Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
The common marmoset (Callithrix jacchus) is a useful experimental animal to evaluate the pharmacokinetics of drug candidates. Cytochrome P450 (P450) 2B enzyme in marmoset livers has been identified; however, only limited information on the enzymatic properties and distribution has been available.
Marmoset P450 2B6 amino acids showed high sequence identities (>86%) with those of primates including humans and cynomolgus monkeys. Phylogenetic analysis using amino acid sequences indicated that marmoset P450 2B6 was closer to human and cynomolgus monkey P450 2B6 than to P450 2B orthologs of other species, including pigs, dogs, rabbits and rodents.
Quantitative polymerase chain reaction analysis using specific primers showed P450 2B6 mRNA predominantly expressed in livers among the five marmoset tissues, similar to those of humans and cynomolgus monkeys.
Marmoset P450 2B6 heterologously expressed in Escherichia coli membranes oxidized 7-ethoxycoumarin, pentoxyresorufin, propofol and testosterone, at roughly similar rates to those of humans and/or cynomolgus monkeys. A high capacity of marmoset P450 2B6 with propofol 4-hydroxylation (at low ionic strength conditions) with a low Km value was relatively comparable to that for marmoset livers.
These results collectively indicated a high propofol 4-hydroxylation activity of P450 2B6 expressed in marmoset livers.
Inappropriate use of acetaminophen (APAP) can lead to morbidity and mortality secondary to hepatic necrosis. Ginsenoside Rg1 is a major active ingredient in processed Panax ginseng, which is proved to elicit biological effects. We hypothesized the beneficial effect of Rg1 on APAP-mediated hepatotoxicity was through Nrf2/ARE pathway. The study was conducted in cells and mice, comparing the actions of Rg1. Rg1 significantly improved cell survival rates and promoted the expression of antioxidant proteins. Meanwhile, Rg1 reduced the excessive ROS and the occurrence of cell apoptosis, which were related to Nrf2/ARE pathway. Expression of Nrf2 has a certain cell specificity.
We present data from patients with advanced biliary tract cancer (BTC) receiving pembrolizumab in the KEYNOTE-158 (NCT02628067; phase 2) and KEYNOTE-028 (NCT02054806; phase 1b) studies. Eligible patients aged ≥18 years from both studies had histologically/cytologically confirmed incurable BTC that progressed after standard treatment regimen(s), measurable disease per Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1, Eastern Cooperative Oncology Group performance status 0/1, and no prior immunotherapy. Programmed death ligand 1 (PD-L1)-positive tumors were required for eligibility in KEYNOTE-028 only. Patients received pembrolizumab 200 mg every three weeks (KEYNOTE-158) or 10 mg/kg every two weeks (KEYNOTE-028) for ≤2 years. Primary efficacy endpoint was objective response rate (ORR) by RECIST v1.1. Response assessed by independent central review is reported. KEYNOTE-158 enrolled 104 patients and KEYNOTE-028 enrolled 24 patients. Median (range) follow-up was 7.5 months (0.6-34.3) in KEYNOTE-158 and 5.7 months (0.6-55.4) in KEYNOTE-028. In KEYNOTE-158, ORR was 5.8% (6/104; 95% CI, 2.1%-12.1%); median duration of response (DOR) was not reached (NR) (range, 6.2-26.6+ months). Median (95% CI) OS and PFS were 7.4 (5.5-9.6) and 2.0 (1.9-2.1) months. Among PD-L1-expressers (n = 61) and PD-L1-nonexpressers (n = 34), respectively, ORR was 6.6% (4/61) and 2.9% (1/34). In KEYNOTE-028, ORR was 13.0% (3/23; 95% CI, 2.8%-33.6%); median DOR was NR (range, 21.5-53.2+ months). Median (95% CI) OS and PFS were 5.7 (3.1-9.8) and 1.8 (1.4-3.1) months. Grade 3 to 5 treatment-related adverse events occurred in 13.5% of patients in KEYNOTE-158 (no grade 4; grade 5 renal failure, n = 1) and 16.7% in KEYNOTE-028 (no grade 4/5). In summary, pembrolizumab provides durable antitumor activity in 6% to 13% of patients with advanced BTC, regardless of PD-L1 expression, and has manageable toxicity. 相似文献
Previous studies have shown that neural stem cell transplantation has the potential to treat Parkinson’s disease,but its specific mechanism of action is still unclear.Stromal cell-derived factor-1 and its receptor,chemokine receptor 4(CXCR4),are important regulators of cell migration.We speculated that the CXCR4/stromal cell-derived factor 1 axis may be involved in the therapeutic effect of neural stem cell transplantation in the treatment of Parkinson’s disease.A Parkinson’s disease rat model was injected with 6-hydroxydopamine via the right ascending nigrostriatal dopaminergic pathway,and then treated with 5μL of neural stem cell suspension(1.5×104/L)in the right substantia nigra.Rats were intraperitoneally injected once daily for 3 days with 1.25 mL/kg of the CXCR4 antagonist AMD3100 to observe changes after neural stem cell transplantation.Parkinson-like behavior in rats was detected using apomorphine-induced rotation.Immunofluorescence staining was used to determine the immunoreactivity of tyrosine hydroxylase,CXCR4,and stromal cell-derived factor-1 in the brain.Using quantitative real-time polymerase chain reaction,the mRNA expression of stromal cell-derived factor-1 and CXCR4 in the right substantia nigra were measured.In addition,western blot assays were performed to analyze the protein expression of stromal cell-derived factor-1 and CXCR4.Our results demonstrated that neural stem cell transplantation noticeably reduced apomorphine-induced rotation,increased the mRNA and protein expression of stromal cell-derived factor-1 and CXCR4 in the right substantia nigra,and enhanced the immunoreactivity of tyrosine hydroxylase,CXCR4,and stromal cell-derived factor-1 in the brain.Injection of AMD3100 inhibited the aforementioned effects.These findings suggest that the stromal cell-derived factor-1/CXCR4 axis may play a significant role in the therapeutic effect of neural stem cell transplantation in a rat model of Parkinson’s disease.This study was approved by the Animal Care and Use Committee of Kunming Medical University,China(approval No.SYXKK2015-0002)on April 1,2014. 相似文献
