A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

A KRT1 gene mutation related to epidermolytic ichthyosis in a Chinese family

We report a Chinese family with members affected by epidermolytic ichthyosis (EI), caused by KRT gene mutations. The proband was a 14‐year‐old boy who had simultaneous appearance of nephroblastoma and epidermolytic ichthyosis (EI). Both the patient and his mother exhibited the specific clinical and pathological manifestations of EI. We analysed all exons and flanking sequences of the KRT1 and KRT10 genes using PCR, and found that the proband and his mother had a G>C transition at nucleotide position 1432 in exon 7 of KRT1, resulting in an amino acid substitution of glutamate (GAA) to glutamine (CAA) at codon 478 (E478Q). The KRT10 gene had no mutations.     

Porocarcinoma coexisting at a site of Bowen disease in a 63‐year‐old woman

Porocarcinoma is an unusual, locally aggressive and potentially fatal neoplasm. Several cutaneous malignancies have been described in association with porocarcinoma, including squamous cell carcinoma, basal cell carcinoma and tricholemmal carcinoma. Previous reports have indicated that the occurrence of malignant tumours in combination with porocarcinoma is extremely rare, in particular with regard to Bowen disease (BD). We report an uncommon case of porocarcinoma occurring synchronously in a single BD lesion in a 63‐year‐old woman with multiple BD lesions. The clinical and histological findings confirmed this diagnosis.     

Surgical Technique Notes of Arterial Vascular Reconstruction During Kidney Transplantation: Personal Experience and Literature Review

Background

Arterial vascular anomalies in patients undergoing kidney transplantation (KT) are correlated with a higher incidence of early surgical complications, potentially causing graft loss. Arterial reconstruction allows patients to overcome these surgical challenges, thus minimizing the risk of poor outcomes. The aim of the present study is to retrospectively investigate the safety and effectiveness of the multiple arterial reconstruction technique with a Teflon patch in case of an unavailable aortic patch: to do so, surgical complications, graft function, and patient survival were evaluated.

Improvements in epidermal function prevent relapse of psoriasis: a self‐controlled study

While therapeutic approaches for psoriasis are widely available, preventive regimens are lacking. We aimed to determine whether improvements in epidermal function could prevent psoriasis relapse. Two self‐controlled cohort studies were designed, enrolling two cohorts of patients with psoriasis (n = 30 and n = 60) to be treated topically with an in‐house‐prepared emollient or ATOPALM^® cream applied twice daily to one forearm for 20 and 30 days, respectively, while the same sites on the contralateral arm served as the untreated control. Epidermal function on both arms was assessed prior to and at the end of the trials. Delayed relapse on the treated arm was seen in 54.5% and 71% of patients in the first and second cohort, respectively. The time of psoriatic relapse correlated with the extent of abnormalities in baseline epidermal function. These results suggest that improvements in epidermal function with topical emollients can prevent/attenuate the development of psoriasis.     

Tobacco consumption,opium use,alcohol drinking and the risk of esophageal cancer in North Khorasan,Iran

Background: There are some unique epidemiological characteristics of esophageal cancer in Iran. The objective of this study was finding the association between tobacco, substance and alcohol using with the risk of esophageal cancer in North Khorasan, Iran.

Methods: This Case-Control study was carried out on 96 patients with esophageal cancer and 187 controls. Controls were matched to cases by age and sex. Data were collected through structured interview. Data were analyzed by using chi-square test, T-test and logistic regression, in Stata software version 12.

Results: Our findings show Hookah smoking [OR = 6.1(CI_95%:1.2–13.1)] and opium consumption [OR = 2.1(CI_95%:1.2–3.5)] were associated with esophageal cancer. Cigarette and pipe smoking, age of onset of smoking, duration of smoking, number of smoking per day, leaving history of smoking, years of leaving smoking, drug withdrawal, number of times of drug withdrawal, a history of drug relapse, alcohol consumption and alcohol dose–response were not related to esophageal cancer.

Conclusion: According to our results, hookah smoking and opium consumption enhance the risk of esophageal cancer in North Khorasan of Iran. We suggest appropriate planning to prevent the esophageal cancer in this district.