Changes in body adiposity in girls and boys from the rural areas of East Poland over a time span of 20 years

INTRODUCTION: Excess adiposity is one of the major causes of a number of developing civilization diseases, hence increasing adiposity levels in populations of various countries over years have raised considerable attention worldwide. OBJECTIVE: The study aimed to evaluate the character, dynamics and tendencies in adiposity changes in the population of children and youths from the rural areas of East Poland over the last 20 years. MATERIAL AND METHODS: Body adiposity was evaluated using BMI values, fatty tissue content (in % and kg), and measurements of three skinfolds. The results obtained in the years 1999-2000 were compared with those reported for rural children and youths from that area in 1980. RESULTS: Total body adiposity as well as adiposity of individual body parts were observed to increase considerably in the years 1980-2000. The highest adiposity gains were reported in the puberty period. CONCLUSIONS: The maintenance of the secular trend in body adiposity of children and youths from the rural areas of East Poland was observed in the experiment. The extent of those changes appeared to be differentiated depending on the adiposity measure applied, as well as sex and stage of ontogenetic development of subjects.     

Changes in body adiposity in girls and boys from the rural areas of East Poland over a time span of 20 years

Introduction: Excess adiposity is one of the major causes of a number of developing civilization diseases, hence increasing adiposity levels in populations of various countries over years have raised considerable attention worldwide.

Objective: The study aimed to evaluate the character, dynamics and tendencies in adiposity changes in the population of children and youths from the rural areas of East Poland over the last 20 years.

Material and methods: Body adiposity was evaluated using BMI values, fatty tissue content (in % and kg), and measurements of three skinfolds. The results obtained in the years 1999–2000 were compared with those reported for rural children and youths from that area in 1980.

Results: Total body adiposity as well as adiposity of individual body parts were observed to increase considerably in the years 1980–2000. The highest adiposity gains were reported in the puberty period.

Conclusions: The maintenance of the secular trend in body adiposity of children and youths from the rural areas of East Poland was observed in the experiment. The extent of those changes appeared to be differentiated depending on the adiposity measure applied, as well as sex and stage of ontogenetic development of subjects.

Résumé. Introduction: L’excès d’adiposité étant l’une des causes majeures d’un certain nombre de maladies associées au développement économique, son accroissement dans les populations de diverses nations au fil des années, a soulevé une préoccupation dans le monde entier.

Objectif: Cette étude a pour but d’évaluer le caractère, la dynamique et les tendances des changements d’adiposité dans la population des enfants et des adolescents des régions rurales de l’est de la Pologne au cours des vingt dernières années.

Matériel et méthodes: L’adiposité corporelle a été estimée par les valeurs d’IMC, du contenu en tissus de réserve (en % et kg) et par les mesures de trois plis cutanés. Les résultats obtenus pour les années 1999–2000, ont été comparés avec ceux des enfants et adolescents de cette même région en 1980.

Résultats: L’adiposité corporelle totale ainsi que l’adiposité de diverses parties du corps s’est accrue considérablement pendant les années 1980–2000. Les gains les plus élevés sont observés pendant la puberté.

Conclusion: On a observé la poursuite de la tendance séculaire à l’accroissement d’adiposité des enfants et des adolescents de l’est de la Pologne. L’importance de ces changements est variable suivant la mesure effectuée ainsi que suivant le sexe et le stade de développement ontogénique des sujets.

Zusammenfassung. Einführung: Extreme Adipositas ist einer der Hauptgründe für die Entstehung einer Anzahl von Zivilisationskrankheiten. Aus diesem Grunde hat in den vergangenen Jahren die Zunahme der Adipositas in Völkern verschiedener Länder für erhebliche Aufmerksamkeit gesorgt.

Vorhaben: Die Studie zielte auf die Beurteilung von Charakter, Dynamik und weiterer Entwicklung von Adipositasveränderungen in den letzten 20 Jahren bei Kindern und Jugendlichen aus ländlichen Gebieten Ostpolens.

Material und Methoden: Adipositas wurde über BMI-Werte, Anteil an Fettgewebe (in % und kg) und Messungen von drei Hautfaltendicken definiert. Die Ergebnisse aus den Jahren 1999–2000 wurden mit Daten von Landkindern und -Jugendlichen derselben Gegend aus dem Jahr 1980 verglichen.

Ergebnisse: Gesamtkörperfettgehalt und der Fettgehalt einzelner Körperteile sind in den Jahren 1980–2000 offenbar erheblich angestiegen. Die höchste Zunahme an Adipositas wurde während der Pubertät beobachtet.

Zusammenfassung: Es wurde in unserer Untersuchung ein stetiger säkularer Trend an Adipositas bei Kindern und Jugendlichen aus ländlichen Gebieten Ostpolens beobachtet. Das Ausmaß dieser Veränderungen schien in Abhängigkeit von der jeweils verwendeten Messmethode, vom Geschlecht und vom Entwicklungsstand des Probanden zu differieren.

Resumen. Introducción: El exceso de adiposidad es una de las principales causas de una serie de enfermedades de las civilizaciones en desarrollo, por lo que el incremento durante años en los niveles de adiposidad en las poblaciones de varios países ha despertado una considerable atención en todo el mundo.

Objetivo: El estudio pretende evaluar el carácter, la dinámica y las tendencias de los cambios de la adiposidad en la población de niños y jóvenes de las áreas rurales del este de Polonia, durante los últimos 20 años.

Material y métodos: La adiposidad corporal se evaluó utilizando los valores del IMC, el contenido del tejido adiposo (en % y en kg) y las medidas de tres pliegues de grasa subcutánea. Los resultados obtenidos durante los años 1999–2000 se compararon con los señalados para los niños y jóvenes rurales de esa misma área en 1980.

Resultados: Se observó que la adiposidad corporal total, así como la adiposidad de partes individuales del cuerpo, ha aumentado considerablemente entre los años 1980–2000. Los mayores incrementos en la adiposidad han correspondido al periodo de la pubertad.

Conclusiones: En la investigación se observa el mantenimiento de la tendencia secular de la adiposidad corporal en los niños y jóvenes de las áreas rurales del este de Polonia. La magnitud de estos cambios parece ser distinta dependiendo de la medida de adiposidad considerada, así como del sexo y del estadio del desarrollo ontogénico de los sujetos estudiados.     

Synthesis of Water‐Soluble Copolymers Carrying Long‐Chain (C12 to C30) Aliphatic Moieties

Water‐soluble copolymers from mono‐1‐alkyl itaconates and N‐vinyl‐2‐pyrrolidone are synthesized and characterized. The mono‐1‐alkyl itaconates are prepared from itaconic anhydride and the related alcohol: 1‐dodecanol, 1‐octadecanol, 1‐docosanol, and 1‐triacontanol. The mono‐1‐triacontyl itaconate is synthesized from plant growth regulator policosanols extracted from Agave fourcrouydes, where 1‐triacontanol is the major product. The reactivity ratios, calculated according to the Mao‐Huglin method for copolymerizations conducted to medium‐high conversions, indicate a tendency toward alternation for all copolymerization reactions. Water solubility of copolymers is provided as a function of copolymer composition and aliphatic chain length.

     

Long‐term changes in the ipsilateral substantia nigra after transient focal cerebral ischaemia in rats

Transient focal cerebral ischaemia can cause neuronal damage in remote areas, including the ipsilateral thalamus and subsutantia nigra, as well as in the ischaemic core. In the present study, we investigated long‐term changes in the ipsilateral substantia nigra from 1 up to 20 weeks after 90 min of transient focal cerebral ischaemia in rats, using tyrosine hydroxylase (TH), neuronal nuclei (NeuN), Iba‐1, glial fibrillary acidic protein (GFAP) and brain‐derived neurotrophic factor (BDNF) immunostaining. These results show that transient focal cerebral ischaemia in rats can cause a severe and prolonged neuronal damage in the ipsilateral striatum. Our results with TH and NeuN immunostaining also demonstrate that the atrophy of the ipsilateral substantia nigra after transient focal cerebral ischaemia was not static but progressive. Furthermore, our double‐labelled immunohistochemical study suggests that BDNF released by GFAP‐positive astrocytes may play a key role in the survival of dopaminergic neurones in the ipsilateral substantia nigra at the chronic stage after transient focal cerebral ischaemia, although the areas of the ipsilateral substantia nigra are decreased progressively after ischaemia. Thus our study provides further valuable information for the pathogenesis of neuronal damage after transient focal cerebral ischaemia.     

Well‐being changes in response to 30 years of regional integration in Maya populations from Yucatan,Mexico

Infant mortality rate (IMR), overall frequency of linear enamel hypoplasia (LEH), sexual dimorphism in LEH, age of onset of LEH, and age at menarche were used as indicators to test the hypothesis that the origin and development of the tourist industry and increased state participation on Maya subsistence agriculturists in the early 1970s had improved the well‐being of the Maya. Two historical moments where inferred from the data. The first was derived from cheap and effective immunization and sanitation campaigns that reduced IMR from 143.4/1,000 live births in the early 1960s to 97.4 in the early 1970s. State participation broke the undernutrition–disease cycle enough to reduce LEH frequencies significantly (from 71.9% in individuals born before 1971 to 51.5% in those born in 1971 or after, χ² = 55.72; 1 df; α = 0.00001) and to eliminate the sex difference in LEH expression (from a 14.8% LEH difference between men and women before 1971 [Male/Female Odds Radio = 0.45, α significant at 0.05] to a nonsignificant 2% difference). Improvement in overall living conditions reflected in a “modern stage” infant mortality regime and an almost disappearance of LEHs, resulted from gradual improvements in living conditions that did not become apparent until the 1980s. Trends in the age at menarche are not statistically significant, probably due to methodological limitations. However, if overall living conditions continue to improve or stay as they are today, accelerations in maturation should become noticeable. Am. J. Hum. Biol. 13:590–602, 2001. © 2001 Wiley‐Liss, Inc.     

Long‐term human immune system reconstitution in non‐obese diabetic (NOD)‐Rag (–)‐γ chain (–) (NRG) mice is similar but not identical to the original stem cell donor

The murine immune system is not necessarily identical to it human counterpart, which has led to the construction of humanized mice. The current study analysed whether or not a human immune system contained within the non‐obese diabetic (NOD)‐Rag1^null‐γ chain^null (NRG) mouse model was an accurate representation of the original stem cell donor and if multiple mice constructed from the same donor were similar to one another. To that end, lightly irradiated NRG mice were injected intrahepatically on day 1 of life with purified cord blood‐derived CD34⁺ stem and progenitor cells. Multiple mice were constructed from each cord blood donor. Mice were analysed quarterly for changes in the immune system, and followed for periods up to 12 months post‐transplant. Mice from the same donor were compared directly with each other as well as with the original donor. Analyses were performed for immune reconstitution, including flow cytometry, T cell receptor (TCR) and B cell receptor (BCR) spectratyping. It was observed that NRG mice could be ‘humanized’ long‐term using cord blood stem cells, and that animals constructed from the same cord blood donor were nearly identical to one another, but quite different from the original stem cell donor immune system.     

Sex differences in the pattern of age‐dependent increase in the BMI from 20–59 years

This study tested the hypothesis of a linear increase of the BMI with age among adults. Materials comprised 32,762 occupationally active females and males 23–59 years age resident in Wroclaw, southwestern Poland. All subjects were medically examined in the course of health screening. The BMI increases linearly with age in women, but increases with age in men in two stages—a more intensive rise between 20–40 years and much slower increase between 40–60 years. This hypothesis was verified with a linear regression model in women but for men piecewise regression with a break at 40 years of age fits the age trends. Am. J. Hum. Biol. 14:693–698, 2002. © 2002 Wiley‐Liss, Inc.     

Bacteriological study of shigellosis in the Lake Kivu area (Central Africa). Developments in the last 15 years (1968-1983)

1913 Shigella strains were isolated from 1968 to 1983 in lake Kivu area (Central Africa). Distribution and evolution of serotypes, biotypes and antibiotypes were studied. The majority of serotypes and biotypes were stable. However, few of these strains showed variations, among them Shigella dysenteriae serotype 1, causing epidemic dysenteriae since 1981. Epidemiologic survey of shigellosis in Kivu seems to be rather underdeveloped (4 bacteriology laboratories for an area of 10 million inhabitants) and the number of registered cases is probably underestimated. This problem is threatening the public health and coordination of laboratory activities, either local or regional, should be improved.     

Multicenter survey of routine determinations of resistance of Helicobacter pylori to antimicrobials over the last 20 years (1990 to 2009) in Belgium

We analyzed the rates of antimicrobial resistance of Helicobacter pylori strains isolated from patients from 1990 to 2009 and identified risk factors associated with resistance. Gastric biopsy specimens were collected from several digestive disease centers in Brussels, Belgium. We routinely performed antimicrobial susceptibility testing for clarithromycin (CLR), metronidazole, amoxicillin, tetracycline, and ciprofloxacin. Evaluable susceptibility testing was obtained for 9,430 strains isolated from patients who were not previously treated for Helicobacter pylori infection (1,527 isolates from children and 7,903 from adults) and 1,371 strains from patients who were previously treated (162 isolates from children and 1,209 from adults). No resistance to amoxicillin was observed, and tetracycline resistance was very rare (<0.01%). Primary metronidazole resistance remained stable over the years, with significantly lower rates for isolates from children (23.4%) than for isolates from adults (30.6%). Ciprofloxacin resistance remained rare in children, while it increased significantly over the last years in adults. Primary clarithromycin resistance increased significantly, reaching peaks in 2000 for children (16.9%) and in 2003 for adults (23.7%). A subsequent decrease of resistance rates down to 10% in both groups corresponded to a parallel decrease in macrolide consumption during the same period. Multivariate logistic regression revealed that female gender, age of the patient of 40 to 64 years, ethnic background, the number of previously unsuccessful eradication attempts, and the different time periods studied were independent risk factors of resistance to clarithromycin, metronidazole, and ciprofloxacin. Our study highlights the need to update local epidemiological data. Thus, the empirical CLR-based triple therapy proposed by the Maastricht III consensus report remains currently applicable to our population.     

Long‐term regeneration of fast and slow murine skeletal muscles after induced injury by ACL myotoxin isolated from Agkistrodon contortrix laticinctus (broad‐banded copperhead) venom

The aim of the present work was to analyze the regenerated muscle types I and II fibers of the soleus and gastrocnemius muscles of mice, 8 months after damage induced by ACL myotoxin (ACLMT). Animals received 5 mg/kg of ACLMT into the subcutaneous lateral region of the right hind limb, near the Achilles tendon; contralateral muscles received saline. Longitudinal and cross sections (10 μm) of frozen muscle tissue were evaluated. Eight months after ACLMT injection, both muscle types I and II fibers of soleus and gastrocnemius muscles still showed centralized nuclei and small regenerated fibers. Compared with the left muscle, the incidence of type I fibers increased in the right muscle (21% ± 03% versus 12% ± 06%, P = 0.009), whereas type II fibers decreased (78% ± 02% versus 88% ± 06%, P = 0.01). The incidence of type IIC fibers was normal. These results confirm that ACLMT induced muscle type fiber transformation from type II to type I, through type IIC. The area analysis of types I and II fibers of the gastrocnemius revealed that injured right muscles have a higher percentage of small fibers in both types I and II fibers (0–1,500 μm²) than left muscles, which have larger normal type I and II fibers (1,500–3,500 μm²). These results indicate that ACLMT can be used as an excellent model to study the rearrangement of motor units and the transformation of muscle fiber types during regeneration. Anat Rec 254:521–533, 1999. © 1999 Wiley‐Liss, Inc.     

Novel genetic polymorphisms in DNA repair genes: O6‐methylguanine‐DNA methyltransferase (MGMT) and N‐methylpurine‐DNA glycosylase (MPG) in lung cancer patients from Poland

Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non‐small‐cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC→TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG→CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59‐bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance. Hum Mutat 14:269‐270, 1999. © 1999 Wiley‐Liss, Inc.     

Histomorphology of the Penis Bone (Baculum) in the Gray Long‐Eared Bat Plecotus austriacus (Chiroptera,Vespertilionidae)

For the first time, the histomorphology of the penis bone of a bat (Plecotus austriacus) was examined in detail. From Plecotus austriacus, 14 whole penes and 11 isolated bacula were studied and compared to bacula of Plecotus auritus and Plecotus macrobullaris. The baculum was located on specimen microradiographs and in micro‐CT images in the tip of the penis. Using serial semithin sections and surface‐stained, undecalcified ground sections, the types of bone and other tissues constituting the baculum were examined by light microscopy. 3D reconstructions were generated from the serial semithin sections and from micro‐CT images. The shaft and the proximal branches of the Y‐shaped baculum form a tubular bone around a medullary cavity. Since the small diameter of this channel and the main lamellar bone around it resemble a Haversian canal, the baculum is equivalent to a single‐osteon bone. Several oblique nutrient canals enter this medullary cavity in the shaft and branches. All ends of the baculum consist predominantly of woven bone. The collagen fiber bundles of the tunica albuginea of both corpora cavernosa insert via fibrocartilage into the woven bone of the branches. Thus, the microscopic structures support the hypothesis that the baculum functions as a stiffening element in the erect penis. In this study, several microscopic imaging techniques were evaluated for displaying the microscopic structures of the baculum. Specimen microradiography, but especially micro‐CT proved to be suitable nondestructive methods for accurate and reproducible demonstration and comparison of the three‐dimensional structures of the baculum in different bat species. Anat Rec 293:1248–1258, 2010. © 2010 Wiley‐Liss, Inc.     

Prevalence of Deafness‐Associated Connexin‐26 (GJB2) and Connexin‐30 (GJB6) Pathogenic Alleles in a Large Patient Cohort from Eastern Sicily

Mutations in the gene encoding the gap junction protein connexin 26 (GJB2) and connexin 30 (GJB6) have been shown to be a major contributor to prelingual, sensorineural, nonsyndromic deafness. The aim of this study was to characterize and establish the prevalence of GJB2 and GJB6 gene alterations in 196 patients affected by sensorineural, nonsyndromic hearing loss, from Eastern Sicily. We performed sequence analysis of GJB2 and identified sequence variants in 68 out of 196 patients (34.7%); (28 homozygous for c.35delG, 22 compound heterozygous and 11 with only one variant allele). We found 12 different allelic variants, the most prevalent being c.35delG, which was found on 89 chromosomes (65.5%), followed by other alleles with different frequencies (p.E47X, c.‐23+1G>A, p.L90P, p.R184W, p.M34T, c.167delT, p.R127H, p.M163V, p.V153I, p.W24X, and p.T8M). Importantly, for the first time we present the frequency and spectrum of GJB2 mutations in NSHL patients from Eastern Sicily. No alterations were found in the GJB6 gene, confirming that alterations in this gene are uncommon in our geographic area. Note that 65.3% and 23.5% of our patients, respectively were found to be negative or carriers by GJB2 molecular screening. This emphasizes the need to broaden the genetic analysis to other genes involved in hearing loss.     

Molecular Motions in the Supramolecular Complexes between Poly(ε‐caprolactone)‐Poly(ethylene oxide)‐Poly(ε‐caprolactone) and α‐ and γ‐Cyclodextrins

The structure and molecular motions of the triblock copolymer PCL‐PEO‐PCL and its inclusion complexes with α‐ and γ‐cyclodextrins (α‐ and γ‐CDs) have been studied by solid‐state NMR. Different cross‐polarization dynamics have been observed for the guest polymer and host CDs. Guest–host magnetization exchange has been observed by proton spin lattice relaxation T₁, proton spin lattice frame relaxation T_1ρ and 2D heteronuclear correlation experiments. A homogeneous phase has been observed for these complexes. Conventional relaxation experiments and 2D wide‐line separation NMR with windowless isotropic mixing have been used to measure the chain dynamics. The results show that for localized molecular motion in the megahertz regime, the included PCL block chains are much more mobile than the crystalline PCL blocks in the bulk triblock copolymer. However, the mobility of the included PEO block chains is not very different from the amorphous PEO blocks of the bulk sample. The cooperative, long chain motions in the mid‐kilohertz regime for pairs of PCL‐PEO‐PCL chains in their γ‐CD channels seem more restricted than for the single PCL‐PEO‐PCL chains in the α‐CD channels, however, they are not influencing the more localized, higher frequency megahertz motions.