig.11).Open in a separate windowFIG. 1.MLVA profiles and minimum spanning trees for specimens yielding C. difficile PCR ribotype 027 isolates at least one of which had an STRD of five or more from the next most closely related isolate. For minimum spanning trees, circles represent unique MLVA profiles in the tree and are scaled by member count. Thick solid lines represent an STRD of one, thin solid lines represent an STRD of two, thick dashed lines represent an STRD of three, and thinner dashed lines represent an STRD of four or more. STRDs of more than four are indicated by numerals between the circles. Gray shading indicates complexes with a maximum neighbor distance of two tandem repeats and a minimum of two MLVA types.It is a disadvantage of the Manhattan coefficient that if several repeats at a locus are deleted or duplicated simultaneously, the resulting STRD is large and similarities are obscured.For this reason, we made alternative comparisons of isolate MLVA profiles within each specimen using the categorical coefficient which associates MLVA types with the smallest number of VNTR locus variants. This revealed that 5 (13%) out of 39 specimens contained isolates differing from each other at three out of six loci (Table ​(Table1).1). Two specimens (1 and 3) contain isolates that differ by both analyses.

TABLE 1.

MLVA profiles of specimens containing C. difficile PCR ribotype 027 isolates differing from each other at three out of six VNTR loci

Two Distinct Clones of Methicillin-Resistant Staphylococcus aureus (MRSA) with the Same USA300 Pulsed-Field Gel Electrophoresis Profile: a Potential Pitfall for Identification of USA300 Community-Associated MRSA

Analysis of methicillin-resistant Staphylococcus aureus (MRSA) characterized as USA300 by pulsed-field gel electrophoresis identified two distinct clones. One was similar to community-associated USA300 MRSA (ST8-IVa, t008, and Panton-Valentine leukocidin positive). The second (ST8-IVa, t024, and PVL negative) had different molecular characteristics and epidemiology, suggesting independent evolution. We recommend spa typing and/or PCR to discriminate between the two clones.The methicillin-resistant Staphylococcus aureus (MRSA) clone USA300, having multilocus sequence type (MLST) ST8 and staphylococcal protein A (spa) type 008 and carrying staphylococcal cassette chromosome (SCCmec) IVa, has disseminated in the United States, as well as to other parts of the world (16, 26, 27). USA300 carries the luk-PV genes encoding Panton-Valentine leukocidin (PVL), has been identified in a variety of community populations, and has been associated with skin and soft tissue infections (SSTI), as well as more severe infections, such as sepsis, pneumonia, and necrotizing fasciitis (7, 22, 28).The identification of USA300 isolates is primarily based on pulsed-field gel electrophoresis (PFGE) (10). Other genetic markers have also been suggested for identification of USA300 isolates, including (i) the arcA gene of the arginine catabolic mobile element (ACME) (3, 8, 26, 29), (ii) sequencing of the direct repeat unit (dru) region (9), and (iii) different USA300-specific multiplex PCRs targeting luk-PV and a “signature” six-AT-repeat sequence within the conserved hypothetical gene SACOL0058 (2).In Denmark, MRSA isolates have been consecutively typed by PFGE since 1999, with the addition of sequence-based methods, such as MLST and spa typing, on selected isolates since 2001 (6). This process identified some of the first USA300 isolates in Europe but, surprisingly, also identified isolates with USA300 PFGE banding patterns but a different spa type (1, 15, 16). In this study, we investigated the epidemiology and genetic diversity of these isolates and USA300 and USA500 reference strains (20) using PFGE (23), spa typing (11), MLST (5), SCCmec typing (21, 24), dru typing (9), ACME (26), the six-AT signature sequence (2), detection of luk-PV (4), and antimicrobial susceptibility testing (Neo-Sensitabs), as well as microarray analysis (18, 19).Clinical and epidemiological information was obtained consecutively (17). Infections were categorized into four different groups: import, hospital associated, community associated, and health care associated with community onset (14).Where appropriate, statistical significance (P < 0.05) was assessed using the Mann-Whitney test or Fischer''s exact test.Between 1999 and 2006, 80 MRSA isolates from Denmark had USA300 PFGE profiles (50 representative PFGE profiles are shown in Fig. ​Fig.1).1). However, by spa typing, two different spa types, t008 (11-19-12-21-17-34-24-34-22-25 [n = 38]) and the single repeat variant t024 (11-12-21-17-34-24-34-22-25 [n = 42]), both belonging to ST8, were identified (the extra repeat [19] is shown in boldface). All isolates typed as SCCmec IVa. However, significant genetic, epidemiological, and clinical differences were found, as shown in Tables ​Tables11 and ​and2.2. Patients infected with t008 isolates were significantly younger than patients infected with t024 isolates (P < 0.01). Patients acquired t008 MRSA in the community (50%) or through travel abroad (21%), and infections were predominantly SSTIs (94%). In contrast, the majority of patients with t024 MRSA were either hospitalized (26%) or had health care-associated risk factors (38%), and they presented with SSTIs (64%) but, also, a larger variety of infections, including fatal respiratory tract infections (11%) and operation- and procedure-related infections (11%). Remarkably, no t024 MRSA cases were imported.Open in a separate windowFIG. 1.Unweighted pair group method with arithmetic mean (UPGMA) dendrogram of SmaI PFGE profiles from Danish MRSA isolates (2000 to 2005) constructed by the use of Dice determinations (optimization, 1.0%; tolerance, 2.1 to 3.1%). The reference strains are USA300 and USA500. Note that t008 and t024 isolates do not cluster separately by PFGE.

TABLE 1.

Bacteriological, epidemiological, and clinical data obtained for patients infected or colonized with either t008 or t024 in Denmark (1999 to 2005)

Antibodies to Staphylococcus aureus Bone Sialoprotein-Binding Protein Indicate Infectious Osteomyelitis

Discrimination of soft tissue infection from osteomyelitis in diabetic foot infections is a common clinical problem. Staphylococcus aureus isolates from patients with osteomyelitis express bone sialoprotein-binding protein (Bbp) that binds the bone matrix protein bone sialoprotein. The serological assay with Bbp discriminated cases of osteomyelitis from soft tissue infections in patients with diabetic foot ulcers.Staphylococcus aureus is the most prevalent bacterium in human skeletal infections, causing osteomyelitis and septic arthritis. S. aureus is frequently found in diabetic foot infections, including osteomyelitis and soft tissue infections, and in addition occurs in endocarditis, pneumonia, and septicemia (1, 5, 7, 11, 25, 26, 29). S. aureus from osteomyelitis and septic arthritis binds bone sialoprotein (BSP) via a cell wall glycoprotein, BSP-binding protein (Bbp), belonging to the Sdr family (20). The Sdr family comprises several microbial surface components recognizing adhesive matrix molecules (16, 19, 28). Bbp from S. aureus strain O24 is a 97-kDa protein, having an A and a B domain with 76% and 96% identity, respectively, with the corresponding domains in SdrE (8, 12). SdrE is associated with platelet activation (14) but negatively correlated with bone infection (24). Expression of the S. aureus gene bbp correlates with genes for methicillin (meticillin) resistance and Panton-Valentine leukocidin, but its geographical distribution varies (2, 13, 15).The present study was prompted by the desire to evaluate levels of antibodies to Bbp in serum samples from patients with different types of infection and to confirm whether the correlation between the location of infection and the BSP-binding ability of staphylococci previously reported (18, 22) is reflected by the ability of the bacteria to evoke an immune response against Bbp. We investigated the immunological response as levels of immunoglobulin G (IgG) antibodies to Bbp in sera from patients suffering from infections caused by S. aureus by using an enzyme-linked immunosorbent assay (21) based on recombinant Bbp (28). Microtiter plates were coated with Bbp-glutathione S-transferase (GST) fusion protein (28) (5 μg/ml), recombinant SdrE (14) (5 μg/ml), or GST (5 μg/ml) alone or with the commercially available antigens (PhPlate, Stockholm, Sweden) (4, 6, 9, 23) alpha-toxin (4 μg/ml) or teichoic acid (4 μg/ml). Plates were incubated with patient sera serially diluted in phosphate-buffered saline with Tween 20. Bound human IgG was detected by phosphatase-conjugated mouse anti-human antibodies, and the optical density at 405 nm was recorded at 30-min intervals over 2 h (21). The titers of IgG antibodies for teichoic acid and alpha-toxin were within the range seen by using a commercial enzyme-linked immunosorbent assay (4, 6, 9, 23). Titers of IgG antibodies against the recombinant Bbp protein were lower by 1 order of magnitude within the 2-h development time (Table ​(Table1)1) . Cutoff values were set at 2 standard deviations (SD) above the mean titer for healthy blood donors (1:90 for Bbp, 1:1,000 for alpha-toxin, 1:1,050 for teichoic acid, and 1:68 for SdrE) for the selected time of development. The Mann-Whitney test was applied for statistical analysis of the results for two-group analyses, and the Kruskal-Wallis post hoc Dunn procedure was applied in multiple-group analyses (Table ​(Table22).

TABLE 1.

Titers of antibodies to Bbp, alpha-toxin, teichoic acid, and SdrE

Comparison of the BD Phoenix System with the Cefoxitin Disk Diffusion Test for Detection of Methicillin Resistance in Staphylococcus aureus and Coagulase-Negative Staphylococci

The BD Phoenix system was compared to the cefoxitin disk diffusion test for detection of methicillin (meticillin) resistance in 1,066 Staphylococcus aureus and 1,121 coagulase-negative staphylococcus (CoNS) clinical isolates. The sensitivity for Phoenix was 100%. The specificities were 99.86% for S. aureus and 88.4% for CoNS.Infections caused by methicillin (meticillin)-resistant Staphylococcus aureus (MRSA) or coagulase-negative staphylococci (CoNS) are an increasing problem worldwide (1). Methicillin resistance is primarily due to the presence of a mecA gene which encodes penicillin binding protein 2a (PBP2a) (4).Detection of the mecA gene or PBP2a is considered the gold standard for detecting mecA-mediated methicillin resistance in staphylococci. Among available phenotypic methods, the Clinical and Laboratory Standards Institute (CLSI) has recently introduced the cefoxitin disk diffusion (DD) test for predicting the presence of mecA in S. aureus and CoNS (5, 6), which is preferred over the oxacillin DD test (21). Automated systems are widely used for species identification and susceptibility testing. The aim of the present study was to evaluate the performance of the BD Phoenix automated system (BD, Sparks, MD) in determining methicillin resistance in comparison to the cefoxitin DD test.The study was performed on 1,066 S. aureus isolates and 1,121 CoNS collected during the 2006-2007 routine clinical laboratory activity at the University Hospital of Perugia, Italy. Strains were isolated from the inpatient population of surgical and medical wards and, to a lesser extent, from the outpatient population. Some strains came from other laboratories, for which we are the reference center. Isolates obtained from consecutive cultures from the same patient were excluded. Identification of the isolates was done by conventional methods (colony pigmentation, hemolysis, coagulase production, and the clumping factor test), the Phoenix system (BD), and, in selected cases, the API Staph system (bioMérieux, Marcy l''Etoile, France). Isolates were tested with the cefoxitin DD test, which was performed using Mueller-Hinton agar plates (bioMérieux) and 30-μg cefoxitin disks (bioMérieux) and interpreted according to current CLSI breakpoints (6), and with PMIC/ID gram-positive Phoenix panels (BD), which were prepared from subcultures on Columbia sheep blood agar (BD) after isolation on primary plates, according to the manufacturer''s instructions. The agreement between both methods was considered the “consensus result.” PB2a expression, as detected by the latex agglutination test (Denka Seiken Co., Niigata, Japan), was used to resolve discrepancies. The test was carried out according to the manufacturer''s instructions on uninduced inocula for S. aureus (3, 22, 23) or inocula induced with a 1-μg oxacillin disk for CoNS (13, 14, 17). Methicillin susceptibility in PBP2a-negative CoNS strains was confirmed by mecA gene testing, performed with a LightCycler instrument (Roche Diagnostics, Indianapolis, IN) as described elsewhere (17). For S. aureus, PBP2a-positive isolates were considered methicillin resistant, while PBP2a-negative isolates were considered susceptible. For CoNS, PBP2a-positive isolates were considered methicillin resistant, while PBP2a-negative isolates were considered susceptible, when confirmed as negative for mecA. Categorical disagreements were classified as very major errors (VMEs; false identification of susceptibility by the Phoenix system) and major errors (MEs; false identification of resistance by the Phoenix system). VME and ME rates were calculated using the numbers of reference isolates confirmed as resistant and susceptible, respectively, as denominators. The Phoenix sensitivity rate was the number of strains identified as methicillin resistant by the Phoenix system over the total number of strains confirmed as resistant, and the Phoenix specificity rate was the number of strains identified as methicillin susceptible by the Phoenix system over the total number of strains confirmed as susceptible.Phoenix detection of MRSA is based on both oxacillin and cefoxitin MICs, interpreted according to CLSI breakpoints (for oxacillin, susceptible with MICs of ≤2 μg/ml and resistant with MICs of ≥4 μg/ml; for cefoxitin, susceptible with MICs of ≤4 μg/ml and resistant with MICs of ≥8 μg/ml) (7), in that if either oxacillin or cefoxitin MIC testing indicates that the isolate is resistant, the Phoenix final report is methicillin resistance. Among 1,066 S. aureus isolates, the cefoxitin DD test results and the Phoenix final reports were concordant for 718 methicillin-susceptible and 347 methicillin-resistant strains and discordant for only 1 strain, which was identified as susceptible by the cefoxitin DD test (diameter of 32 mm) and resistant by the Phoenix system (oxacillin MIC, >2 μg/ml; cefoxitin MIC, >4 μg/ml). This strain was negative for PBP2a. Moreover, it was identified as susceptible to oxacillin (MIC = 1 μg/ml) and cefoxitin (MIC = 4 μg/ml) by macrodilution testing according to the CLSI guidelines. Thus, it was finally referred to as methicillin susceptible (one ME; ME rate, 0.14%; 99.86% specificity). Indeed, considering separately the Phoenix oxacillin and cefoxitin MIC results, six S. aureus strains falsely identified as susceptible to oxacillin (six VMEs; VME rate, 1.73%) and one strain falsely identified as susceptible to cefoxitin (one VME; VME rate, 0.29%) were finally reported correctly by the Phoenix expert system, based on cefoxitin and oxacillin results, respectively. These strains were all identified as resistant by the cefoxitin DD test and were PBP2a positive. Thus, the Phoenix sensitivity was 100% and the specificity was 99.86%, provided that both oxacillin and cefoxitin MICs were determined in the panel.Unlike for S. aureus, oxacillin MIC alone is used by the Phoenix system to detect methicillin resistance in CoNS, interpreted according to CLSI breakpoints (for Staphylococcus lugdunensis, susceptible with MICs of ≤2 μg/ml and resistant with MICs of ≥4 μg/ml; for CoNS other than S. lugdunensis, susceptible with MICs of ≤0.25 μg/ml and resistant with MICs of ≥0.5 μg/ml). Moreover, the Phoenix expert system suggests user testing for PBP2a or mecA CoNS isolates (except Staphylococcus epidermidis) with MICs for oxacillin between 0.5 and 2 μg/ml, as recommended by the CLSI (7).The 1,121 CoNS studied included 629 S. epidermidis isolates, 169 Staphylococcus haemolyticus isolates, 101 S. hominis isolates, 66 S. capitis isolates, 63 CoNS not identified at the species level, 25 S. lugdunensis isolates, 22 S. simulans isolates, 17 S. warneri isolates, 15 S. saprophyticus isolates, 4 S. cohnii isolates, 4 S. sciuri isolates, 4 S. xylosus isolates, 1 S. caprae isolate, and 1 S. intermedius isolate. All CoNS not identified at the species level had been confirmed by a clumping factor test not to be S. lugdunensis, for which the cefoxitin DD and oxacillin MIC tests have different interpretation criteria.Among 25 S. lugdunensis isolates, concordant results were obtained for 24 susceptible isolates, while 1 isolate was discordant, being susceptible by the cefoxitin DD test (diameter 32 mm) and resistant by the Phoenix oxacillin test (MIC > 2 μg/ml). The result for the latex test for PBP2a was positive, and the isolate was finally identified as methicillin resistant, in accordance with the automated system. Among the other 1,096 CoNS, results were concordant for 304 methicillin-susceptible and 741 methicillin-resistant strains. Discrepant results were obtained for 51 strains, all identified as susceptible by the cefoxitin DD test and resistant by the Phoenix oxacillin test, with 47 having MICs between 0.5 and 2 μg/ml and 4 having MICs of >2 μg/ml. The latex test for PBP2a, performed after oxacillin induction, showed positive results for 8/51 strains, thus confirming them as methicillin resistant, and negative results for 43 strains. All 43 PBP2a-negative strains were tested for mecA by real-time PCR and were confirmed to be methicillin susceptible, being negative for the mecA gene (Table ​(Table1).1). Thus, among 1,121 CoNS (including S. lugdunensis), 43 MEs and no VMEs were recorded for the automated system, resulting in 88.4% specificity and 100% sensitivity.

TABLE 1.

Resolution of discrepancies among CoNS identified as methicillin susceptible by cefoxitin DD testing and methicillin resistant by Phoenix oxacillin MIC testing