Material and methods: One Spanish family with confirmed XLRP was studied for mutations using direct sequencing. A genotype-phenotype correlation with pathologic myopia (PM) is detailed.
Results: A new pathogenic mutation in the third exon of the RP GTPase regulator (RPGR) was identified: a variant c212C>G (pSER71*). This mutation appears as a hemizygous variant in the male proband with RP, and as heterozygous variant in the females of this pedigree who invariably exhibit symmetrical PM in both eyes.
Conclusion: A complete family history allowed determination of the inheritance pattern providing genetic counseling for patients and their families. The geno-phenotypic attributes of this heterozygosity suggest a correlation between RP and PM. This novel mutation would expand the mutation spectrum of RP2 and RPGR, and help to study molecular pathogenesis of RP. 相似文献
Materials and Methods: Observational case series. Patients underwent complete ocular examinations as well as retinal imaging and electroretinography.
Results: Both patients had electroretinographic evidence of retinal dysfunction/degeneration in addition to optic atrophy with an otherwise normal-appearing retina.
Conclusions: Some patients with Wolfram syndrome have a mild retinal degeneration that may be a manifestation of the neuronal involvement that is present in this condition. 相似文献
Materials and Methods: Patients’ DNA was analyzed using a next‐generation sequencing (NGS) panel of genes involved in albinism and related pathologies (TYR, OCA2, TYRP1, SLC45A2, SLC24A5, C10ORF11, GPR143, SLC38A8, HPS 1 to 10, LYST, MITF, FRMD7)
Results: We report a 4 generation family with 5 affected members initially referred for molecular diagnosis of ocular albinism. A missense variant of FRMD7 was found in 3 affected cases and one female carrier. We show that the disease in the affected girl is due to skewed inactivation of the X chromosome.
Conclusions: By compiling all the published cases we discuss the variable penetrance among females due to different types of mutation and to X-inactivation. 相似文献
Methods: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression.
Results: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD).
Conclusions: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation. 相似文献
Methods: In a prospective study, patients with AH underwent OCTA and FFA. AH graded as Grade 1 in 8 (optic disc, second order vessels visible), Grade 2 in 4 (optic disc, first-order vessels visible), Grade 3 in 11 (hazy view of optic disc) and Grade 4 (no view of fundus) in 2 eyes.
Results: A total of 20 patients (25 eyes) with AH were included. In comparison to FFA, OCTA was able to similarly detect Diabetic Retinopathy changes such as Neovascularization, microaneurysms, capillary dropout, and foveal avascular zone extent in vascular occlusion in all grades of AH.
Conclusion: OCTA, a noninvasive imaging tool, could detect various retinal vascular and macular abnormalities in patients with all grades of AH in comparison to FFA. 相似文献
Methods: Case report
Result: A 42-year-old Indian male diagnosed with PCT and history of daily intake of alcohol, presented with sudden decrease in vision of right eye. Examination showed perforated cornea surrounded by rim of 360-degree avascular necrotic sclera, with no evidence of infection.
Similar systemic history was present in his elder brother. He did not consume alcohol and presented with mere localized scleral thinning. Since the patient’s sibling acted as a natural control for the evaluation of alcohol as an independent risk factor, the difference in severity of disease can be explained on the basis of difference in alcohol intake.
Conclusion: In the presence of progression of the disease, other risk factors like intake of alcohol should be evaluated. 相似文献
Methods: A comprehensive literature review has been performed regarding XEN implant and its use on glaucoma management. Forty-two articles were checked and 37 were found to be relevant. Out of them, 21 were excluded as being case reports and reviews and the remaining 16 were eligible for the purpose of our review.
Results: There was a significant reduction in intraocular pressure as well as in the number of medications needed in glaucoma patients treated with XEN implant either alone or combined with cataract surgery. In addition, combination of XEN implant with Baerveldt tubes has been shown to be beneficial in cases of refractory glaucoma, although complications may be present in this technique. Moreover, uveitic glaucoma may be a potential application of XEN implant.
Conclusions: XEN implant devices have been developed as a surgical alternative for glaucomatous patients and are expected to play an important role in the management of glaucoma in the future. 相似文献
Methods: A 14-year-old child with V pattern left exotropia, bilateral IO overaction, bilateral dissociated vertical deviation (DVD), and strabismic amblyopia (OS) underwent recess/resect procedure along with IOAT. He developed consecutive esotropia and drooping of upper eyelid with marked limitation of levoelevation (?4). Differential diagnoses of antielevation syndrome and adherence syndrome were considered.
On surgical exploration, forced duction test (FDT) was positive for elevation, left inferior oblique (LIO) muscle insertion was found anterior to the inferior rectus (IR) insertion along with fat adhesions which were released and IO muscle was reattached 3 mm behind and 2 mm lateral to IR insertion, along with advancement of left lateral rectus.
Results: Following resurgery, the patient had six prisms left esophoria and a hypotropia 9 prisms, with minimal limitation of levoelevation (?1). One month later, it was seen that the hypotropia had increased to 18 prism diopters and limitation of elevation was ?2.
Conclusions: Adherence syndrome is a rare and severe complication of IO weakening procedures. The initial postoperative improvement achieved in elevation and hypotropia in primary position was not maintained over subsequent follow-ups. 相似文献
Materials and Methods: Retinal images from 28 males and 28 females with X-linked Alport syndrome, and 13 individuals with autosomal recessive disease were reviewed retrospectively for microvascular/ hypertensive retinopathy (Wong and Mitchell classification), and small vessel calibre (using a computerised semiautomated method and revised Knudtson formula). Data were compared with age and gender-matched individuals with normal blood pressure and renal function.
Results: Microvascular/hypertensive retinopathy was more common in males and females with X-linked Alport syndrome than age- and gender-matched controls (23, 82% and 10, 36%, p < 0.01; and 21, 75% and 13, 48%, p = 0.05, respectively), and in individuals with autosomal recessive disease compared with controls (12, 92% and 16, 43%, p < 0.01). Moderate microvascular/hypertensive changes were present in males and females with X-linked or autosomal recessive disease but not controls.
Arteriolar calibre was reduced in males with X-linked disease (142.5 ± 18.7 µm, and 150.7 ± 10.1 µm, p = 0.046) and in autosomal recessive disease (133.5 ± 11.10 µm and 149.1 ± 10.6 µm, p < 0.0001).
Microvascular/hypertensive retinopathy and arteriolar narrowing in males with X-linked disease were not different after renal transplantation and before (p NS).
Conclusions: Microvascular/hypertensive retinopathy was more common and more severe in Alport syndrome than normotensive controls. Improved BP levels may further slow the rate of renal functional decline in Alport syndrome. 相似文献
Methods: The study involved five family members, consisting of three siblings and their parents. All members underwent comprehensive eye examinations for best corrected visual acuity, axial length and refractive error, electroretinography (ERG), fundus photography, retinal fluorescein angiography (FA), and optical coherence tomography (OCT). Clinical exome sequencing of more than 6,000 clinically relevant genes (SureSelect Focused Exome, Agilent) was performed using the Illumina HiSeq 3000 system. Candidate variants were validated and segregated by Sanger sequencing.
Results: The affected siblings had bilateral shortening of the posterior ocular segment and normal anterior segment dimensions. The fundoscopy, ERG, and FA results were compatible with RP. Macular OCT analysis revealed schisis of the outer retinal layer. Our data analysis pipeline identified a homozygous frameshift mutation in exon 5 of the membrane frizzled-related protein (MFRP) gene (c.498delC; p.Asn167Thrfs*25).
Conclusion: Our study confirmed the association of PM with RP as an autosomal recessive syndrome. Although this has previously been described, it seems that there are some constant (i.e., PM and RP) and some variable features (i.e., optic nerve drusen and foveoschisis). The MFRP mutation has also been detected in other studies associating PM with RP. Analysis of a larger series of cases at the clinical and genetic levels would certainly help us to better understand the phenotype-genotype correlations of this syndrome. 相似文献
Methods: Retrospective case series.
Results: A 13-year-old Emirati boy was referred for low vision. The parents felt he was blind at birth but noted improvement with time. Retinal examination was significant for central macula horizontal ovoid discoloration as was documented for young adults with homozygous peripherin mutations in the one previous report. Electroretinography revealed cone-rod dysfunction. Both asymptomatic parents were examined and found to have central macular abnormalities. Sanger sequencing of peripherin based on clinical features uncovered the pathogenic variant c.659G>A; p.Arg22Gln (NM_000322.4) in homozygosity in the child and in heterozygosity in each parent. Exome sequencing in the child excluded pathologic variants in other retinal dystrophy genes.
Conclusions: The experience with this family highlights clinical features suggestive for biallelic peripherin mutations, documents cone-rod dysfunction as associated with homozygosity for the p.Arg220Gln peripherin mutation, and is an example of how examination of family members can help to guide genetic testing. 相似文献
Materials and methods: Ophthalmic examination included visual acuity measurement, intraocular pressure (IOP) measurements, slit-lamp biomicroscopy, B-scan ultrasonography, Ultrasound biomicroscopy (UBM), spectral-domain optical coherence tomography (SD-OCT), ERG and retcam fluorescein angiogram. In addition, blood samples were taken from this patient for mutation analyze of GJA1.
Result: The ophthalmic features of this patient were microcornea, cornea opacity, glaucoma as expected. Interestingly, the patient had a normal axial length with refractive status of emmetropia, but extremely retinal dysplasia and severe choroid thinning was noted. Flash electroretinogram (ERG) was extinguished in both eyes. This study identified a novel mutation c.91A>T in the GJA1 gene associated with fundus abnormalities. Bioinformatics and structural modeling suggested the mutation to be pathogenic.
Conclusion: Our research expanded not only the mutation spectrum, but also the clinical characteristics of ODDD. To the best of our knowledge, this is the first report on anatomical and functional chorioretinal changes in ODDD patients. These novel ocular features highlight the importance of fundus morphological and functional evaluation in ODDD.
Abbreviations: ODDD: oculodentodigital dysplasia; OCT: optical coherence tomography; ERG: electroretinogram; TACT: teller acuity card test; UBM: ultrasound biomicroscopy; MW: molecular weights; AL: axial length; Cx43: connexin 43; RPE: retinal pigment epithelium; RGCs: retinal ganglion cells; FEVR: familial exudative vitreoretinopathy; ROP: retinopathy of prematurity 相似文献
A 31-year-old male presented in our clinic with gradual, painless, progressive proptosis in the left eye since 28 years associated with gradual loss of vision. The left eye showed gross proptosis. Ocular structures could not be made out. Computed tomography scan showed a well-circumscribed oval heterogeneous mixed solid and cystic lesion completely filling the left orbit with calcification. The differential diagnosis was that of either teratoma or optic nerve glioma.
The patient underwent excision of the lesion. Histopathology revealed a capsulated tumor with multiple cystic components filled with blood and eosinophilic material suggestive of a dermoid cyst.
Non-germinomatous germ cell tumors may present atypically in adults and neglected benign dermoid cysts can attain massive size mimicking malignant lesions. 相似文献
Methods: A single proband of European ancestry with spherophakia and high myopia was subjected to exome sequencing. Proteins containing the ASPH hydroxylation motif were identified within the SwissProt protein database.
Results: We identified 105 putative substrates of ASPH-mediated hydroxylation in the human proteome, of which two (fibrillin-1 and latent transforming growth factor beta binding protein-2) are associated with inherited ectopia lentis syndromes, and are essential for microfibril and ciliary zonule development.
Conclusion: Our results implicate ASPH-mediated hydroxylation in the formation of FBN1/LTBP2 microfibril bundles and competent ciliary zonules. 相似文献
Methods: This is a retrospective review of patients referred to a tertiary care center for external beam radiation treatment of biopsy proven localized periocular light chain amyloidosis. The primary outcome measure was clinical disease stability at one year following radiation therapy as evidenced by slit lamp exam and external photography. Pre and post radiation MRI imaging of the affected area were also used as a means to monitor disease progression.
Results: Four symptomatic patients with localized periocular AL amyloidosis received external beam radiation therapy ranging from 20–30 Gy fractioned over 10–20 fractions. Three of the four patients had prior surgical debulking with or without ptosis repair. Amyloid deposition did not progress in any patient at one year. Further follow-up of two patients revealed amyloid progression at two years post radiation.
Conclusions: External beam radiation therapy for localized periocular AL amyloidosis demonstrated efficacy at halting disease progression at one year; however, the long-term efficacy is unknown. Monitoring of periocular amyloid is best achieved with slit lamp exam and external photography as opposed to MRI. 相似文献
Purpose: To confirm the pathogenicity of a novel mutation in NR2E3 using electrophysiological studies.
Materials and Methods: Patient underwent detailed clinical evaluation and ophthalmic imaging followed by next generation sequencing analysis and electrophysiological studies.
Results: We describe a case of a young man of Greek descent with a family history of retinal degeneration. His fundal features at presentation were atypical of ESCS, with striking macular involvement in both eyes, including fibrotic subretinal material overlying the pigment epithelial detachment in one eye and schisis in the other. Genetic testing revealed a novel homozygous variant in NR2E3 gene of uncertain pathogenicity. Instead of performing further genetic analyses, electrophysiological studies showed pathognomonic changes in the S-cone response.
Conclusions: With the recent clinical endorsement of a gene therapy for RPE65 related-inherited retinal degeneration it is of paramount importance to correctly identify the pathogenic genetic mutation. In this particular syndrome, we highlight the value of electrophysiology to confirm the pathogenicity of a novel mutation in NR2E3 and aid the diagnosis of ESCS, with potential for gene therapy in the future. 相似文献
Methods: Life and work of Giovanni Francesco Barbieri was analyzed and interpreted based on selective literature research of books and journal articles via PubMed, Google Scholar, and Google.
Results: As squinters use mostly only one eye as the other eye is amblyopic, it could be expected that their paintings would be more or less two dimensional.
Already at the age of seven, Barbieri showed great talent in drawing and painting. At age 17, he started his education at the famous Bologna school. Barbieri was very productive, leaving behind, at his death,106 large altarpieces and 144 other paintings. During his lifetime, he was well accepted, sought after, and quite wealthy. In analyzing a selection of Barbieri’s work, one is amazed at how detailed the artist was in depicting chiaroscuro in his paintings to present a three-dimensional picture.
Conclusions: Barbieri did not make a secret of the dysfunction of his eyes. In contrast, he showed his squinting eye distinctly in his famous self-portrait from ca. 1635. It can be assumed that “Il Guercino” was so detailed in studying light and shadow with his one eye that he could compensate for his amblyopic eye. By this, Barbieri could create pictures with an amazing degree of variations of light and shadow. 相似文献
Materials and Methods: Twenty-eight affected children (25 LCA, three EORD) and their immediate family members, totaling 52 individuals (30 affected) from 22 families, were sequenced. Whole exome sequencing was performed on all affected individuals. Available parents were analyzed either by whole exome sequencing (WES) or Sanger sequencing to determine transmission.
Results: All affected individuals demonstrated compound heterozygous or homozygous mutations in known Inherited Retinal Disease (IRD) associated genes. Twelve variants were identified in at least one individual in three genes, RDH12, RPE65, and USH2A. Four recurrent RPE65 mutations were observed in 97% of individuals and 95% of families. All patients with LCA and two of the three individuals with EORD had biallelic mutations in RPE65; one child with EORD had a homozygous RDH12 mutation.
Conclusions: These data suggest that the majority of LCA/EORD in Costa Rica is due to four founder mutations in RPE65 which have been maintained in this genetically isolated population. This finding is of great clinical significance due to the availability of gene therapy recently approved in the US and European Union for patients with biallelic RPE65 defects. 相似文献
Material and Methods: We identified from our records 23 patients with retinal dystrophy and IRCS who had been treated with topical and/or oral carbonic anhydrase inhibitors. All subjects had regular follow-up with OCT and previous genetic testing.
Results: We identified four (17%) patients who experienced a bilateral and symmetrical paradoxical improvement in IRCS size and visual acuity after discontinuation of carbonic anhydrase inhibitors. Two were mutations in RS1, one in CLN3 and another in NR2E3. All patients were followed for at least three years (range 39–63 months). None had systemic abnormalities.
Conclusions: Patients with IRCS may exhibit a paradoxical response after discontinuation of carbonic anhydrase inhibitors. Although the pathophysiology of these phenomena is unclear, stopping treatment may be an option in patients who cease to improve or get worse on treatment. 相似文献