Major depressive disorder and other neuropsychiatric disorders are often managed with long-term use of antidepressant medication. Fluoxetine, an SSRI antidepressant, is widely used as a first-line treatment for neuropsychiatric disorders. However, fluoxetine has also been shown to increase the risk of metabolic diseases such as non-alcoholic fatty liver disease. Fluoxetine has been shown to increase hepatic lipid accumulation in vivo and in vitro. In addition, fluoxetine has been shown to alter the production of prostaglandins which have also been implicated in the development of non-alcoholic fatty liver disease. The goal of this study was to assess the effect of fluoxetine exposure on the prostaglandin biosynthetic pathway and lipid accumulation in a hepatic cell line (H4-II-E-C3 cells). Fluoxetine treatment increased mRNA expression of prostaglandin biosynthetic enzymes (Ptgs1, Ptgs2, and Ptgds), PPAR gamma (Pparg), and PPAR gamma downstream targets involved in fatty acid uptake (Cd36, Fatp2, and Fatp5) as well as production of 15-deoxy-Δ12,14PGJ2 a PPAR gamma ligand. The effects of fluoxetine to induce lipid accumulation were attenuated with a PTGS1 specific inhibitor (SC-560), whereas inhibition of PTGS2 had no effect. Moreover, SC-560 attenuated 15-deoxy-Δ12,14PGJ2 production and expression of PPAR gamma downstream target genes. Taken together these results suggest that fluoxetine-induced lipid abnormalities appear to be mediated via PTGS1 and its downstream product 15d-PGJ2 and suggest a novel therapeutic target to prevent some of the adverse effects of fluoxetine treatment. 相似文献
Porcine reproductive and respiratory syndrome virus (PRRSV) and Mycoplasma hyopneumoniae (M. hyopneumoniae, Mhp) are two of the most common pathogens involved in the porcine respiratory disease complex (PRDC) resulting in significant economic losses worldwide. Vaccination is the most effective approach to disease prevention. Since PRRSV and Mhp co-infections are very common, an efficient dual vaccine against these pathogens is required for the global swine industry. Compared with traditional vaccines, multi-epitope vaccines have several advantages, they are comparatively easy to produce and construct, are chemically stable, and do not have an infectious potential. In this study, to develop a safe and effective vaccine, B cell and T cell epitopes of PRRSV-GP5, PRRSV-M, Mhp-P46, and Mhp-P65 protein had been screened to construct a recombinant epitope protein rEP-PM that has good hydrophilicity, strong antigenicity, and high surface accessibility, and each epitope is independent and complete. After immunization in mice, rEP-PM could induce the production of high levels of antibodies, and it had good immunoreactivity with anti-rEP-PM, anti-PRRSV, and anti-Mhp antibodies. The anti-rEP-PM antibody specifically recognizes proteins from PRRSV and Mhp. Moreover, rEP-PM induced a Th1-dominant cellular immune response in mice. Our results showed that the rEP-PM protein could be a potential candidate for the development of a safe and effective multi-epitope peptide combined vaccine to control PRRSV and Mhp infections. 相似文献
MicroRNAs (miRNAs) play important roles in prostate cancer development. However, it remains unclear how individual miRNAs contribute to the initiation and progression of prostate cancer. Here we show that a basal layer‐enriched miRNA is required for prostate tumorigenesis. We identify miR‐205 as the most highly expressed miRNA and enriched in the basal cells of the prostate. Although miR‐205 is not required for normal prostate development and homeostasis, genetic deletion of miR‐205 in a Pten null tumor model significantly compromises tumor progression and does not promote metastasis. In Pten null basal cells, loss of miR‐205 attenuates pAkt levels and promotes cellular senescence. Furthermore, although overexpression of miR‐205 in prostate cancer cells with luminal phenotypes inhibits cell growth in both human and mouse, miR‐205 has a minimal effect on the growth of a normal human prostate cell line. Taken together, we have provided genetic evidence for a requirement of miR‐205 in the progression of Pten null‐induced prostate cancer. 相似文献
This study is focussed on micro-encapsulation of essential oils in polylactic acid (PLA) and a poly(methyl methacrylate) (PMMA) matrix as well as blends of the same. Microspheres were prepared by the solvent evaporation technique and characterised by scanning electron microscopy (SEM), differential scanning calorimetry (DSC) and Fourier transform infra-red spectroscopy (FTIR). The encapsulation efficiencies and release profiles of the essential oils were studied by gas chromatography mass spectrometry (GC-MS) and head-space solid-phase microextraction GC-MS, respectively. Furthermore, the microspheres were tested for antibacterial activity against both Gram-negative and Gram-positive bacterial strains.
The results showed that the microspheres compositions (PLA/PMMA ratio) have significant effect on their characteristics. The process adopted for preparing the microspheres promoted formation of spherical particles at the sizes of 1.5–9.5?µm. The highest encapsulation efficiency of the prepared microspheres was observed in systems consisting of linalool (81.10?±?10.0?wt. % for PLA system and 76.0?±?3.3?wt. % for PMMA system). Confirmation was also made that the release rate of the microspheres was affected by the size of the same. 相似文献
Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献