排序方式: 共有30条查询结果,搜索用时 15 毫秒
1.
2.
Abdul H. Kandhro Virapong Prachayasittikul Chartchalerm Isarankura Na-Ayudhya 《Hemoglobin》2017,41(3):157-163
Among microcytic hypochromic anemias, the most common disorders are iron deficiency anemia and co-pathological conditions such as α- or β-thalassemia (α- or β-thal) traits. The aim of the present study was to determine the frequency and prevalence of iron deficiency anemia and α- or β-thal traits based on clinical laboratory data across different ethnic groups in five districts of Sindh Province, Pakistan. The present retrospective study analyzed 3 years (2012–2015) of encoded and unlinked clinical laboratory data, and identified 3030 microcytic hypochromic anemia cases. The data contained complete blood counts (CBCs) with smear morphology examinations, serum ferritin levels, and hemoglobin (Hb) electrophoreses. After reviewing the data, 994 confirmed subjects (iron deficiency anemia and α- and β-thal traits) were then selected for the present study. The prevalence of α- and β-thal traits was highest in Badin district (35.27%), while the prevalence of iron deficiency anemia was highest in Larkana district (30.73%). According to the ethnic-wise distribution, higher numbers of α- and β-thal trait cases were seen in the Sindhi ethnic group [375 (64.21%) and 283 (69.02%), respectively] than in the other ethnic groups. In addition, a higher distribution of β-thal trait cases was observed in the Sindhi ethnic group [n?=?327 (56%)] in α- and β-thal cases overall. Findings from the present study strongly suggested that screening is important not only for β-thal trait but also other traits as well. However, careful monitoring of CBC parameters, including red blood cell (RBC) indices and morphology, along with clinical findings are essential to diagnose carrier cases, especially in high prevalence areas. 相似文献
3.
4.
Bharnthong T Prachayasittikul V Isarankura Na Ayudhya C Premchaiporn P Khow O Sitprija V 《The Southeast Asian journal of tropical medicine and public health》2005,36(4):970-975
This study was aimed to develop a dry purified protein devirative (PPD) preparation to extend the shelf-life of tuberculin PPD. Five percent sucrose (S), 6.5% mannitol (M), 2.5% trehalose (T) or 0.3% Hemaccel (H) was added to each formulation. In vivo and in vitro analyses were carried out to determine the efficacy of the lyophilized products. In the in vivo test, the delayed type hypersensitivity (DTH) responses of the lyophilized preparations were compared to the liquid preparation (CL) after injection into BCG vaccinated guinea pigs. The preparations of H, M, T, and S generated DTH responses of 100, 90, 89, and 60%, as compared to the response of CL, respectively. There was no loss of tuberculin activity in the H formula. A statistically significant difference in activity was found between S and CL (p < 0.05). The cellular test for IFN-gamma secretions was performed using the whole blood of human subjects screened for DTH response to tuberculin PPD Mantoux tests. The detection of IFN-gamma secretions was done using ELISA and the efficacy was expressed in terms of percentage of IFN-gamma responses to the tuberculin antigens. The results of CL, H, M, T and S were 3.28, 10.40, 0.84, 1.52 and 1.29%, compared to mitogen stimulation, respectively. The lyophilized H, M and T formulations and the liquid CL were studied for their shelf-life stabiliy. Accelerated degradation was done by storing the samples at higher temperatures of 37 degrees C and 56 degrees C for 3, 6, 9 and 12 months. All the tuberculin PPD solutions were injected into BCG vaccinated guinea pigs at the end of each storage period and the activity of each solution was evaluated. The formulation with the Hemaccel as excipient gave a superior response than the others at the normal storage temperature of 40 micro C for 12 months. Therefore, Hemaccel provides protection for PPD activity. This supports the potential for the development of lyophilized tuberculin PPD with the addition of 0.3% Hemaccel to extend shelf life. 相似文献
5.
6.
Nantasenamat C Isarankura-Na-Ayudhya C Prachayasittikul V 《Expert opinion on drug discovery》2010,5(7):633-654
Importance of the field: The past decade had witnessed remarkable advances in computer science which had given rise to many new possibilities including the ability to simulate and model life's phenomena. Among one of the greatest gifts computer science had contributed to drug discovery is the ability to predict the biological activity of compounds and in doing so drives new prospects and possibilities for the development of novel drugs with robust properties. Areas covered in this review: This review presents an overview of the advances in the computational methods utilized for predicting the biological activity of compounds. What the reader will gain: The reader will gain a conceptual view of the quantitative structure-activity relationship paradigm and the methodological overview of commonly used machine learning algorithms. Take home message: Great advancements in computational methods have now made it possible to model the biological activity of compounds in an accurate manner. To obtain such a feat, it is often necessary to forgo several data pre-processing and post-processing procedures. A wide range of tools are available to perform such tasks; however, the proper selection and piecing together of complementary components in the prediction workflow remains a challenging and highly subjective task that heavily relies on the experience and judgment of the practitioner. 相似文献
7.
Ratchanok Pingaew Pan Tongraung Apilak Worachartcheewan Chanin Nantasenamat Supaluk Prachayasittikul Somsak Ruchirawat Virapong Prachayasittikul 《Medicinal chemistry research》2013,22(8):4016-4029
Simplified 1,3-disubstituted urea derivatives (11–24) of phenylethylamines, homoveratylamines, 2-pyridylethylamines, 2-picolylamines as well as xylylenediamines were synthesized and investigated for their cytotoxic activities. The results revealed that most analogs displayed cytotoxicity against HepG2 and MOLT-3 cell lines. The bis-thiourea derivatives 23 and 24 exhibited higher inhibitory potency against HepG2 cell than the reference drug, etoposide. 1,1′-(1,3-phenylenebis(methylene))bis(3-(4-chlorophenyl)thiourea) 24 was shown to be the most potent cytotoxic compound against MOLT-3 cell line with an IC50 value of 1.62 μM. QSAR studies suggested that compounds with high ionization potential displayed high cytotoxicity against HuCCA-1 cell line. Furthermore, derivatives with dimethoxyphenyl group had high radial distribution function with a correspondingly high cytotoxicity against A549 cell line. Moreover, analogs 23 and 24 had low values of E HOMO (energy of the highest occupied molecular orbital energy) as well as high cytotoxicity against HepG2 cell line. This study affords an easily accessible approach for the synthesis of promising anticancer agents. The developed QSAR models provided pertinent information into the physicochemical properties governing the investigated biologic properties. 相似文献
8.
Prachayasittikul S Worachartcheewan A Nantasenamat C Chinworrungsee M Sornsongkhram N Ruchirawat S Prachayasittikul V 《European journal of medicinal chemistry》2011,46(2):738-742
Considering that some thiopyrimidines were previously reported as potential therapeutics, the present study achieved novel analogs of bioactive 2-substituted thiopyrimidines-4-(3H)-ones via base catalyzed alkylation reaction of 2-thiouracil using alkyl and aralkyl bromides. The title compounds were 2-(1-butylthio)pyrimidine-4(3H)-one (5a), 2-(2-butylthio)pyrimidine-4(3H)-one (5b), 2-(cyclohexylmethylthio)pyrimidine-4(3H)-one (5c), 2-(benzylthio)pyrimidine-4(3H)-one (5d) and 2-(1-adamantylthio)pyrimidine-4(3H)-one (5e). Bioactivity tests revealed that thiopyrimidines 5a, 5c, 5d and 5e exhibited antimicrobial activity. The thiopyrimidine-4-one (5c) showed complete inhibition against Streptococcus pyogenes and Branhamella catarrhalis as well as antifungal action against Candida albicans. Significantly, the 1-adamantylthiopyrimidine (5e) was shown to be the most potent cytotoxic compound against multidrug-resistant small cell lung cancer (H69AR). Their structure-activity relationships were discussed. 相似文献
9.
Chartchalerm Isarankura-Na-Ayudhya p hd Chanin Nantasenamat p hd Prabhop Dansethakul ms c Pradermchai Saetum bs c Sirikul Laosrivijit bs c Virapong Prachayasittikul p hd 《Nursing & health sciences》2010,12(1):58-66
Diabetes mellitus is a chronic disease that affects > 180 million people worldwide. It is persistent in Thai communities in spite of much effort in prevention and control. This study examined the knowledge capacity of villagers in the Klongmai community of Nakhon Pathom, Thailand, regarding diabetes by way of action research. A health status assessment and a survey of the community were carried out and used as the basis for designing an educational video on diabetes that is accessible regardless of age and educational background. Evaluations of the pre- and poststudy questionnaires were carried out using statistical analysis. The results indicated that the devised educational materials were effective in encouraging the community's self-awareness and perception of diabetes at the significance level of 0.05. Most importantly, the participants demonstrated proficiency in adapting the knowledge gained from the workshop to their own lifestyle. 相似文献
10.
Ratana Lawung Angkana Charoenwatanachokchai Rungrot Cherdtrakulkiat Sivarak Thammapiwan Tharinda Mungniponpan Leif Bülow Virapong Prachayasittikul 《Journal of clinical laboratory analysis》2010,24(1):31-37
The development of antimicrobial resistance of Neisseria gonorrhoeae arising from wide dissemination of resistant clones is a major global health problem. In this study, a total of 235 isolates of N. gonorrhoeae isolated from patients of Bangrak Hospital were tested for their antibiotic susceptibilities to penicillin, norfloxacin, ofloxacin, ciprofloxacin, spectinomycin, and ceftriaxone. Mutation (Ser‐91) in the quinolone resistance determining regions of gyrA and random amplification of the polymorphic DNA polymerase chain reaction (RAPD‐PCR) were examined from 145 isolates. Among these, 55 isolates were obtained during January–March 2000, 46 isolates during January–March 2002, and 44 isolates during October–December 2002. The occurrence of combination resistance between penicillin and quinolone was 20% in January–March 2000, which was increased to 57.8% during the period of October–December 2002 (P<0.0001). Mutation of Ser‐91 in gyrA could be directly linked with the resistance or declining of susceptibility to ciprofloxacin. Using RAPD‐PCR, we could classify the 145 isolates into 4 and 5 groups by primers D11344 (5′‐AGTGAATTCGCGGTGAGATGCCA‐3′) and D8635 (5′‐GAGCGGCCAAAGGGAGCA GAC‐3′), respectively. Combination of the data obtained from these two primers produced 11 fingerprint groups. Our findings conclude that monitoring of the Ser‐91 mutation of gyrA and RAPD‐PCR methods are most useful for epidemiological screening. J. Clin. Lab. Anal. 24:31–37, 2010. © 2010 Wiley‐Liss, Inc. 相似文献