Lipid nanoparticles (LNPs) are becoming popular as a means of delivering therapeutics, including those based on nucleic acids and mRNA. The mRNA-based coronavirus disease 2019 vaccines are perfect examples to highlight the role played by drug delivery systems in advancing human health. The fundamentals of LNPs for the delivery of nucleic acid- and mRNA-based therapeutics, are well established. Thus, future research on LNPs will focus on addressing the following: expanding the scope of drug delivery to different constituents of the human body, expanding the number of diseases that can be targeted, and studying the change in the pharmacokinetics of LNPs under physiological and pathological conditions. This review article provides an overview of recent advances aimed at expanding the application of LNPs, focusing on the pharmacokinetics and advantages of LNPs. In addition, analytical techniques, library construction and screening, rational design, active targeting, and applicability to gene editing therapy have also been discussed. 相似文献
PurposeTo evaluate the midterm outcomes of percutaneous transluminal renal angioplasty (PTRA) for pediatric renovascular hypertension (RVH).Materials and MethodsThe clinical data of patients who underwent PTRA for RVH in the authors’ hospital from 2012 to 2019 were retrospectively analyzed. Postprocedural blood pressure, glomerular filtration rate (GFR) of the affected kidney, restenosis, and complications were closely monitored.ResultsPTRA was performed in a total of 30 children (20 boys and 10 girls), with a mean age of 7.3 years ± 0.7 (range, 40 days to 13.9 years) and a mean weight of 25.0 kg ± 2.3 (range, 3.4–53 kg). The median follow-up period was 26.5 months (range, 1 month to 7.5 years). Technical success was achieved in 26 (86.7%) of the 30 patients. Restenosis developed in 3 patients (10.0%). Only 1 patient underwent stent implantation, and the stent fractured 8 months later, requiring further intervention. There were no other complications. In terms of clinical benefit of blood pressure control after the initial PTRA procedure, 15 patients (50%) were cured and 7 patients (23.3%) showed improvement. There was no significant difference in the etiology, lesion location, and lesion length between patients with clinical benefit and failure (P = .06, P = .202, and P = .06, respectively). GFR of the affected kidney was significantly improved from 19.9 mL/min ± 11.2 to 38.1 mL/min ± 11.9 at the 6-month follow-up after PTRA (P < .001).ConclusionsThe overall results of PTRA for pediatric RVH caused by different etiologies are promising. PTRA not only provided a clinical benefit of blood pressure control in 73.3% of the patients but also significantly improved the function of the affected kidney. 相似文献
Adjuvant irradiation is the standard treatment after breast conservative surgery. Normofractionated regimen with an overall treatment time of 5 to 6 weeks is often considered as a limiting factor for irradiation compliance. In order to answer this issue, moderate and more recently extreme hypofractionated protocols appeared. We report here oncological outcomes and toxicity of hypofractionated breast irradiation. After defining the frame of moderate and extreme hypofractionated breast irradiations based on overall treatment time, patient selection criteria were listed. According to their levels of proof, the results of moderate and extreme hypofractionated breast irradiation were analysed. Overall treatment time for moderate hypofractionated breast irradiation ranged from 3 to 4 weeks, while for extreme hypofractionated breast irradiation, it was less than 1 week. For moderate hypofractionated breast irradiation, whole breast irradiation was currently performed with or without lymph node irradiation. Moderate hypofractionated breast irradiation has proven to be as safe and as efficient as normofractionated breast irradiation with level IA evidence. For extreme hypofractionated breast irradiation, phase III randomized trials confirmed that accelerated partial breast irradiation was non-inferior in terms of local control compared to normofractionated whole breast irradiation (with external beam radiation therapy and multicatheter brachytherapy), with similar acute and late toxicity. While the use of intraoperative breast irradiation remains under debate, new very accelerated partial breast irradiation (overall treatment time not exceeding 2 days) protocols emerged with encouraging results. Accelerated partial breast irradiation is warranted for extreme hypofractionated breast irradiation and is indicated for low-risk breast cancers. Moderate and extreme hypofractionated breast irradiation regimens are validated and can be routinely proposed according to patient selection criteria. 相似文献
??Objective To discuss the influence of basic periodontal therapy on the level of IL-8?? IL-10 in serum and gingival crevicular fluid in patients who have chronic periodontitis complicated by coronary heart disease. Methods A total of 65 cases of patients with chronic periodontitis complicated by coronary heart disease were selected and divided into two groups randomly??Group A of 35 patients who received the basic periodontal therapy and cardiac medical treatment??Group B of 30 patients who received cardiological treatment only. Then??select 25 patient who had developed chronic severe periodontitis with non-systematic disease to establish group C and give them the basic periodontal therapy only. Observe the changes of the IL-8??IL-10 levels in serum and gingival crevicular fluid and the periodontal infection indexes??BI??PD??. Results The results showed that after three months of basic periodontal therapy the periodontal clinical indices of both group A and group C became better and the IL-8 level obviously reduced??while the IL-10 level obviously increased. There was no obvious difference between group A and group B in each examination index before the therapy. After three months??we found that the periodontal infection index??SBI PD??of group A was obviously better than group B. Compared to group B??the IL-8 level of group A obviously reduced??and the IL-10 level obviously increased. The difference was statistically significant??P < 0.05??. Conclusion The basic periodontal therapy can effectively improve periodontal conditions of the patients with chronic periodontal diseases??and reduce the risk of breaking the normal cardiovascular function. 相似文献
This study is focussed on micro-encapsulation of essential oils in polylactic acid (PLA) and a poly(methyl methacrylate) (PMMA) matrix as well as blends of the same. Microspheres were prepared by the solvent evaporation technique and characterised by scanning electron microscopy (SEM), differential scanning calorimetry (DSC) and Fourier transform infra-red spectroscopy (FTIR). The encapsulation efficiencies and release profiles of the essential oils were studied by gas chromatography mass spectrometry (GC-MS) and head-space solid-phase microextraction GC-MS, respectively. Furthermore, the microspheres were tested for antibacterial activity against both Gram-negative and Gram-positive bacterial strains.
The results showed that the microspheres compositions (PLA/PMMA ratio) have significant effect on their characteristics. The process adopted for preparing the microspheres promoted formation of spherical particles at the sizes of 1.5–9.5?µm. The highest encapsulation efficiency of the prepared microspheres was observed in systems consisting of linalool (81.10?±?10.0?wt. % for PLA system and 76.0?±?3.3?wt. % for PMMA system). Confirmation was also made that the release rate of the microspheres was affected by the size of the same. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.