ABSTRACTObjective: Dry eye is reported to be associated with several neurological diseases. The aim of this study is to evaluate the patients with hemiplegia after stroke for dry eye and compare their results with a control group. Materials and methods: Forty-five patients with hemiplegia and 45 individuals as the control group were included in the study. Tear function tests (Schirmer and tear breakup time) and a dry eye questionnaire for dry eye symptoms (ocular surface disease index) were performed and the results of the two groups were compared. Results: Schirmer test results were significantly lower in the post-stroke hemiplegia group compared to the control group (11.3 ± 8.2 mm and 20.6 ± 11.6 mm, respectively, p < .001). Tear breakup time results were significantly lower in the post-stroke hemiplegia group compared to the control group (7.9 ± 3.1 s and 12.1 ± 4.3 s, respectively, p < .001). Ocular surface disease index scores were not significantly different between hemiplegia and control groups (21.6 ± 20.0 and 19.8 ± 13.9, respectively, p = .635). Schirmer scores lower than 10 mm (60% and 30%, p < .001) and tear breakup time results lower than 10 s (65.6% and 28.9%, p < .001) were also higher in the hemiplegia group compared to control group. Conclusion: We found lower Schirmer test and tear breakup time results and similar OSDI scores in hemiplegia patients compared to controls. Hemiplegia patients may have dry eye without typical symptoms. This should be taken into consideration in the follow-up and rehabilitation of post-stroke hemiplegia patients. 相似文献
??Objective To discuss the influence of basic periodontal therapy on the level of IL-8?? IL-10 in serum and gingival crevicular fluid in patients who have chronic periodontitis complicated by coronary heart disease. Methods A total of 65 cases of patients with chronic periodontitis complicated by coronary heart disease were selected and divided into two groups randomly??Group A of 35 patients who received the basic periodontal therapy and cardiac medical treatment??Group B of 30 patients who received cardiological treatment only. Then??select 25 patient who had developed chronic severe periodontitis with non-systematic disease to establish group C and give them the basic periodontal therapy only. Observe the changes of the IL-8??IL-10 levels in serum and gingival crevicular fluid and the periodontal infection indexes??BI??PD??. Results The results showed that after three months of basic periodontal therapy the periodontal clinical indices of both group A and group C became better and the IL-8 level obviously reduced??while the IL-10 level obviously increased. There was no obvious difference between group A and group B in each examination index before the therapy. After three months??we found that the periodontal infection index??SBI PD??of group A was obviously better than group B. Compared to group B??the IL-8 level of group A obviously reduced??and the IL-10 level obviously increased. The difference was statistically significant??P < 0.05??. Conclusion The basic periodontal therapy can effectively improve periodontal conditions of the patients with chronic periodontal diseases??and reduce the risk of breaking the normal cardiovascular function. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
Objective: The objective of this study is to evaluate the efficacy and safety of the clearing the lung and dissipating phlegm method in the treatment of acute exacerbation of chronic obstructive pulmonary disease(COPD) and to provide evidence for the treatment of the disease. Materials and Methods: Literature was searched from the United States National Library of Medicine(PubMed), Embase, Cochrane Library, China National Knowledge Infrastructure, Wanfang Database(Wanfang), and the Full?Text Database of Chinese Scientific and Technical Periodicals(VIP).A comprehensive collection was made of randomized controlled trials(RCTs) before June 2018, in which the treatment groups used either the clearing the lung and dissipating phlegm formulas only or combined it with routine Western medicine therapy, and the control group adopted routine Western medicine therapy only for the acute exacerbation of COPD. The Cochrane risk of bias method was used to evaluate the quality of the literature. The data were analyzed and retrieved independently by two reviewers before meta?analysis was carried out with RevMan 5.3 software to evaluate the primary outcome measures, including the total clinical effective rate, and the secondary outcome measures such as the pulmonary function(forced vital capacity [FVC], forced expiratory volume in the 1 s [FEV1], percentage of FEV1 [FEV1%], and FEV1/FVC)and blood gases(PaO_2 and PaCo_2). Results: A total of 13 RCTs involving 990 patients(496 in the treatment group and 494 in the control group)were included in this study. Meta?analysis revealed significant difference in the efficacy of the group that adopted solely the routine Western medicine method and the group that combined the Western medicine with the clearing the lung and dissipating phlegm method. Outcome measures including the pulmonary function(FVC, FEV1, FEV1%, and FEV1/FVC) and the blood gases(PaO_2 and PaCo_2) were significantly improved as compared to the control group(P 0.00001). However, adverse effects in the treatment group using combined traditional Chinese medicine were not reported due to the short observation time of the study. Conclusion: The clearing the lung and dissipating phlegm method can improve the efficacy in the treatment of acute exacerbation of COPD, the outcome measures of the pulmonary function and the blood gases,as well as the life quality of the patients. However, due to the fact that the existing studies are generally of poor quality in which randomization and its implementation were not properly carried out, more high?quality RCTs are necessary to confirm the findings of this study. 相似文献
Background: Gait disorders are common in Parkinson’s disease patients who respond poorly to dopaminergic treatment. Blockade of adenosine A2A receptors is expected to improve gait disorders. Istradefylline is a first-in-class selective adenosine A2A receptor antagonist with benefits for motor complications associated with Parkinson’s disease.
Research design and methods: This multicenter, open-label, single-group, prospective interventional study evaluated changes in total gait-related scores of the Part II/III Movement Disorder Society-Unified Parkinson’s Disease Rating Scale (MDS-UPDRS) and Freezing of Gait Questionnaire (FOG-Q) in 31 Parkinson’s disease patients treated with istradefylline. Gait analysis by portable gait rhythmogram was performed.
Results: MDS-UPDRS Part III gait-related total scores significantly decreased at Weeks 4–12 from baseline with significant improvements in gait, freezing of gait, and postural stability. Significant decreases in MDS-UPDRS Part II total scores and individual item scores at Week 12 indicated improved daily living activities. At Week 12, there were significant improvements in FOG-Q, new FOG-Q, and overall movement per 48 h measured by portable gait rhythmogram. Adverse events occurred in 7/31 patients.
Conclusions: Istradefylline improved gait disorders in Parkinson’s disease patients complicated with freezing of gait, improving their quality of life. No unexpected adverse drug reactions were identified.
Endolymphatic hydrops features excess endolymph in the membranous labyrinth, and is a marker of Menière's disease. Between the early 1980s and late 2000s, MRI in Menière's disease aimed purely to rule out tumor or malformation as differential diagnoses for the pressure disorder. Progress in high-resolution MRI, however, now enables excess endolymph to be visualized in the membranous labyrinth, differentiating saccule and utricle in Menière's disease and in other clinical presentations such as cochleovestibular schwannoma. More recently, non-visibility of the saccule was demonstrated in a subgroup of Menière's disease patients, and utricle atelectasis in case of uni- or bilateral vestibular areflexia. Endolymph quantification remains highly controversial in terms of grading approach, but a simple semiology based on excess or deficient visualization of endolymph according to the compartment sheds light on the pathophysiological mechanisms of cochleovestibular disorder and may in future allow effective monitoring of medical and surgical treatment. 相似文献