PurposeTo evaluate the midterm outcomes of percutaneous transluminal renal angioplasty (PTRA) for pediatric renovascular hypertension (RVH).Materials and MethodsThe clinical data of patients who underwent PTRA for RVH in the authors’ hospital from 2012 to 2019 were retrospectively analyzed. Postprocedural blood pressure, glomerular filtration rate (GFR) of the affected kidney, restenosis, and complications were closely monitored.ResultsPTRA was performed in a total of 30 children (20 boys and 10 girls), with a mean age of 7.3 years ± 0.7 (range, 40 days to 13.9 years) and a mean weight of 25.0 kg ± 2.3 (range, 3.4–53 kg). The median follow-up period was 26.5 months (range, 1 month to 7.5 years). Technical success was achieved in 26 (86.7%) of the 30 patients. Restenosis developed in 3 patients (10.0%). Only 1 patient underwent stent implantation, and the stent fractured 8 months later, requiring further intervention. There were no other complications. In terms of clinical benefit of blood pressure control after the initial PTRA procedure, 15 patients (50%) were cured and 7 patients (23.3%) showed improvement. There was no significant difference in the etiology, lesion location, and lesion length between patients with clinical benefit and failure (P = .06, P = .202, and P = .06, respectively). GFR of the affected kidney was significantly improved from 19.9 mL/min ± 11.2 to 38.1 mL/min ± 11.9 at the 6-month follow-up after PTRA (P < .001).ConclusionsThe overall results of PTRA for pediatric RVH caused by different etiologies are promising. PTRA not only provided a clinical benefit of blood pressure control in 73.3% of the patients but also significantly improved the function of the affected kidney. 相似文献
Metformin, a drug for type 2 diabetes mellitus, has shown therapeutic effects for various cancers. However, it had no beneficial effects on the survival rate of human malignant mesothelioma (HMM) patients. The present study was performed to elucidate the underlying mechanism of metformin resistance in HMM cells. Glucose‐starved HMM cells had enhanced resistance to metformin, demonstrated by decreased apoptosis and autophagy and increased cell survival. These cells showed abnormalities in mitochondria, such as decreased ATP synthesis, morphological elongation, altered mitochondrial permeability transition pore and hyperpolarization of mitochondrial membrane potential (MMP). Intriguingly, Mdr1 was significantly upregulated in mitochondria but not in cell membrane. The upregulated mitochondrial Mdr1 was reversed by treatment with carbonyl cyanide m‐chlorophenyl hydrazone, an MMP depolarization inducer. Furthermore, apoptosis and autophagy were increased in multidrug resistance protein 1 knockout HMM cells cultured under glucose starvation with metformin treatment. The data suggest that mitochondrial Mdr1 plays a critical role in the chemoresistance to metformin in HMM cells, which could be a potential target for improving its therapeutic efficacy. 相似文献
Introduction: Immune checkpoint inhibitors (ICI) are now a standard of care in the treatment of many cancers leading to durable responses in patients with metastatic disease. These agents are generally well tolerated but may lead to the occurrence of immune-related adverse events (irAEs). As any organ may be affected, clinicians should be aware of the broad range of clinical manifestations and symptoms and keep in mind that toxicities may occur late, at any point along a patient’s treatment course. Although the most common irAEs are rarely severe, some of them may be associated with great morbidity and even become life-threatening. The rate of occurrence, type and severity of irAEs may vary with the type of ICI; thus, grade 3 and 4 irAEs are reported in more than 55% of patients treated with the combination of ipilimumab 3 mg/kg and nivolumab 1 mg/kg.
Area covered: This review presents the management of irAEs resulting from checkpoint blockade, with a focus on rare irAEs.
Expert commentary: With the development of immuno-oncology and the expanding role of ICI, physicians have learnt to diagnose and treat most of the irAEs that can occur. This review provides an overview of current guidelines, previously published studies and our multidisciplinary team based practices. 相似文献
Although dose reduction of S‐1 is recommended for patients with impaired renal function, dose modification for such patients has not been prospectively evaluated. The aim of the present study was to investigate the pharmacokinetic parameters of 5‐fluorouracil, 5‐chloro‐2,4 dihydroxypyridine and oteracil potassium, and to review the recommended dose modification of S‐1 in patients with renal impairment. We classified patients receiving S‐1 into 4 groups according to their renal function, as measured using the Japanese estimated glomerular filtration rate (eGFR) equation. The daily S‐1 dose was adjusted based on the patient's eGFR and body surface area. Blood samples were collected for pharmacokinetic analysis. A total of 33 patients were enrolled and classified into 4 groups as follows: 10 patients in cohort 1 (eGFR ≥ 80 mL/min/1.73 m2), 10 patients in cohort 2 (eGFR = 50‐79 mL/min/1.73 m2), 10 patients in cohort 3 (eGFR = 30‐49 mL/min/1.73 m2), and 3 patients in cohort 4 (eGFR < 30 mL/min/1.73 m2). Those in cohorts 3 and 4 treated with an adjusted dose of S‐1 showed a similar area under the curve for 5‐fluorouracil (941.9 ± 275.6 and 1043.5 ± 224.8 ng/mL, respectively) compared with cohort 2 (1034.9 ± 414.3 ng/mL). Notably, while there was a statistically significant difference between cohort 1 (689.6 ± 208.8 ng/mL) and 2 (P =0.0474) treated with an equal dose of S‐1, there was no significant difference observed in the toxicity profiles of the cohorts. In conclusion, dose adjustment of S‐1 in patients with impaired renal function using eGFR is appropriate and safe. 相似文献
Introduction: Collaborative interactions between several diverse biological processes govern the onset and progression of breast cancer. These processes include alterations in cellular metabolism, anti-tumor immune responses, DNA damage repair, proliferation, anti-apoptotic signals, autophagy, epithelial-mesenchymal transition, components of the non-coding genome or onco-mIRs, cancer stem cells and cellular invasiveness. The last two decades have revealed that each of these processes are also directly regulated by a component of the cell cycle apparatus, cyclin D1.
Area covered: The current review is provided to update recent developments in the clinical application of cyclin/CDK inhibitors to breast cancer with a focus on the anti-tumor immune response.
Expert opinion: The cyclin D1 gene encodes the regulatory subunit of a proline-directed serine-threonine kinase that phosphorylates several substrates. CDKs possess phosphorylation site selectivity, with the phosphate-acceptor residue preceding a proline. Several important proteins are substrates including all three retinoblastoma proteins, NRF1, GCN5, and FOXM1. Over 280 cyclin D3/CDK6 substrates have b\een identified. Given the diversity of substrates for cyclin/CDKs, and the altered thresholds for substrate phosphorylation that occurs during the cell cycle, it is exciting that small molecular inhibitors targeting cyclin D/CDK activity have encouraging results in specific tumors. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.