Interleukin-1β gene polymorphisms in Taiwanese patients with gout

The purpose of this study was to examine whether interleukin-1 beta (IL-1) promoter and exon 5 gene polymorphisms are markers of susceptibility or clinical manifestations in Taiwanese patients with gout. The study included 196 patients in addition to 103 unrelated healthy control subjects living in central Taiwan. From genomic DNA, polymorphisms of the gene for IL-1 promoter and IL-1 exon 5 were typed. Allelic frequencies were compared between the two groups, and the relationship between allelic frequencies and clinical manifestations of gout was evaluated. No significant differences were observed in the allelic frequencies of the IL-1 promoter between patients with gout and healthy control subjects. Additionally, we did not detect any association of the IL-1 promoter genotype with the clinical and laboratory profiles of gout patients. However, there was a significant difference between the two groups in terms of hypertriglyceridemia (P=0.0004, ²=12.52, OR 7.14, 95%CI 0.012–0.22). There was also a significant difference in the genotype of IL-1 exon 5 polymorphism between patients with and without hypertriglyceridemia. Results of the present study suggest that polymorphisms of the IL-1 promoter and IL-1 exon 5 are not related to gout patients in central Taiwan.     

Association of polymorphism in the interferon γ gene with IDDM

Summary Cytokines may play importmant roles in the pathogenesis of insulin-dependent diabetes mellitus (IDDM). We analysed a dinucleotide repeat polymorphism within the first intron of the interferon (IFN-) gene in Japanese diabetic patients (175 IDDM and 145 non-insulin-dependent diabetes mellitus) and 267 control subjects. A significant difference was observed in the global allele distribution of the polymorphism between the IDDM and control groups (p=0.039). The difference from the control group was more evident in the patients whose insulin therapy started within 1 year from onset (p=0.006) or in the young-onset (<10 years) patients (p=0.0006). The alleles 3 and 6 were increased in the IDDM patients, and a significant increase in the frequency of the 3/6 genotype was observed in the IDDM patient group (9.1%, RR 2.9, p=0.010), in the patients with initial insulin therapy less than 1 year from onset (10.6%, RR 3.4, p=0.004), or in the young-onset patients (16.7%, RR 5.7, p=0.0003) in comparison to the control subjects (3.4%). There was a tendency towards frequent occurrence of clinical characteristics which reflect young or abrupt onset of diabetes or both, and depletion of insulin secretion capacity in the patients with 3/6 or 6/6 in comparison to the patients with other genotypes. These results suggest that the IFN- gene region may contribute to the pathogenesis of IDDM and could be a genetic marker for IDDM.Abbreviations IDDM Insulin-dependent diabetes mellitus - HLA human leucocyte antigen - IFN- interferon - NIDDM non-insulin-dependent diabetes mellitus - PCR polymerase chain reaction - ICA islet cell antibody - TNF- tumour necrosis factor - IL-1 interleukin-1 - INS insulin gene     

Associations of CYP4A11 gene–gene and gene–smoking interactions with essential hypertension in the male eastern Chinese Han population

Objectives: The aim of this study was to investigate the impact of CYP4A11 single-nucleotide polymorphisms (SNP), additional gene–gene and gene–environment interactions on essential hypertension (EH) risk. Methods: A total of 1648 participants (788 males, 860 females), with a mean age of 56.1 ± 14.1 years old, were selected, including 820 EH patients and 828 normotension subjects. Logistic regression was performed to investigate association of SNPs within CYP4A11 gene with high DBP, high SBP and EH risk, and generalized multifactor dimensionality reduction (GMDR) was used to analyze the gene–gene interaction and gene–smoking interaction. Results: Logistic regression analysis showed that EH risk was significantly higher in carriers of C allele of the rs1126742 polymorphism than those with TT genotype (TC+CC versus TT, adjusted OR (95%CI) = 1.56 (1.24–1.91). In addition, we also found that EH risk was also significantly higher in carriers of G allele of the rs3890011polymorphism than those with CC genotype (CG+ GG versus CC, adjusted OR (95%CI) = 1.31 (1.15–2.03). GMDR analysis indicated a potential gene–gene interaction between rs1126742 and rs3890011 and a gene–environment interaction between rs1126742 and smoking. We found that subjects with TC or CC of rs1126742 and CG or GG of rs3890011genotype have the highest EH risk, OR (95%CI) was 2.52 (1.28–3.57). Smokers with TC or CC of rs1126742 genotype have the highest EH risk, OR (95%CI) was 2.20 (1.28–3.40). Conclusions: Gene–gene interaction between rs1126742 and rs3890011 and gene–environment interaction between rs1126742 and smoking were associated with increased EH risk.     

Apoptosis-related Fas and FasL gene polymorphisms’ associations with knee osteoarthritis

To investigate the associations between Fas and FasL gene polymorphisms and susceptibility to knee osteoarthritis. Genomic DNA was obtained from 146 patients with knee osteoarthritis and 102 healthy controls. Genotype distributions and allelic frequencies of four polymorphisms of Fas (-670 G>A rs1800682, -1377 G>A rs2234767) and FasL (IVS2nt-124 A>G rs5030772, -844 T>C rs763110) genes were compared between the groups. Thereafter, this association was investigated between patients and controls of the same sex. There were significant differences between patients with knee osteoarthritis and controls regarding the genotype distributions and allelic frequencies of Fas-1377 G>A polymorphism (P = 0.0001 and P = 0.005, respectively). The Fas-1377 GG genotype and G allele were significantly more frequent in patients with knee osteoarthritis than in controls. Genotype distributions and allelic frequencies of Fas-670 G>A, FasL-844 T>C, and FasL IVS2nt-124 A>G polymorphisms did not differ between the groups (P > 0.05). However, there were no significant differences between patients and controls of the same sex (P > 0.05). These findings suggest that the Fas-1377 G>A polymorphism in the Fas gene related with apoptosis may contribute to susceptibility to knee osteoarthritis in the Turkish population. There is a need for further studies to evaluate the role of apoptosis in large cohorts.     

The association of TNFRSF1A gene and MEFV gene mutations with adult onset Still’s disease

Adult onset Still’s disease (ASD) is a systemic inflammatory disorder of unknown etiology. ASD is characterized by fever with unknown etiology, rash, arthritis, and involvement of several organ systems. FMF and TRAPS are two important autoinflammatory diseases which characterized with recurrent inflammatory attacks. We aimed in this study to investigate the MEFV gene and TNFRSF1A gene variations in ASD. Twenty consecutive Turkish ASD patients (14 female and 6 male; mean age 38.45 ± 14; mean disease duration 3.3 ± 2.3; mean age of the disease onset 35.1 ± 14.4) and 103 healthy controls of Turkish origin were analyzed. All ASD patients were genotyped for the 4 MEFV mutations (M694V, E148Q, V726A, M680I) and TNFRSF1A gene exon 2–3 and exon 4–5 by using sequence analysis. The healthy controls are genotyped using PCR–RFLP method for intron 4 variation. The results of MEFV gene mutations screening show an increase in the MEFV mutation rate in ASD group, but it was not significantly different (p = 0.442, OR 1.64, 95 % CI 0.409–6.589). T–C polymorphism (rs1800692) was the only variation in the intron 4 of TNFRSF1A gene that we observed at the ASD patients. The frequency of TT genotype was 15 %, TC: 45 %, and CC: 40 % in ASD patients and the frequencies were 22, 41, and 37 % in healthy controls, respectively. When we analyzed the allele difference between both groups, there was no difference (p = 0.54, OR 1.24, 0.619–2.496–2.654). The variations in MEFV may have role in ASD pathogenesis. Our findings suggest that there is no significant association between ASD and TNFRSF1A variations.     

Introduction of novel α1-hemoglobin gene mutation with transfusion-dependent phenotype

Objective and importance: Thalassemia is the most frequently monogenetic disorders around the world that is inherited as a recessive single-gene disease, resulting from mutations in α- or β-globin gene clusters. The aim of this report was to present a new insertional mutation in the α₁ globin gene which causes transfusion-dependent anemia in α-thalassemic patients.

Clinical presentation: Two 5-year-old girls with blood transfusion-dependent α-thalassemia anemia and another girl with moderate α-thalassemia have been presented among patients who have been referred to Hematology and Thalassemia Research Center, Dastgheib Hospital, Shiraz, Iran. They were not relatives. All children were stunted and pale; they were put on regular blood transfusion every 14–21 days.

Intervention: Sequencing of the β-globin gene was normal in all cases and their parents; but, α-globin gene sequencing results were remarkable. An insertion of 21 base pairs (IVS II+3ins (+21nt)(+GACCCGGTCAACTTCAAGGTG) in the α₁-globin gene was detected in all three cases and one of their parents. In two cases, this insertion was accompanied by MED deletion and in one child by POLY A₁ mutation. MED deletion was detected by gap-PCR.

Conclusion: This new 21 base pair insertion cannot affect blood parameters on its own, but can present as continuous blood transfusion-dependent α-thalassemia. Thus, it is important to take this point into account for detecting the carriers, like β-thalassemia carriers, which can present as transfusion-dependent children in parents with α-thalassemia trait.     

The association of single nucleotide P-selectin gene polymorphism with IgA nephropathy

Objective IgA nephropathy is one of the most com- mon form of primary glomerulonephritis throughout the world and a main renal disease which causes renal failure. P-selectin plays an important role in the pathogenesis and development of IgA nephropathy. The purpose of this study is to find a possible relationship between P-selectin gene polymorphism and IgA nephropathy. Methods In this study,a comprehensive P-selectin gene sur-     

Association of IL-18 gene polymorphism (?137C) with arthritis manifestations in SLE: combined effect with IFN gamma gene polymorphism (+874A)

We analyzed the association between single nucleotide polymorphisms in IL-12 and IL-18 genes in disease susceptibility and severity of SLE in Thais. A weak association was observed between A allele of the IL-12 gene at the 3′ untranslated region in SLE patients with proteinuria (OR = 1.89, 95% CI = 1.05–3.40, P = 0.02, Pc = 0.06). In addition, we found a significant association between C allele of IL-18 (−137) with arthritis (OR = 6.88, 95% CI = 1.54–42.93, P = 0.003, Pc = 0.009). The presence of one C allele (C/C+C/G) was associated with significant OR of 8.72 (95% CI = 1.83–56.71, P = 0.001, Pc = 0.003). Interestingly, we found the combined effect between the G/C genotype of IL-18 (−137) and the A/A genotype of IFNG (+874) gene causing susceptibility of arthritis in SLE patients (OR = 13.22, 95% CI = 1.56–291.66, P = 0.004).     

Screening for apolipoprotein E gene mutations in 4 patients with lipoprotein glomerulopathy

Objective To study the mutations of apolipoprotein E (apoE) gene in 4 Chinese lipoprotein glomerulopathy (LPG) patients and their family members, and to investigate the pathogenesis of LPG. Methods Urinalysis was performed on the family members of two patients, and they were screened for the level of serum creatinine, serum lipid and serum lipoprotein. The mutation of apoE     

Mutation of RET gene in Chinese patients with Hirschsprung’s disease

AIM:To investigate the pathogenic mechanism of Hischsprung’s disease(HD)at the molecular level and to elucidate the relationship between RET oncogene and Chinese patients with HD.     

Relation of atrophic gastritis with Helicobacterpylori-CagA^＋ and interleukin-1 gene polymorphisms

AIM： To determine the association of Helicobacter pylori （H pylorl） CagA^＋ infection and pro-inflammatory polymorphisms of the genes interleukin （IL）-IRN and IL-1B with the risk of gastric atrophy and peptic ulcers in a dyspeptic population in Costa Rica, a country with high incidence and mortality of gastric cancer. METHODS： Seven biopsy specimens, a fasting blood sample and a questionnaire concerning nutritional and sociodemographic factors were obtained from 501 consecutive patients who had undergone endoscopy for dyspeptic symptoms. A histopathological diagnosis was made. Pepsinogen concentrations were analyzed by enzyme linked immunosorbent assay （ELISA）. Infection with H pylori CagA^＋ was determined by serology and polymerase chain reaction （PCR）. IL-1B and IL-1RN polymorphisms genotyping was performed by PCRrestriction fragment length polymorphism （PCR-RFIP）and PCR respectively. RESULTS： In this dyspeptic population, 86% were Hpylori positive and of these, 67.8% were positive for CagA. Atrophic antral gastritis （AAG） was associated with CagA^＋ status [odd ratio （OR） = 4.1; P 〈 0.000] and fruit consumption （OR = 0.3; P 〈 0.00）. Atrophic body gastritis （ABG） was associated with pepsinogen PGI/PGII 〈 3.4 （OR = 4.9; P 〈 0.04） and alcohol consumption （OR = 7.3; P 〈 0.02）. Duodenal ulcer was associated with CagA^＋ （OR = 2.9; P 〈 0.04） and smoking （OR = 2.4; P 〈 0.04）. PGI 〈 60 μg/L as well as PGI/PGII 〈 3.4 were associated with CagA^＋. CONCLUSION： In a dyspeptic population in Costa Rica, H pylori CagA^＋ is not associated with ABG, but it is a risk factor for AAG. The pro-inflammatory cytokine poly- morphisms IL-1B ＋ 3945 and IL-1RN are not associated with the atrophic lesions of this dyspeptic population.     

Could utrophin rescue the myocardium of patients with dystrophin gene mutations?

The spontaneous up-regulation of utrophin, observed in dystrophin-deficient skeletal muscle fibers, may decrease the susceptibility of such fibers to necrosis. It has been reported that the utrophin-rescued double-mutant mdx mouse always develops a lethal cardiomyopathy. We report two patients with severe dilated cardiomyopathy due to dystrophin gene mutations: the first was a manifesting Duchenne muscular dystrophy carrier and the second a patient affected with moderate Becker muscular dystrophy. We studied their explanted heart specimen and/or endoImyocardial biopsies by immunohistochemistry and Western blot for both dystrophin and utrophin. Utrophin was found to be over-expressed in these specimens. Our results suggest that in these patients the up-regulation of utrophin in dystrophin-deficient cardiomyocytes was unable to prevent the development of life-threatening myocardial dysfunction. These findings seem to dampen the enthusiasm raised by the prospect of DMD treatment by utrophin rescue in skeletal muscle fibers, as the myocardium would still remain severely affected.     

Correlation of N-myc downstream-regulated gene 1 overexpression with progressive growth of colorectal neoplasm

AIM:To study the function of N-myc downstream-regulatedgene 1(NDRG1)in colorectal cardnogenesis and its correlationwith tumor lymph node metastasis.METHODS:NDRG1 was detected at its protein level byimmunohistochemistry(IHC)and image analysis(IA),andNDRG1 mRNA was detected by in situ hybridization(ISH)in formalin-fixed and paraffin-embedded sections with atotal of 190 specimens including 38 normal colorectalmucosae,31 colorectal adenomas,45 non-metastaticcolorectal carcinomas(CRCs),38 metastatic primary CRCand subsequently regional lymph nodes respectively.Atthe same time,the correlations of NDRG1 with sex,ageof patients and histological types of colorectal carcinomaswere observed.RESULTS:NDRG1 proteins were gradually increased incolorectal carcinogenesis(P<0.05 or P<0.01).There was asignificant difference in the expression of NDRG1 betweennon-metastatic and metastatic CRCs(P<0.05),and thecorrelation was positive(P<0.01,r_5=0.329).However,therewas no obvious difference in the expression of NDRG1between the primary sites of CRCs and that in the metastaticsites of corresponding regional lymph nodes,nor was therean apparent difference in sex,age,and histological types.The expression of NDRG1 mRNA was generally in concordancewith that of NDRG1 protein.CONCLUSION:NDRG1 gene may play an important role incolorectal carcinogenesis.In addition,NDRG1 may be aputative tumor metastasis promoter gene and is regardedas one of the molecular biological markers that can forecastearly metastasis of CRCs.NDRG1 gene in the metastaticsites of regional lymph nodes may preserve its expressioncharacteristics in the primary sites of CRCs to some extent.The expression of NDRG1 is not affected by sex,age andhistological types.The role of NDRG1 in tumor metastaticprocess can be demonstrated by in vivo and in vitro.     

Immunoglobulin Vkappa light chain gene analysis in patients with Sjögren's syndrome

OBJECTIVE: Patients with Sj?gren's syndrome (SS) have characteristic lymphocytic infiltration of the salivary glands with a previously reported predominance of Vkappa-bearing B cells and produce a variety of autoantibodies, indicating that there is a humoral autoimmune component in this syndrome. This study was undertaken to determine whether there are primary deviations of immunoglobulin V gene usage, differences in somatic hypermutation, defects of selection, or indications for perturbances of B cell maturation in SS. METHODS: Individual peripheral B cells from patients with SS were analyzed for their Ig V gene usage, and the findings were compared with results in normal controls. RESULTS: Molecular differences, as reflected by findings in the nonproductive Vkappa repertoire of the patients, were identified by an enhanced usage of Jkappa2 gene segments and a lack of mutational targeting toward RGYW/WRCY sequences compared with controls. A greater usage of Vkappa1 family members and a reduced frequency of Vkappa3 gene segments in the productive repertoire suggested differences in selection, possibly driven by antigen. Overall positive selection for mutations, especially for replacements in the complementarity-determining region and for mutations in RGYW/WRCY, similar to that found in controls, was detected. CONCLUSION: Disturbances of strictly regulated B cell maturation, during early B cell development as indicated by prominent Jkappa2 gene usage and during germinal center reactions as indicated by a lack of targeting of the hypermutation mechanism, might contribute to the emergence of autoimmunity in SS.     

Abnormal β-catenin gene expression with invasiveness of primary hepatocellular carcinoma in China

AIM To study the abnormal expression of β-catenin gene and its relationship with invasiveness of primary hepatocellular carcinoma among Chinese people. METHODS Thirty-four hepatocellular carcinoma (HCC) specimens and adjacent para-cancerous tissues, 4 normal liver tissues were immunohistochemically stained to study subcellular distribution of β-catenin. Semiquantitive analysis of expression of β-catenin gene exon 3 mRNA was examined by RT-PCR and in situ hybridization. The relationship between expressions of both β-catenin protein, mRNA and clinicopathological characteristics of HCC was also analyzed. RESULTS Immunohistochemistry showed that all normal liver tissues and para-cancerous tissues examined displayed membranous type staining for β-catenin protein,occasionally with weak expression in the cytoplasm.While 21 cases (61.8%) of HCC examined showed accumulated type in cytoplasms or nuclei. The accumuled type Labling Index (LI) of cancer tissue and paracancarous tissue was (59.9 ± 26.3) and (18.3 ± 9.7)respectively (P＜0.01). Higher accumulated type LI was closely related with invasiveness of HCC. Results of RTPCR showed the β-catenin gene exon 3 mRNA Expression Index (El) of 34 HCCs was higher than that of paracancerous tissue and normal liver tissue. Using in situ hybridization, the signal corresponding to β-catenin gene exon 3 mRNA was particularly strong in cytoplasm of HCC when compared with those of para-cancerous and normal liver tissues. Over expression of β-catenin exon 3 was also found to be correlated with high metastatic potential of HCC. CONCLUSION Abnormal expression of β-catenin gene may contribute importantly to the invasiveness of HCC among Chinese people.