Discordance Between Clinical and Pathological Staging and Grading in Upper Tract Urothelial Carcinoma

IntroductionThis study aimed to evaluate the concordance in tumor stage and grade between ureteroscopic (URS) biopsy and radical nephroureterectomy (RNU) in patients with upper tract urothelial carcinoma (UTUC).Patients and MethodsRecords of 1,214 UTUC patients who had undergone URS biopsy followed by RNU were included. Univariable and multivariable logistic regression analyses were performed to identify factors contributing to the pathological upstaging.ResultsThe concordance between URS biopsy-based clinical and RNU pathological staging was 34.5%. Clinical understaging occurred in 59.5% patients. Upstaging to muscle-invasive disease occurred in 240 (41.7%) of 575 patients diagnosed with ≤cT1 disease. Of those diagnosed with muscle-invasive disease on final pathology, 89.6% had been clinically diagnosed with ≤cT1 disease. In the univariable analyses, computed tomography urography (CTU)–based invasion, ureter location, hydronephrosis, high-grade cytology, high-grade biopsy, sessile architecture, age, and women sex were significantly associated with pathological upstaging (P < .05). In the multivariable analyses, CTU-based invasion and hydronephrosis remained associated with pathological upstaging (P < .05). URS biopsy-based clinical and pathological gradings were concordant in 634 (54.2%) patients. Clinical undergrading occurred in 496 (42.4%) patients.ConclusionsClinical understaging/undergrading and upstaging to muscle-invasive disease occurred in a high proportion of UTUC patients undergoing RNU. Despite the inherent selection bias, these data underline the challenges of accurate UTUC staging and grading. In daily clinical practice, URS biopsy and CTU offer the most accurate preoperative information albeit with limited predictive value when used alone. These findings should be considered when utilizing preoperative, risk-adapted strategies.     

Clinical Effectiveness of Erlova in EGFR-Mutated Non-Small Cell Lung Cancer: An Affordable Price with Clinical Benefit

Background: Thyrosin kinase inhibitors (TKIs) is approved for the first line treatment of non-small cell lung cancer (NSCLC) patients with  epidermal growth factor receptor (EGFR) mutation. This study performed to assess clinical effectiveness and safety of Erlova (generic form of Erlotinib). Methods: Somatic mutations of EGFR gene were studied in tumor tissue by polymerase chain reaction (PCR) and bi-directional sequencing in 513 chemonaive and histologically verified lung adenocarcinoma Iranian patients. Patients  with EGFR mutation received Erlova at 150 mg/day  as first line treatment. Primary endpoint was progression free survival (PFS). Results: About 21% (n=109) cases had EGFR mutation. Most EGFR mutations were  occurred at exon 19. Among them, sixty nine patients treated with Erlova. Median PFS was 11.4 months and objective response rate (ORR) was about  88%. Most frequent treatment related adverse events was  skin rash. Conclusion: Our findings showed Erlova had remarkable effectiveness. In  mutation-positive patients with EGFR, Erlova can be used  safely instead of  other tyrosine-kinase inhibitors.     

Regulation of glucose transporter-4 intervention with S. saman leaves extract in streptozotocin-induced diabetic rats

Diabetes mellitus is the leading disorder and affects more than millions of people worldwide. Nowadays, the usage of herbal drugs is said to control adiposity and hyperglycemia. The current research investigated the anti-adiposity and antidiabetic activity of S. saman leaf extract and bioactive compounds. Therefore, the results lower the sugar absorption into the blood and reveal the extract's antidiabetic properties. STZ-induced diabetic rats, Samanea saman methanolic extract show improvement in the parameters like fasting blood glucose levels, body weight, other biochemical parameters supported by the histopathological analysis, and an increase in serum levels in the experimental groups. The antioxidant plays a vital role by increasing SOD and catalase activity levels and decreasing lipid peroxidation levels. The methanolic extract protects the tissue from oxidation stress, which is responsible for the glycemic properties. According to the findings, diabetic-treated rats had overnight blood glucose levels lower and near standard biochemical markers. Histopathology of the liver, pancreas, kidneys, and adipose tissues supported the pharmacological observations.Further, we screened and documented S. saman extract used for in vitro and in vivo methods. In terms of effectiveness, the crude extracts exhibit 0.8-fold GLUT4 down-regulation. Consequently, this result contributes to clinical trials and develops antidiabetic therapy as a substitute for synthetic pharmaceuticals.     

The rationality involved in the popular use of coffee (Coffea sp) and sunflower seed (Helianthus annuus) for the treatment of vitiligo: a case report

Introduction: Vitiligo is a dermatological disease that affects about 0.38% to 2.9% of the world population. Currently, the main treatments used for vitiligo involve the use of topical drugs such as corticosteroids and calcineurin inhibitors, phototherapy, systemic treatment with steroids and even surgical grafts and, in acute cases, depigmenting treatments. Natural products are an alternative for the treatment of vitiligo: mamacadela (Brosimum gaudichaudii), a plant rich in furanocoumarins, and sowthistle (Sonchus oleraceus), rich in phenolic substances, are already used to treat vitiligo. There are also popular reports of the use of a preparation containing coffee (Coffea sp) and sunflower seed (Helianthus annuus) to treat vitiligo. Case report: A female patient, 28 years old, diagnosed with vitiligo, reported having obtained a positive result in the repigmentation of the pale white patches after the daily use of a preparation containing coffee and sunflower seed for about one year. Discussion: Data from the scientific literature demonstrated that chemical constituents of these plants, such as chlorogenic acid and its isomers, which have antioxidant and anti-inflammatory action, and substances such as linoleic acid and vitamins E and B, which help in the process of melanin formation on the skin, may be responsible for the observed repigmentation of the patches. Further research on this case report is important for scientific validation and the development of new therapeutic options, especially with less adverse effects, in the treatment of vitiligo.     

Health-Related Quality of Life in Patients Under Treatment With Apixaban in Latin America

Atrial fibrillation (AF) has a strong impact on the quality of life (QOL) of patients and anticoagulation has a lot to do with it. We evaluated the QOL of patients with nonvalvular AF who start treatment with apixaban in Latin America. QOL was analyzed through a questionnaire developed to evaluate anticoagulated patients, which was completed by them 3 months after starting treatment. We included 521 patients from Uruguay, Bolivia, Ecuador, Paraguay, and Peru. A high index of general treatment satisfaction (5.34 ± 0.46) and self-efficacy (5.11 ± 0.68) were observed; the distress index was low (1.77 ± 0.88), as was the perception of daily hassles (1.35 ± 0.49) and strain social network related to medication (1.21 ± 0.34). Patients with AF who started treatment with apixaban has good satisfaction and self-efficacy scores with low index of stress, few daily limitations and social disruptions.     

A novel PAX6 mutation causes congenital aniridia with or without retinal detachment

Background: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6.

Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.

Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).

Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.     

The association among demographic factors,health behaviors and sleep quality in youth with Autism Spectrum Disorder

BackgroundA majority of youth with Autism Spectrum Disorder (ASD) have disrupted sleep patterns, but there has been limited research examining factors associated with sleep in this population. Objective: The objective of this study was to compare demographic and lifestyle behaviors with sleep quality in youth with ASD. Methods: A total of 49 children (12.44 years; 78% male) with ASD wore the Actigraph GT9X accelerometer over seven days and nights to assess moderate to vigorous physical activity (MVPA), sedentary behavior (SB), total sleep duration, and sleep efficiency. Parents reported their child’s weekly amount of screen time and demographic information. Participants were classified according to whether they met sleep criteria for duration and efficiency (8–9 h of sleep duration and ≥85% sleep efficiency). T-tests and ANOVA were used to compare demographic and lifestyle factors between the groups. Results: Participants who meet both sleep duration and efficiency criteria had greater minutes of MVPA per day (113.65 min/day) than participants who only met sleep efficiency criteria (40.27 min/day) and participants who did not meet either sleep criteria (67.5 min/day; p < 0.0001). Additionally, participants who met both sleep criteria had fewer minutes of SB compared to those who only met sleep efficiency criteria (384.79 vs 526.05 min/day; p = 0.02). Conclusions: Youth who had indicators of good sleep quality had greater amounts of MVPA and lower amounts of SB. Studies should further examine the relationship between sleep and health behaviors in youth with ASD to determine causal mechanisms, leading to more effective sleep interventions.