Anaplastic thyroid carcinoma: diagnostic challenges,histopathologic features and ancillary testing

Anaplastic thyroid carcinoma (ATC) is an aggressive thyroid malignancy with high mortality rate. This malignancy arises in thyroid follicular cells either denovo or with an associated differentiated thyroid carcinoma component. Clinically, it usually presents as a rapidly enlarging mass, pain and locally compressive symptoms. Histopathologic variability and heterogeneity often pose diagnostic challenges, especially in scant and paucicellular specimens. This article describes the clinical, histopathologic and molecular features of ATC and also addresses the associated diagnostic limitations and challenges.     

A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

A perception-based study to explore COVID-19 pandemic stress and its factors in Bangladesh

Background and aimsWorldwide the COVID-19 pandemic has accelerated sufferings of mental health and behaviour attitudes of people. Many countries, including Bangladesh, reported suicide as extreme consequences of the psychological burden influenced by COVID-19. The present study explores human stress and its factor influenced by COVID-19 in Bangladesh, which significantly affect the quality of life.MethodsAn online-based questionnaire survey was conducted among 651 adult Bangladeshi populations by capturing socio-demographic information, possible human stress, and consequences of the pandemic. A set of statistical tools such as Pearson's Correlation Matrix (PCM), T-test, Principal Component Analysis (PCA) and Hierarchical Cluster Analysis (HCA) were applied to identify the relationship between different factors and influential factors increasing human stress.ResultsMore than 83% of the participants are facing COVID-19 related mental stress, which results in short temper, sleep disorder, and family chaos. PCA and HCA outcomes indicated a significant relationship between the respondents' opinions and human stress factors, which harmonized with the country's existing scenario. PCM results enlighten the relationship between human stress factors and found financial hardship, cutting back daily spending, and food crisis are interconnected together causes stress. Also, hampering students' formal education and future career plans significantly contribute to mental stress.ConclusionBased on the above findings, it's crucial to introduce a time-oriented strategy and implement precaution monitoring plans for Bangladesh. The rescue plan will help people to manage the pandemic and improve mental health to fight against psychological challenges related to COVID-19 and future pandemics.     

Tobacco consumption,opium use,alcohol drinking and the risk of esophageal cancer in North Khorasan,Iran

Background: There are some unique epidemiological characteristics of esophageal cancer in Iran. The objective of this study was finding the association between tobacco, substance and alcohol using with the risk of esophageal cancer in North Khorasan, Iran.

Methods: This Case-Control study was carried out on 96 patients with esophageal cancer and 187 controls. Controls were matched to cases by age and sex. Data were collected through structured interview. Data were analyzed by using chi-square test, T-test and logistic regression, in Stata software version 12.

Results: Our findings show Hookah smoking [OR = 6.1(CI_95%:1.2–13.1)] and opium consumption [OR = 2.1(CI_95%:1.2–3.5)] were associated with esophageal cancer. Cigarette and pipe smoking, age of onset of smoking, duration of smoking, number of smoking per day, leaving history of smoking, years of leaving smoking, drug withdrawal, number of times of drug withdrawal, a history of drug relapse, alcohol consumption and alcohol dose–response were not related to esophageal cancer.

Conclusion: According to our results, hookah smoking and opium consumption enhance the risk of esophageal cancer in North Khorasan of Iran. We suggest appropriate planning to prevent the esophageal cancer in this district.